SUPPLEMENTARY INFORMATION
|
|
- Jonathan Booker
- 6 years ago
- Views:
Transcription
1 Results Construct purification and coupling. Two A1-GP1bα ReaLiSM constructs, with and without cysteine residues near the N and C-termini (Fig. S2a), were expressed and purified by Ni affinity chromatography (Fig. S2b) and Superdex 200 gel filtration (Fig. S2c). ReaLiSM constructs both with and without cysteines were coupled to DNA (Fig. S2d). Only the construct with cysteines yielded handle-protein-handle product, whereas handle-handle byproduct was seen with both constructs, demonstrating specific DNA coupling to the introduced cysteines (Fig. S2d). Furthermore, only the construct with cysteines showed a band shifted to higher molecular weight with antibody to GP1bα (Fig. S2d). Note that the gels are stained for nucleic acid with SYBR green, and therefore only nucleic acid or nucleic acid-protein complexes are visualized. At slower rates of laser trap movement, multiple extension and contraction events were sometimes observed in a single cycle (Fig. S3). 1
2 Figure S1. Conceptual summary. Schematic model of flexed and extended states of the A1-GP1bα flex-bond, showing direction of tensile force (horizontal arrows), and estimated constants for conversion between the two states of the receptor-ligand bond (k 21 and k 12 ) and off-rates in absence of force (k 1off 0 and k 2off 0 and mechanical properties of the bonds showing how much force exponentiates off-rates (σ1 and σ2). A1 is shown in cyan, GP1ba in magenta, and a linker polypeptide that fuses them together as a grey curved line. 2
3 Figure S2. ReaLiSM construct design, purification, and coupling to DNA handles. a. Schematic design of covalently tethered VWF A1-GPIbα constructs. Constructs with N and C-terminal cysteines for coupling to DNA handles (protein construct) or without the added cysteines (control protein construct) were expressed and purified. Each construct was expressed and purified similarly. b. Protein purification using Ni-NTA affinity chromatography. All three fractions of the elution (column volumes 1-3) were concentrated and applied to the S200 size exclusion column. c. Purification on Superdex S200. Lanes 1-4 represent successive even-numbered fractions from the gel filtration column. The fraction shown in lane 3 was used for coupling to DNA handles. Panels b and c show nonreducing SDS 10% PAGE and Coomassie Blue staining; markers are in lane M. d. Protein coupling to DNA handles. Coupled material, with or without a mab to GPIbα (mab 6D1, from Dr. B. Coller, Rockefeller U., New York, NY) to assay a shift in migration, was subjected to electrophoresis in 4-20% native gels and stained with SYBR green nucleic acid gel stain. 3
4 Figure S3. Force-extension trace for one cycle of force increase (black) and decrease (red) for a representative cycle in which multiple unbinding and binding events were seen at 5 nm/s. Receptor-ligand unbinding and binding events are highlighted in yellow. Bead position (Z bead ) is calculated from trap position (Z trap ) as Z bead = Z trap - F/k, with an average stiffness k from several different beads. 4
5 Figure S4. The effect of the linker in A1-GP1bα ReaLiSM constructs. All results in the main text are with the 43-residue linker, except where a 26-residue linker is noted. (a) Fit of receptor-ligand extension (unbinding) data to the WLC model. Data is as shown in main text Fig. 1f, with the addition of data on the 26-residue linker (green symbols) and fit to WLC model (red line). This fit yielded a persistence length of 0.6 nm and contour length of 10.6 ± 0.6 nm. The expected contour length of 11.8 nm is calculated as the linker length of 26 residues times an extension of 3.8 Å/residue (9.9 nm), plus the N to C- terminal distances in the A1 (1.9 nm) and GPIbα (7.0 nm) crystal structures, minus the distance between the N-terminus of A1 and C-terminus of GPIbα in the complex structure (7.0 nm). (b and c) Distribution of unbinding forces with a 43-residue linker (b) and 26-residue linker (c). Error bars show Poisson noise as h k (h k is bin height). Loading rate averages and SD are over all rupture events at pulling rate. Curves show the predicted rupture force distributions using the constants estimated in Fig. 2g. 5
6 Figure S5. a. Extension over representative 60 s periods at pn. b. Segmentation of the extension data into bound and unbound intervals. 6
7 Figure S6. Comparison of off rates determined using different systems. Data from this publication on the A1-linker-GPIbα fusion protein- DNA handle ReaLiSM construct are shown in black open or filled symbols. Black lines show fits of this data to the Bell model. The circle with gray fill is from 1, and shows bulk phase measurements of soluble A1 domain dissociation from GPIbα on beads or on platelets (k off of and s - 1 ). Fitting of our data on k 1off at different forces to the Bell equation (dashed line) extrapolates to a k 1off 0 of s -1, close to the bulk phase results. Blue symbols show data from Fig. 2a of 2, on dissociation of A1 domains physically adsorbed to polystyrene Petri dishes from GPIbα (glycocalicin) physically adsorbed to atomic force microscope cantilevers. No fits to force spectroscopy dynamics equations were reported in 2 ; the blue dashed and solid lines are visual fits of their data to straight lines. The fit of the catch bond regime (dashed line) extrapolates to a k off 0 of 10 s -1, more than three orders of magnitude away from the ReaLiSM and bulk phase results. 7
8 Table S1. Estimates of flex-bond kinetics at three different forces. All four rates were estimated by fitting bond survival data (Fig. 3f to h) to equations S2-S4. Estimates with reasonable confidence intervals are obtained for k 1 off. However, because the other three parameters are correlated with one another, their confidence intervals are large. Force k 1 off, s -1 k 2 off, s -1 k 12, s -1 k 21, s pn pn pn Table S2. Values of k 12, k 21, and k 1 off estimated from force-clamp experiments using equations S2 to S4 when k 2 off was fixed at values estimated in Fig. 2g. Uncertainties are shown as 95% confidence intervals in parentheses. Force k 1 off, s -1 k 2 off, s -1 k 12, s -1 k 21, s pn 2.2 (1.1, 3.3) (0.32, 0.82) 0.12 (0, 0.28) pn 2.2 (1.9, 2.6) (0.35, 0.42) 0.34 (0.31, 0.38) pn 3.6 (2.4, 4.8) (0.79, 1.5) 0.75 (0.59, 0.91) 8
9 References 1 Miura, S. et al. Interaction of von Willebrand factor domain A1 with platelet glycoprotein Ibα (1 289). Slow intrinsic binding kinetics mediate rapid platelet adhesion. J. Biol. Chem. 275, (2000). 2 Yago, T. et al. Platelet glycoprotein Ibalpha forms catch bonds with human WT vwf but not with type 2B von Willebrand disease vwf. J Clin Invest 118, (2008). 9
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Purification, folding and reconstitution of FhuA receptors into E. coli lipid membranes. (a) SDS-PAGE of purified FhuA solubilized in the presence of N,N-dimethyldodecylamine N-oxide
More informationChapter 6. Techniques of Protein and Nucleic Acid Purification
Chapter 6 Techniques of Protein and Nucleic Acid Purification Considerations in protein expression and purification Protein source Natural sources Recombinant sources Methods of lysis and solubilization
More informationSupporting Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 215 Supporting Information Quantitative Description of Thermodynamic and Kinetic Properties of the
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
More informationKinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
More informationSUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly
SUPPLEMENTARY INFORMATION Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly Dustin J. E. Huard, Kathleen M. Kane and F. Akif Tezcan* Department of Chemistry and Biochemistry,
More informationSupplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1.
GR24 (μm) 0 20 0 20 GST-ShHTL7 anti-gst His-MAX2 His-COI1 PVDF staining Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1. Pull-down assays using GST-ShHTL7
More informationProtein analysis. Dr. Mamoun Ahram Summer semester, Resources This lecture Campbell and Farrell s Biochemistry, Chapters 5
Protein analysis Dr. Mamoun Ahram Summer semester, 2015-2016 Resources This lecture Campbell and Farrell s Biochemistry, Chapters 5 Bases of protein separation Proteins can be purified on the basis Solubility
More informationMasayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies
Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Crystallographic statistics CRM1-SNUPN complex Space group P6 4 22 a=b=250.4, c=190.4 Data collection statistics: CRM1-selenomethionine SNUPN MAD data Peak Inflection Remote Native
More informationSupplementary Figure 1. Botrocetin induces binding of human VWF to human
Supplementary Figure 1: Supplementary Figure 1. Botrocetin induces binding of human VWF to human platelets in the absence of elevated shear and induces platelet agglutination as detected by flow cytometry.
More informationIsolation of the recombinant middle and head + middle modules.
Supplementary Figure 1 Isolation of the recombinant middle and head + middle modules. (a) Scheme illustrating the multi-step purification protocol for the reconstituted middle module. Extract from infected
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationPDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.
More informationSequence of C-terminal tail regions of myosin heavy chains in class XI of Nicotiana benthamiana (Nb
Fig. S1 Sequence of C-terminal tail regions of myosin heavy chains in class XI of Nicotiana benthamiana (Nb myosin XI-2, -F and K) and BY-2 cell (Nt 170-kD myosin and Nt 175-kD myosin). Amino acids identical
More informationSolutions to 7.02 Quiz II 10/27/05
Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover
More informationSupplementary Information. Single-molecule analysis reveals multi-state folding of a guanine. riboswitch
Supplementary Information Single-molecule analysis reveals multi-state folding of a guanine riboswitch Vishnu Chandra 1,4,#, Zain Hannan 1,5,#, Huizhong Xu 2,# and Maumita Mandal 1,2,3,6* Department of
More informationTopic 2: Proteins. 2-1 specific proteins can be purified from cell extracts. Molecular Biology and Public Health ( 分子生物学与公共卫生 )
HAPTER20: Techniques of Molecular Biology Molecular Biology and Public Health ( 分子生物学与公共卫生 ) -------Protein manipulation ( 蛋白操作 ) Topic 2: Proteins 1. Protein purification ( 蛋白质纯化 ) 2. Affinity chromatography
More informationProduct. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin
Novagen offers a large variety of affinity supports and kits for the purification of recombinant proteins containing popular peptide fusion tags, including His Tag, GST Tag, S Tag and T7 Tag sequences.
More informationLecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry
Lecture 5: 8/31 CHAPTER 5 Techniques in Protein Biochemistry Chapter 5 Outline The proteome is the entire set of proteins expressed and modified by a cell under a particular set of biochemical conditions.
More informationEvaluation of Cu(I) Binding to the E2 Domain of the Amyloid. Precursor Protein A Lesson in Quantification of Metal Binding to
Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 2017 Evaluation of Cu(I) Binding to the E2 Domain of the Amyloid Precursor Protein A Lesson in Quantification
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1 Speed and run length properties of dynein mutants. Velocity (a,b) and run length (c,d) histograms for SRS/BLH motors of different stalk length and same
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,
More informationQuantifying small numbers of antibodies with a near-universal protein-dna chimera
Quantifying small numbers of antibodies with a near-universal protein-dna chimera Ian Burbulis, Kumiko Yamaguchi, Richard Yu, Orna Resnekov & Roger Brent Supplementary figures and text: Supplementary figure
More informationSUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS
SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS Riccardo Miggiano 1, Valentina Casazza 1, Silvia Garavaglia 1,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10016 Supplementary discussion on binding site density for protein complexes on the surface: The density of biotin sites on the chip is ~10 3 biotin-peg per µm 2. The biotin sites are
More informationIsolation of Protein
Isolation of Protein Ultra-centrifugation http://irfanchemist.wordpress.com/2009/04/19/isolation-of-protein / Protein solutions of various masses or densities may separated based on the time it takes to
More informationSupporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy
Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy Jonathan R. Burns* & Stefan Howorka* 1 Contents 1. Design of DNA nanopores... 3 1.1.
More informationPurification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki
Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric
More informationLecture 8: Affinity Chromatography-III
Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The
More informationSUPPLEMENTARY INFORMATION
Nanomechanical mapping of first binding steps of a virus to animal cells David Alsteens, Richard Newton, Rajib Schubert, David Martinez-Martin, Martin Delguste, Botond Roska and Daniel J. Müller This PDF
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography
More informationSupplementary Table 1. DNA sequence synthesized to express the Zika virus NS5 protein.
Supplementary Table 1. DNA sequence synthesized to express the Zika virus NS5 protein. MR766 NS5 sequence 1 ACAGAGAACAGATTGGTGGTGGAGGTGGGACGGGAGAGACTCTGGGAGAGAAGTGGAAAG 61 CTCGTCTGAATCAGATGTCGGCCCTGGAGTTCTACTCTTATAAAAAGTCAGGTATCACTG
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Multiple sequence alignments of four Swi2/Snf2 subfamily proteins, ScChd1, SsoRad54 and the RNA helicase Vasa. The sequence alignments of the Swi2/Snf2 subfamily proteins, ScChd1
More informationSupplementary Information
Supplementary Information Supplementary Figure 1 Force-distance curve-based (FD-based) AFM. (a) To contour the surface of the sample FD-based AFM approaches and retracts the tip of the AFM cantilever pixel-by-pixel.
More informationExtracting Pure Proteins from Cells
Extracting Pure Proteins from Cells 0 Purification techniques focus mainly on size & charge 0 The first step is homogenization (grinding, Potter Elvejhem homogenizer, sonication, freezing and thawing,
More informationMimetic Blue Affinity Adsorbents Mimetic Blue 1 P6XL, Mimetic Blue SA P6XL Mimetic Blue SA HL P6XL, Mimetic Blue ELISA Kit
Mimetic Blue Affinity Adsorbents Mimetic Blue 1 P6XL, Mimetic Blue SA P6XL Mimetic Blue SA HL P6XL, Mimetic Blue ELISA Kit WWW.PROMETICBIOSCIENCES.COM/PRODUCT DATASHEET Mimetic Blue affinity chromatography
More informationSupplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0
More informationPurification of Lactate Dehydrogenase
Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase
More informationSupplementary Figures and legend. Heparin affinity purification of extracellular vesicles.
Supplementary Figures and legend Heparin affinity purification of extracellular vesicles. Leonora Balaj 1, Nadia A. Atai 1,2, Weilin Chen 1, Dakai Mu 1, Bakhos A. Tannous 1, Xandra O. Breakefield 1, Johan
More informationUniversity of Bristol - Explore Bristol Research
Butterer, A., Pernstich, C., Smith, R. M., Sobott, F., Szczelkun, M. D., & Tóth, J. (2014). Type III restriction endonucleases are heterotrimeric: comprising one helicase-nuclease subunit and a dimeric
More informationSupplemental Information Molecular Cell, Volume 41
Supplemental Information Molecular Cell, Volume 41 Molecular Mechanisms for the RNA-Dependent ATPase Activity of Upf1 and Its Regulation by Upf2 Sutapa Chakrabarti, Uma Jayachandran, Fabien Bonneau, Francesca
More informationSupplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible.
Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible. Because SYBR Gold is less sensitive to single stranded
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationSuppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid
Supplementary Figures Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid sequence of Drosophila RCC1. Same colors are for Figure 1 with sequence of β-wedge that interacts with Ran in
More informationSupplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases
More information5.2 Protein purification
Purification of a His 6 -tagged Green Fluorescent Protein (GFP). Protein purification.. Purification of a His 6 -tagged Green Fluorescent Protein (GFP) Principle You can add either a N- or C-terminal His
More informationHEK293T. Fig. 1 in the
Supplementary Information Supplementary Figure 1 Zinc uptake assay of hzip4 and hzip4-δecd transiently expressed in HEK293T cells. The results of one representative e experiment are shown in Fig. 1 in
More informationHis-Spin Protein Miniprep
INSTRUCTIONS His-Spin Protein Miniprep Catalog No. P2001 (10 purifications) and P2002 (50 purifications). Highlights Fast 5 minute protocol to purify His-tagged proteins from cell-free extracts Screen
More informationSupplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm
Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm that BsSMC was labeled with Cy3 NHS-Ester. In each panel,
More informationThe Skap-hom Dimerization and PH Domains Comprise
Molecular Cell, Volume 32 Supplemental Data The Skap-hom Dimerization and PH Domains Comprise a 3 -Phosphoinositide-Gated Molecular Switch Kenneth D. Swanson, Yong Tang, Derek F. Ceccarelli, Florence Poy,
More informationProtein Techniques 1 APPENDIX TO CHAPTER 5
Protein Techniques 1 APPENDIX T CHAPTER 5 Dialysis and Ultrafiltration If a solution of protein is separated from a bathing solution by a semipermeable membrane, small molecules and ions can pass through
More informationSupplementary Note 1. Enzymatic properties of the purified Syn BVR
Supplementary Note 1. Enzymatic properties of the purified Syn BVR The expression vector pet15b-syn bvr allowed us to routinely prepare 15 mg of electrophoretically homogenous Syn BVR from 2.5 L of TB-medium
More informationpt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M
Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described
More informationNature Structural & Molecular Biology: doi: /nsmb.2548
Supplementary Figure 1. Structure of GltPhout. (a) Stereo view of a slice through a single GltPhout protomer shown in stick representation along with 2Fo-Fc and anomalous difference electron maps. The
More informationConformational changes in IgE contribute to its. uniquely slow dissociation rate from receptor FcεRI
Conformational changes in IgE contribute to its uniquely slow dissociation rate from receptor FcεRI M.D. Holdom, A.M. Davies, J.E. Nettleship, S.C. Bagby, B. Dhaliwal, E. Girardi, J. Hunt, H.J. Gould,
More informationSupplementary Information
Supplementary Information Minimal mechanistic model of sirna-dependent target RNA slicing by recombinant human Argonaute2 protein Andrea Deerberg*, Sarah Willkomm* and Tobias Restle Institute of Molecular
More informationModule 1 overview PRESIDENTʼS DAY
1 Module 1 overview lecture lab 1. Introduction to the module 1. Start-up protein eng. 2. Rational protein design 2. Site-directed mutagenesis 3. Fluorescence and sensors 3. DNA amplification PRESIDENTʼS
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/11/e1601625/dc1 Supplementary Materials for A molecular mechanism of chaperone-client recognition This PDF file includes: Lichun He, Timothy Sharpe, Adam Mazur,
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06147 SUPPLEMENTARY INFORMATION Figure S1 The genomic and domain structure of Dscam. The Dscam gene comprises 24 exons, encoding a signal peptide (SP), 10 IgSF domains, 6 fibronectin
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures 1-8
SUPPLEMENTARY INFORMATION Supplementary Figures 1-8 Supplementary Figure 1. TFAM residues contacting the DNA minor groove (A) TFAM contacts on nonspecific DNA. Leu58, Ile81, Asn163, Pro178, and Leu182
More informationFinal exam. Please write your name on the exam and keep an ID card ready.
Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an
More informationOrange fluorescent proteins shift constructed from cyanobacteriochromes. chromophorylated with phycoerythrobilin. Kai-Hong Zhao 1 Ming Zhou 1, *
Electronic Supplementary Material (ESI) for Photochemical. This journal is The Royal Society of Chemistry and Owner Societies 2014 Orange fluorescent proteins shift constructed from cyanobacteriochromes
More information1 24 C63 C β- β-
M40 Signal leaved RS1 Domain 59 110 142 Discoidin Domain 223 1 24 63 219 224 + - β- β- M M e e O O H H His 6 -Tag 250 150 100 75 50 37 * 25 20 Supplementary Figure 1 Purification of wild-type retinoschisin.
More informationPurification of alpha-1 antitrypsin using an antibody based affinity chromatography medium
Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium Ulrika Meyer a, Hanna Wlad a, Sven Blokland b, Frank J.M. Detmers b and Henrik Ihre a a GE Healthcare Bio-Sciences
More informationPlatelet glycoprotein Ibα forms catch bonds with human WT vwf but not with type 2B von Willebrand disease vwf
Related Commentary, page 3009 Research article Platelet glycoprotein Ibα forms catch bonds with human WT vwf but not with type 2B von Willebrand disease vwf Tadayuki Yago, 1 Jizhong Lou, 2,3 Tao Wu, 4
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature08627 Supplementary Figure 1. DNA sequences used to construct nucleosomes in this work. a, DNA sequences containing the 601 positioning sequence (blue)24 with a PstI restriction site
More informationSupplementary Figure 1. FRET probe labeling locations in the Cas9-RNA-DNA complex.
Supplementary Figure 1. FRET probe labeling locations in the Cas9-RNA-DNA complex. (a) Cy3 and Cy5 labeling locations shown in the crystal structure of Cas9-RNA bound to a cognate DNA target (PDB ID: 4UN3)
More informationOligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis
SUPPLEMENRY INFORMION Purification of probes and Oligonucleotides sequence Oligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis and recovered by electroelution. Labelling
More informationMT minus end catastrophe
DOI: 1.138/ncb3241 MT minus end catastrophe frequency [s -1 ].2.15.1.5 control mgfp- TPX2 * * mgfp- TPX2 mini Supplementary Figure 1. TPX2 reduces catastrophes at the microtubule minus ends. Modified box-and-whiskers
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10324 Fig. S1: Two dimensional IEF/SDS-PAGE/Western blot analysis of RBC lysate crosslinked with 4 mm BS 3. The blot was probed with αsyn antibody C20. Fig. S2: SDS-PAGE/silver stain
More informationA Domain Swapping Study of Nano-Capsule Proteins. Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner*
A Domain Swapping Study of Nano-Capsule Proteins Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner* Figure S1. Amino acid sequences of proteins used in this study. Grey shading
More informationSupplementary Online Material. Structural mimicry in transcription regulation of human RNA polymerase II by the. DNA helicase RECQL5
Supplementary Online Material Structural mimicry in transcription regulation of human RNA polymerase II by the DNA helicase RECQL5 Susanne A. Kassube, Martin Jinek, Jie Fang, Susan Tsutakawa and Eva Nogales
More informationPreparative Protein Chemistry
Biochemistry 412 Preparative Protein Chemistry 19 February 2008 The Three Eras of Protein Purification 1. The Classical (Pre-Recombinant DNA) Era (pre-1978) - Proteins purified from natural sources only
More informationSUPPLEMENTARY INFORMATION. Design and Characterization of Bivalent BET Inhibitors
SUPPLEMENTARY INFORMATION Design and Characterization of Bivalent BET Inhibitors Minoru Tanaka 1,2,#, Justin M. Roberts 1,#, Hyuk-Soo Seo 3, Amanda Souza 1, Joshiawa Paulk 1, Thomas G. Scott 1, Stephen
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationExpanded View Figures
Expanded View Figures Figure EV1. AM3-CLE45 control experiments and bam3 alleles. A Relative primary root length of indicated genotypes at 9 dag, in response to increasing amounts of CLE45 in the media.
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationMagExtactor -His-tag-
Instruction manual MagExtractor-His-tag-0905 F0987K MagExtactor -His-tag- Contents NPK-701 100 preparations Store at Store at 4 C [1] Introduction [2] Components [3] Materials required [4] Protocol3 1.
More informationModulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system
SUPPLEMENTARY DATA Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system Daniel Gleditzsch 1, Hanna Müller-Esparza 1, Patrick Pausch 2,3, Kundan Sharma 4, Srivatsa Dwarakanath 1,
More informationNotes to accompany the slidecast on theory of SDS PAGE and Western blotting
S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of
More informationPurification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract
Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural
More informationPurification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!
Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
More informationSupplemental Figure 1
Supplemental Figure 1 Supplemental Fig. 1. (A) The binding avidity between Fz4-FcH6 and MBP-Norrin dimers measured by biolayer interferometry. 5 µg/ml Fz4-Fc protein was loaded onto anti human Fc capture
More information(Refer Slide Time: 00:16)
(Refer Slide Time: 00:16) Proteins and Gel-Based Proteomics Professor Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay Mod 02 Lecture Number 5 Welcome
More informationConvenient Purification of Monoclonal Antibodies using HiTrap rprotein A FF
GE Healthcare Convenient Purification of Monoclonal Antibodies using HiTrap rprotein A FF M. Carlsson, A. Heijbel, and A-C. Häggqvist GE Healthcare AB, Björkgatan 3, SE-751 84 Uppsala, Sweden Abstract
More informationSingle-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition
SUPPLEMENTARY INFORMATION Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition Mari-Liis Visnapuu 1 and Eric C. Greene 1 1 Department of Biochemistry &
More informationProtein Characterization/ Purification. Dr. Kevin Ahern
Protein Characterization/ Purification Dr. Kevin Ahern Protein Purification Applications of Biochemistry Knowledge Protein Purification Applications of Biochemistry Knowledge Opening Cells Protein Purification
More informationNature Medicine doi: /nm.3554
SUPPLEMENTARY FIGURES LEGENDS Supplementary Figure 1: Generation, purification and characterization of recombinant mouse IL-35 (ril-35). High-Five insect cells expressing high levels of the bicistronic
More informationQ22M, T44W, R81G, H83G, T84M, N130G, N172M, A234S, T236L, C9G, V48G, L50W, T78S, S101E, E237M, T265S, W267F 7, 11, , 239,
111 Table 4-1. Summary of design calculations for Kemp elimination enzymes. The residues allowed for each required catalytic contact are indicated along with the actual catalytic residue chosen from the
More informationProtein Methods. Second Edition. DANIEL M. BOLLAG Merck Research Laboratories West Point, Pennsylvania
Protein Methods Second Edition DANIEL M. BOLLAG Merck Research Laboratories West Point, Pennsylvania MICHAEL D. ROZYCKI Department of Chemistry The Henry H. Hoyt Laboratory Princeton University Princeton,
More informationSUMOstar Gene Fusion Technology
Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com
More informationAims: -Purification of a specific protein. -Study of protein-protein interactions
Aims: -Purification of a specific protein -Study of protein-protein interactions This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin
More informationIntroduction to Biochemical techniques
Introduction to Biochemical techniques By Assist Prof. Dr. Khomsorn Lomthaisong Division of biochemical researches Protein and peptides research Molecular and Nucleic acid research 1 Electrophoresis set
More informationComparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein. Application
Comparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein Application Petra Sebastian Meike Kuschel Stefan Schmidt Abstract This Application Note describes
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationPROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)
1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of
More information