Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,

supplementary information

Figure S1 ZEB1 full length mrna. (a) Analysis of the ZEB1 mrna using the UCSC genome browser (http://genome.ucsc.edu) revealed truncation of the annotated Refseq sequence (NM_030751). The probable terminus

Supplementary Table, Figures and Videos

Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo

Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts

Article Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts Graphical Abstract Authors Jurian Schuijers, Jan Philipp Junker,..., Alexander van Oudenaarden, Hans Clevers

Supplemental Figure 1.

Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection

Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction)

Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG

Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat

Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat units in the human genome. Annotated transposable elements

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 antibody. HCT116 cells were reverse transfected with sicontrol

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

embryos. Asterisk represents loss of or reduced expression. Brackets represent

Supplemental Figures Supplemental Figure 1. tfec expression is highly enriched in tail endothelial cells (A- B) ISH of tfec at 15 and 16hpf in WT embryos. (C- D) ISH of tfec at 36 and 38hpf in WT embryos.

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray

Supplementary Figures Montero et al._supplementary Figure 1

Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres

Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.

Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements

Supplemental Figure 1 A

Supplemental Figure A prebleach postbleach 2 min 6 min 3 min mh2a.-gfp mh2a.2-gfp mh2a2-gfp GFP-H2A..9 Relative Intensity.8.7.6.5 mh2a. GFP n=8.4 mh2a.2 GFP n=4.3 mh2a2 GFP n=2.2 GFP H2A n=24. GFP n=7.

of NOBOX. Supplemental Figure S1F shows the staining profile of LHX8 antibody (Abcam, ab41519), which is a

SUPPLEMENTAL MATERIALS AND METHODS LHX8 Staining During the course of this work, it came to our attention that the NOBOX antibody used in this study had been discontinued. There are a number of other nuclear

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,

Supplementary Information

Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

Nature Methods: doi: /nmeth.4396

Supplementary Figure 1 Comparison of technical replicate consistency between and across the standard ATAC-seq method, DNase-seq, and Omni-ATAC. (a) Heatmap-based representation of ATAC-seq quality control

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/8/362/ra12/dc1 Supplementary Materials for FOXP1 potentiates Wnt/β-catenin signaling in diffuse large B cell lymphoma Matthew P. Walker, Charles M. Stopford, Maria

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic

Nature Genetics: doi: /ng Supplementary Figure 1

Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs

Zhang et al., RepID facilitates replication Initiation. Supplemental Information:

Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the

Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C

CORRECTION NOTICE Nat. Genet. 47, 598 606 (2015) Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C Borbala Mifsud, Filipe Tavares-Cadete, Alice N Young, Robert Sugar,

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two

Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)

Supplementary Tables. Primers and probes. Target Primer / probe sequences Chemistry Human HBB F: AACTGTGTTCACTAGCAACCTCAAA

Supplementary Tables Primers and probes Target Primer / probe sequences Chemistry H F: AACTGTGTTCACTAGCAACCTCAAA promoter R: ACAGGGCAGTAACGGCAGACT H Downstream Actb alpha (162) alpha (162.) (Pro) (16)

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS Suppl. Fig. 1. Notch and myostatin expression is unaffected in the absence of p65 during postnatal development. A & B. Myostatin and Notch-1 expression levels were determined

SUPPLEMENTARY INFORMATION

Figure S1: Activation of the ATM pathway by I-PpoI. A. HEK293T cells were either untransfected, vector transfected, transfected with an I-PpoI expression vector, or subjected to 2Gy γ-irradiation. 24 hrs

Isolation of single-base genome-edited human ips cells without

Nature Methods Isolation of single-base genome-edited human ips cells without antibiotic selection Yuichiro Miyaoka, Amanda H. Chan, Luke M. Judge, Jennie Yoo, Miller Huang, Trieu D. Nguyen, Paweena P.

Supplementary Information

Supplementary Information Table of contents: Pages: Supplementary Methods 2-3 Supplementary Figure 1 4 Supplementary Figure 2 5 Supplementary Figure 3 6 Supplementary Figure 4 7 Supplementary Figure 5

Wnt16 smact merge VK/AB

A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

Supplemental Data. Zhou et al. (2016). Plant Cell /tpc

Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV

Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1

INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot

Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage

Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage differentiation. Monocytes were transfected with either a scrambled

Nature Genetics: doi: /ng Supplementary Figure 1

Supplementary Figure 1 Characterization of Hi-C/CHi-C dynamics and enhancer identification. (a) Scatterplot of Hi-C read counts supporting contacts between domain boundaries. Contacts enclosing domains

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish

Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae

Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb

Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,

Supplementary Figures

Supplementary Figures Supplementary Figure 1 Experimental schema for the identification of circular RNAs in six normal tissues and seven cancerous tissues. Supplementary Fiure 2 Comparison of human circrnas

supplementary information

DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

Design. Construction. Characterization

Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

Nature Methods: doi: /nmeth Supplementary Figure 1. Construction of a sensitive TetR mediated auxotrophic off-switch.

Supplementary Figure 1 Construction of a sensitive TetR mediated auxotrophic off-switch. A Production of the Tet repressor in yeast when conjugated to either the LexA4 or LexA8 promoter DNA binding sequences.

AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between

AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

Supplementary Material

Supplementary Material Supplementary Table 1: Luciferase assay primer sequences rs7090445 Forward 5-3 AATCCCAGGTGCTTATGGACA rs7090445 Reverse 5-3 TGAGCCGAGATTGCACCATT rs7896246 Forward 5-3 GTGTCCAGGAACTCCCAAGG

Suppl. Table S1. Characteristics of DHS regions analyzed by bisulfite sequencing. No. CpGs analyzed in the amplicon. Genomic location specificity

Suppl. Table S1. Characteristics of DHS regions analyzed by bisulfite sequencing. DHS/GRE Genomic location Tissue specificity DHS type CpG density (per 100 bp) No. CpGs analyzed in the amplicon CpG within

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived

Supplemental Information

Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

Supplementary Table S1

Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

Xu et al., Supplementary Figures 1-7

Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to

SUPPLEMENTARY INFORMATION

SUPPLEMENTRY INFORMTION DOI:.38/ncb Kdmb locus kb Long isoform Short isoform Long isoform Jmj XX PHD F-box LRR Short isoform XX PHD F-box LRR Target Vector 3xFlag Left H Neo Right H TK LoxP LoxP Kdmb Locus

Supplementary Methods

Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

Supplementary Fig. S1. Building a training set of cardiac enhancers. (A-E) Empirical validation of candidate enhancers containing matches to Twi and

Supplementary Fig. S1. Building a training set of cardiac enhancers. (A-E) Empirical validation of candidate enhancers containing matches to Twi and Tin TFBS motifs and located in the flanking or intronic

DIAMANTINA INSTITUTE for Cancer, Immunology and Metabolic Medicine

DIAMANTINA INSTITUTE for Cancer, Immunology and Metabolic Medicine Defining MYB Transcriptional Network by Genome-wide Chromatin Occupancy Profiling (ChIP-Seq) 2010 E.Glazov, L. Zhao Transcription Factors:

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity.

Supplementary Figure 1 Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity. (a) ESTIMATE immune score from mrna expression array

Supplemental material

Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

Figure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles

Spermatazoa. Sertoli cells. Morc1 WT adult. Morc1 KO adult. Morc1 WT P14.5. Morc1 KO P14.5. Germ cells. Germ cells. Spermatids.

a. Spermatazoa Sertoli cells Morc1 WT adult c. Morc1 KO adult Morc1 WT P1.5 Morc1 KO P1.5 Morc1 WT adult Morc1 KO adult Germ cells Germ cells Spermatids Spermatozoa Supplementary Figure 1. Confirmation

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations

Nature Genetics: doi: /ng Supplementary Figure 1. High-confidence PRC2 targets and candidate PREs.

Supplementary Figure 1 High-confidence PRC2 targets and candidate PREs. (a) Flowchart for identification of candidate Arabidopsis PREs. We identified 1504 genomic regions marked by at least 3 of the following:

Supplementary Information

Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion

Figure S1. Replication initiation sites at efficient ORIs do not coincide with nucleosomedepleted

Figure S1. Replication initiation sites at efficient ORIs do not coincide with nucleosomedepleted regions in the mouse genome. Typical examples of SNS profiles (Cayrou et al., 11) and nucleosome occupancies

Supplementary Figure Legends

Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The

TRIM31 is recruited to mitochondria after infection with SeV.

Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

Nature Biotechnology: doi: /nbt.4166

Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

- 1 - Supplemental Data

- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression

Partial list of differentially expressed genes from cdna microarray, comparing MUC18-

Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18

Supplementary Table 1: Oligo designs. A list of ATAC-seq oligos used for PCR.

Ad1_noMX: Ad2.1_TAAGGCGA Ad2.2_CGTACTAG Ad2.3_AGGCAGAA Ad2.4_TCCTGAGC Ad2.5_GGACTCCT Ad2.6_TAGGCATG Ad2.7_CTCTCTAC Ad2.8_CAGAGAGG Ad2.9_GCTACGCT Ad2.10_CGAGGCTG Ad2.11_AAGAGGCA Ad2.12_GTAGAGGA Ad2.13_GTCGTGAT

Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death

SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam

GT-rich promoters can drive RNA pol II transcription and deposition of H2A.Z in African trypanosomes

GT-rich promoters can drive RNA pol II transcription deposition of H2A.Z in African trypanosomes Carolin Wedel, Konrad U. Förstner, Ramona Derr T. Nicolai Siegel Appendix Table of Contents Appendix Materials

Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum. Blood-stage Development

Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum Blood-stage Development Painter et al. 1 of 8 Supplementary Figure 1: Supplementary Figure

DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000

Supplemental Information. Antagonistic Activities of Sox2. and Brachyury Control the Fate Choice. of Neuro-Mesodermal Progenitors

Developmental Cell, Volume 42 Supplemental Information Antagonistic Activities of Sox2 and Brachyury Control the Fate Choice of Neuro-Mesodermal Progenitors Frederic Koch, Manuela Scholze, Lars Wittler,

The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells

Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,

Document S1. Supplemental Experimental Procedures and Three Figures (see next page)

Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas

Nature Methods: doi: /nmeth Supplementary Figure 1. Schematics of SAM, dcas9-suntag and dcas9-vpr.

Supplementary Figure 1 Schematics of SAM, dcas9-suntag and dcas9-vpr. (a) Schematics of SAM. SAM consists of two chimeric proteins, dcas9 fused with VP64 and MS2-coat protein fused with p65 and HSF1 activator

The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells.

Supplemental Materials Materials & Methods Generation of RRPA and RAPA Knock-in Mice The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells. Targeted ES clones in which the

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

Supplementary Figure 1.

Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

Supporting Information

Supporting Information Ho et al. 1.173/pnas.81288816 SI Methods Sequences of shrna hairpins: Brg shrna #1: ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgacgnttttg (TRCN71383; Open Biosystems). Brg shrna

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The

i-stop codon positions in the mcherry gene

Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom

Figure S1. nuclear extracts. HeLa cell nuclear extract. Input IgG IP:ORC2 ORC2 ORC2. MCM4 origin. ORC2 occupancy

A nuclear extracts B HeLa cell nuclear extract Figure S1 ORC2 (in kda) 21 132 7 ORC2 Input IgG IP:ORC2 32 ORC C D PRKDC ORC2 occupancy Directed against ORC2 C-terminus (sc-272) MCM origin 2 2 1-1 -1kb

Intracellular receptors specify complex patterns of gene expression that are cell and gene

SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin