Control of Gene Expression

Size: px
Start display at page:

Download "Control of Gene Expression"

Transcription

1 Control of Gene Expression 1

2 How Gene Regulation Works 2

3 Control of Gene Expression Controlling gene expression is often accomplished by controlling transcription initiation Regulatory proteins bind to DNA May block or stimulate transcription Prokaryotic organisms regulate gene expression in response to their environment Eukaryotic cells regulate gene expression to maintain homeostasis in the organism 3

4 Regulatory Proteins Gene expression is often controlled by regulatory proteins binding to specific DNA sequences Regulatory proteins gain access to the bases of DNA at the major groove Regulatory proteins possess DNA-binding motifs 4

5 Prokaryotic regulation Control of transcription initiation Positive control increases frequency of initiation of transcription Activators enhance binding of RNA polymerase to promoter Negative control decreases frequency Repressors bind to operators in DNA 5

6 Prokaryotic cells often respond to their environment by changes in gene expression Genes involved in the same metabolic pathway are organized in operons Induction enzymes for a certain pathway are produced in response to a substrate Repression capable of making an enzyme but does not 6

7 lac operon Contains genes for the use of lactose as an energy source -b-galactosidase (lacz), permease (lacy), and transacetylase (laca) Gene for the lac repressor (laci) is linked to the rest of the lac operon 7

8 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. CAP-binding site Promoter for I gene PI Gene for repressor protein I CAP P lac Regulatory region Promoter for lac operon O Operator Genefor ß-galactosidase Z Gene for permease Y Gene for transacetylase A lac Control system Coding region 8

9 The lac operon is negatively regulated by a repressor protein lac repressor binds to the operator to block transcription In the presence of lactose, an inducer molecule (allolactose) binds to the repressor protein Repressor can no longer bind to operator Transcription proceeds Even in the absence of lactose, the lac operon is expressed at a very low level 9

10 Glucose repression Preferential use of glucose in the presence of other sugars Mechanism involves activator protein that stimulates transcription Catabolic activator protein (CAP) is an allosteric protein with camp as effector Level of camp in cells is reduced in the presence of glucose so that no stimulation of transcription from CAP-responsive operons takes place Inducer exclusion presence of glucose inhibits the transport of lactose into the cell 10

11 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Glucose Low, Inducer Present, Promoter Activated DNA Allolactose CAP camp camp CAP binds to DNA Glucose level is low camp is high CAPbinding site camp Repressor will not bind to DNA mrna a. camp activates CAP by causing a conformation change RNA polymerase is not blocked and transcription can occur 11

12 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Glucose High, Inducer Absent, Promoter Not Activated Glucose is available camp level is low CAP does not bind Repressor binds to DNA Effector site is empty, and there is no conformation change RNA polymerase is blocked by the lac repressor b. 12

13 trp operon Genes for the biosynthesis of tryptophan The operon is not expressed when the cell contains sufficient amounts of tryptophan The operon is expressed when levels of tryptophan are low trp repressor is a helix-turn-helix protein that binds to the operator site located adjacent to the trp promoter 13

14 The trp operon is regulated by the trp repressor protein trp repressor binds to the operator to block transcription Binding of repressor to the operator requires a corepressor which is tryptophan Low levels of tryptophan prevent the repressor from binding to the operator 14

15 Tryptophan repressor Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Tryptophan 3.4 nm 15

16 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Tryptophan Absent, Operon Derepressed trp repressor cannot bind to DNA Inactive trp repressor (No tryptophan present) Operator mrna Translation E D C B A Enzymes for tryptophan synthesis produced a. Gene for trp repressor Promoter for trp operon RNA polymerase is not blocked, and transcription can occur 16

17 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Tryptophan Present, Operon Repressed Tryptophan Tryptophan binds to repressor, causing a conformation change Repressor conformation change allows it to bind to the operator RNA polymerase is blocked by the trp repressor, and transcription cannot occur Enzymes for tryptophan synthesis not produced Gene for trp repressor b. 17

18 Eukaryotic Regulation Control of transcription more complex Major differences from prokaryotes Eukaryotes have DNA organized into chromatin Complicates protein-dna interaction Eukaryotic transcription occurs in nucleus Amount of DNA involved in regulating eukaryotic genes much larger 18

19 Transcription factors General transcription factors Necessary for the assembly of a transcription apparatus and recruitment of RNA polymerase II to a promoter TFIID recognizes TATA box sequences Specific transcription factors Increase the level of transcription in certain cell types or in response to signals 19

20 Interactions of various factors Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. RNA Polymerase II B TAFs F TFIID E Transcribed region H TATA box A Core promoter 20

21 Promoters form the binding sites for general transcription factors Mediate the binding of RNA polymerase II to the promoter Enhancers are the binding site of the specific transcription factors DNA bends to form loop to position enhancer closer to promoter 21

22 Enhancers Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Activator Transcription factor RNA polymerase Transcribed region Promoter Enhancer TATA box mrna synthesis 22

23 Transcription complex Few general principles Nearly every eukaryotic gene represents a unique case Great flexibility to respond to many signals Virtually all genes that are transcribed by RNA polymerase II need the same suite of general factors to assemble an initiation complex 23

24 Transcription complex Enhancers Coding region Activator Enhancer Coactivator Activator B General factors TAFs TFIID F E RNA polymerase II Activators These regulatory proteins bind to DNA at distant sites known as enhancers. When DNA folds so that the enhancer is brought into proximity with the initiation complex, the activator proteins interact with the complex to increase the rate of transcription. Coactivators H These transcription factors stabilize the transcription complex by bridging activator proteins with the complex. A General Factors These transcription factors position RNA polymerase at the start of a protein-coding sequence and then release the polymerase to initiate transcription. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 24

25 Eukaryotic chromatin structure Structure is directly related to the control of gene expression DNA wound around histone proteins to form nucleosomes Nucleosomes may block access to promoter Histones can be modified to result in greater condensation 25

26 Methylation once thought to play a major role in gene regulation Many inactive mammalian genes are methylated Lesser role in blocking accidental transcription of genes turned off Histones can be modified Correlated with active versus inactive regions of chromatin Can be methylated found in inactive regions Can be acetylated found in active regions 26

27 Condensed solenoid Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Nucleosomes can block the binding of RNA polymerase II to the promoter Amino acid histone tail N-terminus Addition of acetyl groups to histone tails remodel the solenoid so that DNA is accessible for transcription Acetyl group DNA available for transcription 27

28 Chromatin-remodeling complexes Large complex of proteins Modify histones and DNA Also change chromatin structure ATP-dependent chromatin remodeling factors Function as molecular motors Catalyze 4 different changes in DNA/histone binding Make DNA more accessible to regulatory proteins 28

29 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. ATP ADP+ P i ATP-dependent remodeling factor 1. Nucleosome sliding 2. Remodeled nucleosome 3. Nucleosome displacement 4. Histone replacement 29

30 Posttranscriptional Regulation Control of gene expression usually involves the control of transcription initiation Gene expression can be controlled after transcription with Small RNAs mirna and sirna Alternative splicing RNA editing mrna degradation 30

31 Protein Degradation Proteins are produced and degraded continually in the cell Lysosomes house proteases for nonspecific protein digestion Proteins marked specifically for destruction with ubiquitin Degradation of proteins marked with ubiquitin occurs at the proteasome 31

32 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Ubiquitin Protein to be destroyed ATP ADP + P i Destroyed by proteolysis 32

33 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Degradation Polypeptide fragments Ubiquitination Proteasome ATP ADP + P i Ubiquitin ADP + P i ATP Targeted protein ADP ATP Ubiquitin ligase 33

GENE REGULATION IN PROKARYOTES

GENE REGULATION IN PROKARYOTES GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

Regulation of Gene Expression

Regulation of Gene Expression Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Regulation of Gene Expression

Regulation of Gene Expression CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION

More information

Regulation of gene expression. (Lehninger pg )

Regulation of gene expression. (Lehninger pg ) Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

REGULATION OF GENE EXPRESSION

REGULATION OF GENE EXPRESSION REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the

More information

Lecture 9 Controlling gene expression

Lecture 9 Controlling gene expression Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around

More information

7.1 The lac Operon 7-1

7.1 The lac Operon 7-1 7.1 The lac Operon The lac operon was the first operon discovered It contains 3 genes coding for E. coli proteins that permit the bacteria to use the sugar lactose Galactoside permease (lacy) which transports

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

EUKARYOTIC GENE CONTROL

EUKARYOTIC GENE CONTROL EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION

More information

I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon:

I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon: I. Prokaryotic Gene Regulation Figure 1: Operon Operon: a) Regulatory Elements consist of an Operator that serves as the on-off switch for the genes of the operon. Also contains a promoter for the Structural

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Transcription in Prokaryotes. Jörg Bungert, PhD Phone:

Transcription in Prokaryotes. Jörg Bungert, PhD Phone: Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes 3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

More information

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11 Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide

More information

Spring 2006 Biochemistry 302 Exam 2

Spring 2006 Biochemistry 302 Exam 2 Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one

More information

Gene Regulation in Eukaryotes

Gene Regulation in Eukaryotes Gene Regulation in Eukaryotes The latest estimates are that a human cell, a eukaryotic cell, contains 20,000 25,000 genes. Some of these are expressed in all cells all the time. These so-called housekeeping

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Twitter: @PlantDevTUM, #genetiktum FB: Plant Development TUM Prof. Dr. Claus Schwechheimer

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary

More information

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological

More information

Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license.

Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license. Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license. 2013, Rice University. CHAPTER 16 GENE EXPRESSION 429 16 GENE EXPRESSION

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors

More information

Read the question carefully before answering. Think before you write. If I can not read your handwriting, I will count the question wrong.

Read the question carefully before answering. Think before you write. If I can not read your handwriting, I will count the question wrong. Name KEY Note Total points added up to only 98 points so everyone received 2 free points to make total points 100. Biology 201 (Genetics) Exam #3 23 November 2004 Read the question carefully before answering.

More information

Structure/function relationship in DNA-binding proteins

Structure/function relationship in DNA-binding proteins PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA

More information

The Regulation of Bacterial Gene Expression

The Regulation of Bacterial Gene Expression The Regulation of Bacterial Gene Expression Constitutive genes are expressed at a fixed rate Other genes are expressed only as needed Inducible genes Repressible genes Catabolite repression Pre-transcriptional

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Chromatin and Transcription

Chromatin and Transcription Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation

More information

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Chapter 4: How Cells Work

Chapter 4: How Cells Work Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Eukaryotic & Prokaryotic Transcription. RNA polymerases

Eukaryotic & Prokaryotic Transcription. RNA polymerases Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Wednesday, November 22, 17. Exons and Introns

Wednesday, November 22, 17. Exons and Introns Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Chem 465 Biochem II Test 3

Chem 465 Biochem II Test 3 Chem 465 Biochem II Test 3 Name: Multiple choice 4 points each. 1. Which of the following are features of the wobble hypothesis? A) A trna can recognize only one codon. B) Some trnas can recognize codons

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Genetics Biology 331 Exam 3B Spring 2015

Genetics Biology 331 Exam 3B Spring 2015 Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Contents 1 The Lactose Intolerance of Bacteria 2 The Lac Operon 3 Lac Operon Simulation 4 LacZ as a reporter gene The Lactose Intolerance of Bacteria The standard growth kinetics

More information

Chapter 31. Transcription and RNA processing

Chapter 31. Transcription and RNA processing Chapter 31 Transcription and RNA processing RNA polymerase (RNAP) E. coli promoters Components of E. coli RNA Polymerase Holoenzyme (α 2 ββ'ωσ) Structure of prokaryotic RNAP The closed and open state of

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

Exam 2 BIO200, Winter 2012

Exam 2 BIO200, Winter 2012 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.

More information

Regulatory Dynamics in Engineered Gene Networks

Regulatory Dynamics in Engineered Gene Networks Regulatory Dynamics in Engineered Gene Networks The Physico-chemical Foundation of Transcriptional Regulation with Applications to Systems Biology Mads Kærn Boston University Center for BioDynamics Center

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Practice Question for Prokaryotic and Eukaryotic Gene Regulation Lectures Winter 2009 Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) CREBs

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Information Readout: Transcription and Post-transcriptional Processing Translation

Information Readout: Transcription and Post-transcriptional Processing Translation Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter

Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA

More information

Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung. Priyambodo, M.Sc. staff.unila.ac.id/priyambodo

Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung. Priyambodo, M.Sc. staff.unila.ac.id/priyambodo Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung Priyambodo, M.Sc. staff.unila.ac.id/priyambodo Prokariotik Eukariotik staff.unila.ac.id/priyambodo Regulasi ekspresi gen pada

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Hole s Essentials of Human Anatomy & Physiology

Hole s Essentials of Human Anatomy & Physiology Hole s Essentials of Human Anatomy & Physiology David Shier Jackie Butler Ricki Lewis Created by Dr. Melissa Eisenhauer Head Athletic Trainer/Assistant Professor Trevecca Nazarene University Amended by

More information

Topic 7: Nucleic acids and proteins

Topic 7: Nucleic acids and proteins Topic 7: Nucleic acids and proteins Topic 7: Nucleic acids and proteins 7.1 DNA structure Assessment Statement IBO Notes Student Notes 7.1.1 7.1.2 7.1.3 7.1.4 7.1.5 Describe the structure of DNA, including

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Chapter Fundamental Molecular Genetic Mechanisms

Chapter Fundamental Molecular Genetic Mechanisms Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Eukaryotic Transcription

Eukaryotic Transcription Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).

More information

Genetics Lecture Notes Lectures 17 19

Genetics Lecture Notes Lectures 17 19 Genetics Lecture Notes 7.03 2005 Lectures 17 19 Lecture 17 Gene Regulation We are now going to look at ways that genetics can be used to study gene regulation. The issue is how cells adjust the expression

More information

Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,

Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Chromatin Structure and its Effects on Transcription

Chromatin Structure and its Effects on Transcription Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not

More information

12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:

12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall: 12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how

More information

Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome

Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas

More information

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above 1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex

More information

AP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET

AP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET AP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of heat-killed

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert

More information

DNA Transcription. Visualizing Transcription. The Transcription Process

DNA Transcription. Visualizing Transcription. The Transcription Process DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Chromatin. Structure and modification of chromatin. Chromatin domains

Chromatin. Structure and modification of chromatin. Chromatin domains Chromatin Structure and modification of chromatin Chromatin domains 2 DNA consensus 5 3 3 DNA DNA 4 RNA 5 ss RNA forms secondary structures with ds hairpins ds forms 6 of nucleic acids Form coiling bp/turn

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information