Control of Gene Expression
|
|
- Edith Underwood
- 6 years ago
- Views:
Transcription
1 Control of Gene Expression 1
2 How Gene Regulation Works 2
3 Control of Gene Expression Controlling gene expression is often accomplished by controlling transcription initiation Regulatory proteins bind to DNA May block or stimulate transcription Prokaryotic organisms regulate gene expression in response to their environment Eukaryotic cells regulate gene expression to maintain homeostasis in the organism 3
4 Regulatory Proteins Gene expression is often controlled by regulatory proteins binding to specific DNA sequences Regulatory proteins gain access to the bases of DNA at the major groove Regulatory proteins possess DNA-binding motifs 4
5 Prokaryotic regulation Control of transcription initiation Positive control increases frequency of initiation of transcription Activators enhance binding of RNA polymerase to promoter Negative control decreases frequency Repressors bind to operators in DNA 5
6 Prokaryotic cells often respond to their environment by changes in gene expression Genes involved in the same metabolic pathway are organized in operons Induction enzymes for a certain pathway are produced in response to a substrate Repression capable of making an enzyme but does not 6
7 lac operon Contains genes for the use of lactose as an energy source -b-galactosidase (lacz), permease (lacy), and transacetylase (laca) Gene for the lac repressor (laci) is linked to the rest of the lac operon 7
8 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. CAP-binding site Promoter for I gene PI Gene for repressor protein I CAP P lac Regulatory region Promoter for lac operon O Operator Genefor ß-galactosidase Z Gene for permease Y Gene for transacetylase A lac Control system Coding region 8
9 The lac operon is negatively regulated by a repressor protein lac repressor binds to the operator to block transcription In the presence of lactose, an inducer molecule (allolactose) binds to the repressor protein Repressor can no longer bind to operator Transcription proceeds Even in the absence of lactose, the lac operon is expressed at a very low level 9
10 Glucose repression Preferential use of glucose in the presence of other sugars Mechanism involves activator protein that stimulates transcription Catabolic activator protein (CAP) is an allosteric protein with camp as effector Level of camp in cells is reduced in the presence of glucose so that no stimulation of transcription from CAP-responsive operons takes place Inducer exclusion presence of glucose inhibits the transport of lactose into the cell 10
11 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Glucose Low, Inducer Present, Promoter Activated DNA Allolactose CAP camp camp CAP binds to DNA Glucose level is low camp is high CAPbinding site camp Repressor will not bind to DNA mrna a. camp activates CAP by causing a conformation change RNA polymerase is not blocked and transcription can occur 11
12 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Glucose High, Inducer Absent, Promoter Not Activated Glucose is available camp level is low CAP does not bind Repressor binds to DNA Effector site is empty, and there is no conformation change RNA polymerase is blocked by the lac repressor b. 12
13 trp operon Genes for the biosynthesis of tryptophan The operon is not expressed when the cell contains sufficient amounts of tryptophan The operon is expressed when levels of tryptophan are low trp repressor is a helix-turn-helix protein that binds to the operator site located adjacent to the trp promoter 13
14 The trp operon is regulated by the trp repressor protein trp repressor binds to the operator to block transcription Binding of repressor to the operator requires a corepressor which is tryptophan Low levels of tryptophan prevent the repressor from binding to the operator 14
15 Tryptophan repressor Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Tryptophan 3.4 nm 15
16 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Tryptophan Absent, Operon Derepressed trp repressor cannot bind to DNA Inactive trp repressor (No tryptophan present) Operator mrna Translation E D C B A Enzymes for tryptophan synthesis produced a. Gene for trp repressor Promoter for trp operon RNA polymerase is not blocked, and transcription can occur 16
17 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Tryptophan Present, Operon Repressed Tryptophan Tryptophan binds to repressor, causing a conformation change Repressor conformation change allows it to bind to the operator RNA polymerase is blocked by the trp repressor, and transcription cannot occur Enzymes for tryptophan synthesis not produced Gene for trp repressor b. 17
18 Eukaryotic Regulation Control of transcription more complex Major differences from prokaryotes Eukaryotes have DNA organized into chromatin Complicates protein-dna interaction Eukaryotic transcription occurs in nucleus Amount of DNA involved in regulating eukaryotic genes much larger 18
19 Transcription factors General transcription factors Necessary for the assembly of a transcription apparatus and recruitment of RNA polymerase II to a promoter TFIID recognizes TATA box sequences Specific transcription factors Increase the level of transcription in certain cell types or in response to signals 19
20 Interactions of various factors Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. RNA Polymerase II B TAFs F TFIID E Transcribed region H TATA box A Core promoter 20
21 Promoters form the binding sites for general transcription factors Mediate the binding of RNA polymerase II to the promoter Enhancers are the binding site of the specific transcription factors DNA bends to form loop to position enhancer closer to promoter 21
22 Enhancers Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Activator Transcription factor RNA polymerase Transcribed region Promoter Enhancer TATA box mrna synthesis 22
23 Transcription complex Few general principles Nearly every eukaryotic gene represents a unique case Great flexibility to respond to many signals Virtually all genes that are transcribed by RNA polymerase II need the same suite of general factors to assemble an initiation complex 23
24 Transcription complex Enhancers Coding region Activator Enhancer Coactivator Activator B General factors TAFs TFIID F E RNA polymerase II Activators These regulatory proteins bind to DNA at distant sites known as enhancers. When DNA folds so that the enhancer is brought into proximity with the initiation complex, the activator proteins interact with the complex to increase the rate of transcription. Coactivators H These transcription factors stabilize the transcription complex by bridging activator proteins with the complex. A General Factors These transcription factors position RNA polymerase at the start of a protein-coding sequence and then release the polymerase to initiate transcription. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 24
25 Eukaryotic chromatin structure Structure is directly related to the control of gene expression DNA wound around histone proteins to form nucleosomes Nucleosomes may block access to promoter Histones can be modified to result in greater condensation 25
26 Methylation once thought to play a major role in gene regulation Many inactive mammalian genes are methylated Lesser role in blocking accidental transcription of genes turned off Histones can be modified Correlated with active versus inactive regions of chromatin Can be methylated found in inactive regions Can be acetylated found in active regions 26
27 Condensed solenoid Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Nucleosomes can block the binding of RNA polymerase II to the promoter Amino acid histone tail N-terminus Addition of acetyl groups to histone tails remodel the solenoid so that DNA is accessible for transcription Acetyl group DNA available for transcription 27
28 Chromatin-remodeling complexes Large complex of proteins Modify histones and DNA Also change chromatin structure ATP-dependent chromatin remodeling factors Function as molecular motors Catalyze 4 different changes in DNA/histone binding Make DNA more accessible to regulatory proteins 28
29 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. ATP ADP+ P i ATP-dependent remodeling factor 1. Nucleosome sliding 2. Remodeled nucleosome 3. Nucleosome displacement 4. Histone replacement 29
30 Posttranscriptional Regulation Control of gene expression usually involves the control of transcription initiation Gene expression can be controlled after transcription with Small RNAs mirna and sirna Alternative splicing RNA editing mrna degradation 30
31 Protein Degradation Proteins are produced and degraded continually in the cell Lysosomes house proteases for nonspecific protein digestion Proteins marked specifically for destruction with ubiquitin Degradation of proteins marked with ubiquitin occurs at the proteasome 31
32 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Ubiquitin Protein to be destroyed ATP ADP + P i Destroyed by proteolysis 32
33 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Degradation Polypeptide fragments Ubiquitination Proteasome ATP ADP + P i Ubiquitin ADP + P i ATP Targeted protein ADP ATP Ubiquitin ligase 33
GENE REGULATION IN PROKARYOTES
GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationCHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationRegulation of Gene Expression
Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationRegulation of Gene Expression
CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION
More informationRegulation of gene expression. (Lehninger pg )
Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationREGULATION OF GENE EXPRESSION
REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the
More informationLecture 9 Controlling gene expression
Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around
More information7.1 The lac Operon 7-1
7.1 The lac Operon The lac operon was the first operon discovered It contains 3 genes coding for E. coli proteins that permit the bacteria to use the sugar lactose Galactoside permease (lacy) which transports
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationEUKARYOTIC GENE CONTROL
EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION
More informationI. Prokaryotic Gene Regulation. Figure 1: Operon. Operon:
I. Prokaryotic Gene Regulation Figure 1: Operon Operon: a) Regulatory Elements consist of an Operator that serves as the on-off switch for the genes of the operon. Also contains a promoter for the Structural
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationTranscription in Prokaryotes. Jörg Bungert, PhD Phone:
Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More information32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes
3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de
More informationResources. This lecture Campbell and Farrell's Biochemistry, Chapter 11
Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide
More informationSpring 2006 Biochemistry 302 Exam 2
Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one
More informationGene Regulation in Eukaryotes
Gene Regulation in Eukaryotes The latest estimates are that a human cell, a eukaryotic cell, contains 20,000 25,000 genes. Some of these are expressed in all cells all the time. These so-called housekeeping
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Twitter: @PlantDevTUM, #genetiktum FB: Plant Development TUM Prof. Dr. Claus Schwechheimer
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors
More informationChem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary
More informationChapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological
More informationChapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license.
Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license. 2013, Rice University. CHAPTER 16 GENE EXPRESSION 429 16 GENE EXPRESSION
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors
More informationRead the question carefully before answering. Think before you write. If I can not read your handwriting, I will count the question wrong.
Name KEY Note Total points added up to only 98 points so everyone received 2 free points to make total points 100. Biology 201 (Genetics) Exam #3 23 November 2004 Read the question carefully before answering.
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationThe Regulation of Bacterial Gene Expression
The Regulation of Bacterial Gene Expression Constitutive genes are expressed at a fixed rate Other genes are expressed only as needed Inducible genes Repressible genes Catabolite repression Pre-transcriptional
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationChromatin and Transcription
Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation
More informationName_BS50 Exam 3 Key (Fall 2005) Page 2 of 5
Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationEukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationChem 465 Biochem II Test 3
Chem 465 Biochem II Test 3 Name: Multiple choice 4 points each. 1. Which of the following are features of the wobble hypothesis? A) A trna can recognize only one codon. B) Some trnas can recognize codons
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationGenetics Biology 331 Exam 3B Spring 2015
Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationProkaryotic Transcription
Prokaryotic Transcription Contents 1 The Lactose Intolerance of Bacteria 2 The Lac Operon 3 Lac Operon Simulation 4 LacZ as a reporter gene The Lactose Intolerance of Bacteria The standard growth kinetics
More informationChapter 31. Transcription and RNA processing
Chapter 31 Transcription and RNA processing RNA polymerase (RNAP) E. coli promoters Components of E. coli RNA Polymerase Holoenzyme (α 2 ββ'ωσ) Structure of prokaryotic RNAP The closed and open state of
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationExam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationCHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES
CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.
More informationRegulatory Dynamics in Engineered Gene Networks
Regulatory Dynamics in Engineered Gene Networks The Physico-chemical Foundation of Transcriptional Regulation with Applications to Systems Biology Mads Kærn Boston University Center for BioDynamics Center
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Practice Question for Prokaryotic and Eukaryotic Gene Regulation Lectures Winter 2009 Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) CREBs
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationPlant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter
Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA
More informationMatakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung. Priyambodo, M.Sc. staff.unila.ac.id/priyambodo
Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung Priyambodo, M.Sc. staff.unila.ac.id/priyambodo Prokariotik Eukariotik staff.unila.ac.id/priyambodo Regulasi ekspresi gen pada
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationHole s Essentials of Human Anatomy & Physiology
Hole s Essentials of Human Anatomy & Physiology David Shier Jackie Butler Ricki Lewis Created by Dr. Melissa Eisenhauer Head Athletic Trainer/Assistant Professor Trevecca Nazarene University Amended by
More informationTopic 7: Nucleic acids and proteins
Topic 7: Nucleic acids and proteins Topic 7: Nucleic acids and proteins 7.1 DNA structure Assessment Statement IBO Notes Student Notes 7.1.1 7.1.2 7.1.3 7.1.4 7.1.5 Describe the structure of DNA, including
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationEukaryotic Transcription
Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).
More informationGenetics Lecture Notes Lectures 17 19
Genetics Lecture Notes 7.03 2005 Lectures 17 19 Lecture 17 Gene Regulation We are now going to look at ways that genetics can be used to study gene regulation. The issue is how cells adjust the expression
More informationName Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,
AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationChromatin Structure and its Effects on Transcription
Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not
More information12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:
12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how
More informationChapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome
Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas
More informationValue Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above
1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex
More informationAP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET
AP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of heat-killed
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationReading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationChromatin. Structure and modification of chromatin. Chromatin domains
Chromatin Structure and modification of chromatin Chromatin domains 2 DNA consensus 5 3 3 DNA DNA 4 RNA 5 ss RNA forms secondary structures with ds hairpins ds forms 6 of nucleic acids Form coiling bp/turn
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationKEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More information