SUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly
|
|
- Rodney Patterson
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly Dustin J. E. Huard, Kathleen M. Kane and F. Akif Tezcan* Department of Chemistry and Biochemistry, University of California, San Diego, La Jolla, CA Supplementary Information contains: - Supplementary Tables Supplementary Figures 1-17 S1
2 Supplementary Results Supplementary Table 1. MALDI-TOF characterization of various ferritin mutants. For the actual mass spectra of unmodified and modified proteins, refer to Supplementary Figs. 2 and 3, respectively. Calculated Mass (Da) Observed Mass (Da) ΔC* 21,056 21,058 C53 ΔC* 21,031 21,034 C53 ΔC*-AEDANS 21,337 21,338 C53 ΔC*-Atto ,758 21,764 (modified) 21,064 (unmodified) C116 ΔC* 21,030 21,055 C116 ΔC*-AEDANS 21,336 21,355 4His-ΔC* 21,069 21,086 C53 4His-ΔC* 21,044 21,047 C53 4His-ΔC*-AEDANS 21,350 21,333 (modified) 21,069 (unmodified) ΔH-MIC1 21,011 20,980 (H56L/H63R/H67E) MIC1 21,024 20,988 C53 MIC1 20,999 21,005 C53 MIC1-AEDANS 21,305 21,316 S2
3 Supplementary Table 2. X-ray data collection and refinement statistics. A single crystal was used during data collection for each variant. Cu-4His-ΔC* Cu-MIC1 Apo-MIC1 Cu- C53 MIC1- AEDANS Data collection Space group F432 F432 F432 F432 Cell dimensions a, b, c (Å) α, β, γ ( ) Resolution (Å)* ( ) ( ) ( ) ( ) R sym or R merge (%)* 6.0 (21.5) 10.2 (49.2) 9.7 (39.7) 8.5 ( 40.5) I / σi* 9.2 (3.2) 5.6 (1.4) 6.8 (1.9) 7.5 (1.9) Completeness (%)* 100 (100) 99.8 (100) 100 (100) 100 (100) Redundancy Refinement Resolution (Å) No. unique reflections R work / R free 16.9/ / / /30.0 No. atoms Protein Ligand/ion Water B-factors Protein Ligand/ion Water R.m.s. deviations Bond lengths (Å) Bond angles ( ) *Highest-resolution shell is shown in parentheses. S3
4 Supplementary Table 3. Parameters for sedimentation velocity measurements. MIC1 Monomer Cu-induced MIC1 cage apo-mic1 cage Cureconstituted MIC1 cage Concentration (µm) Buffer Density (g/ml) Buffer Viscosity (poise) Vbar (ml/g) Frictional Ratio Theoretical Sedimentation Coefficient (S) Observed Sedimentation Coefficient (S) S4
5 Supplementary Table 4. Fe content of Fe-reconstituted ferritin variants. Data represent mean values ± s.d. of three independent measurements. Variant Fe Atoms/Cage ΔC* ± 9.5 4His-ΔC* ± 7.6 Cu-induced MIC1 cage ± 16.2 S5
6 Supplementary Table 5. List of primers used in constructing site-directed mutants of ferritin. Variant Mutation Primer Sequence (5-3 ) (order of addition) ΔC* K86Q + C90E GCAGGACATTCAGAAGCCGGATGAGGACGATTGGG CCCAATCGTCCTCATCCGGCTTCTGAATGTCCTGC C102A GGCCTGAATGCGATGGAGGCGGCGCTGCATCTGG CCAGATGCAGCGCCGCCTCCATCGCATTCAGGCC C130A GAATGATCCGCACCTGGCGGATTTCATCGAAACGC GCGTTTCGATGAAATCCGCCAGGTGCGGATCATTC 4His-ΔC* R63H GCCATGAAGAACACGAGCACGCAGAG CTCTGCGTGCTCGTGTTCTTCATGGC L56H GAAAAACTTTGCGAAATACTTCCATCATCAGAGCCATGAAGAACACG CGTGTTCTTCATGGCTCTGATGATGGAAGTATTTCGCAAAGTTTTTC E67H TGAAGAACACGAGCACGCACATAAACTGATGAAACTGCAGA TCTGCAGTTTCATCAGTTTATGTGCGTGCTCGTGTTCTTCA MIC1 Y39E GTTTATCTGTCTATGAGCGAGTACTTCGACCGTGACGATG CATCGTCACGGTCGAAGTACTCGCTCATAGACAGATAAAC N74E CTGATGAAACTGCAGGAGCAGCGTGGTGGCCGC GCGGCCACCACGCTGCTCCTGCAGTTTCATCAG P88A GCAGGACATTCAGAAGGCGGATGAGGACGATTG CAATCGTCCTCATCCGCCTTCTGAATGTCCTGC H173A MIC1 H173A AGTACCTGTTTGACAAGGCCACCTTGGGTGACTCCG CGGAGTCACCCAAGGTGGCCTTGTCAAACAGGTACT D131A/E134A MIC1 D131A/E134A CCGCACCTGGCGGCTTTCATCGCAACGCATTACCTG CAGGTAATGCGTTGCGATGAAAGCCGCCAGGTGCGG C53 MIC1 K53C GTGGCCCTGAAAAACTTTGCGTGCTACTTCCATCATCAGAGCCAT ATGGCTCTGATGATGGAAGTAGCACGCAAAGTTTTTCAGGGCCAC C116 ΔC* E116C GTCAATCAGAGCCTGCTGTGCCTGCACAAGCTGGCAACG CGTTGCCAGCTTGTGCAGGCACAGCAGGCTCTGATTGAC C53 ΔC* K53C GTGGCCCTGAAAAACTTTGCGTGCTACTTCCTGCATCAGAGCCAT ATGGCTCTGATGCAGGAAGTAGCACGCAAAGTTTTTCAGGGCCAC S6
7 Supplementary Table 6. Crystallization conditions for ferritin variants. Protein Crystal Temp. Protein Precipitant Cu-4His-ΔC* 25 o C 712 µm apo protein in standard buffer 50 mm Tris (ph 8.0), 5 mm CaCl 2, 200 µm CuCl 2 Cu-MIC1 25 o C 642 µm in standard buffer 50 mm Tris (ph 8.0), 5 mm CaCl 2, 8% PEG 1900 MME, 700 µm CuCl 2 Apo-MIC1 25 o C 666 µm in standard buffer 50 mm Tris (ph 8.0), 10 mm CaCl 2, 4% PEG 400, 20 mm EDTA (in standard Cu-AEDANS- C53 MIC1 25 o C 666 µm in standard buffer buffer) 50 mm Tris (ph 8.0), 5 mm CaCl 2, 50 mm NaCl, 10% PEG 3350, 350 µm CuCl 2 S7
8 Supplementary Figure 1. SDS-PAGE characterization of ferritin mutants. All mutants were judged to be >85% pure. S8
9 Supplementary Figure 2. MALDI mass spectra of ferritin variants. For a list of corresponding masses, see Supplementary Table 1. S9
10 Supplementary Figure 3. MALDI mass spectra of ferritin variants subjected to chemical modification. For a list of corresponding masses, see Supplementary Table 1. For the SDS-PAGE characterization of the modified variants, see Supplementary Figure 4. S10
11 Supplementary Figure 4. Chemical modification of ferritin variants with IAEDANS and Atto 590 maleimide as characterized by SDS-PAGE. Prior to electrophoresis, all samples were treated with EDTA to remove any bound or unbound Cu that may quench IAEDANS fluorescence. The gel was first imaged using a UVP UV transilluminator equipped with a BioDoc-It imaging system to detect fluorescence by IAEDANS and Atto 590 (top). It was then stained with Coomassie for visualizing the protein bands (bottom). Lane 1: Molecular weight marker; Lane 2: ΔC* cage treated with IAEDANS (negative control); Lane 3: C53ΔC* cage treated with IAEDANS; Lane 4: C116ΔC* cage treated with IAEDANS (positive control); Lane 5: C534His-ΔC* cage treated with IAEDANS; Lane 6: C53MIC1 monomer treated with IAEDANS; Lane 7: C53ΔC* cage pretreated with Cu prior to labeling with IAEDANS; Lane 8: C116ΔC* cage pretreated with Cu prior to labeling with IAEDANS; Lane 9: C53 4His-ΔC* cage pretreated with Cu prior to labeling with IAEDANS; Lane 10: C53ΔC* cage treated with Atto 590 maleimide. S11
12 Supplementary Figure 5. Alternate views of the ferritin cage. a) View down the C3 symmetry axis. b) View down the C4 symmetry axis. One C2 dimer pair is highlighted in magenta as in Fig. 2. S12
13 Supplementary Figure 6. Identification of interfacial sites for grafting a stable Cu II coordination motif. a) The C 2 symmetric Cu 2 :MBCP1 2 structure directed by Cu II coordination to bis-histidine motifs on the MBPC1 surface. The resulting, stable Cu-coordination sites are defined by pairwise C α and C β distances (listed in the table below) among the four coordinating histidines. b) Pairwise C α and C β distances among residues 56, 60, 63, and 67 chosen in the HuHF C 2 interface for grafting a stable 4His Cu coordination site. S13
14 Supplementary Figure 7. Intersubunit interactions in the C 2 interface. The C 2 interface of ferritin viewed parallel to the C 2 symmetry axis. S14
15 Supplementary Figure 8. TEM imaging of ferritin variants. Images on the left and the right columns are obtained with and without uranyl acetate staining, respectively. The unstained samples clearly show the presence of Fe mineral within all variant cages. S15
16 Supplementary Figure 9. Backbone superposition of the C 2 dimers of native ferritin (green) and 4His-ΔC* (magenta). S16
17 Supplementary Figure 10. Sedimentation velocity profile of MIC1. The protein sample (569 µm in concentration) was prepared in the standard buffer supplemented with 10 mm EDTA. Despite its high concentration, MIC1 still remains monomeric (peak sedimentation coefficient of 2.2 S) in the absence of metals. S17
18 Supplementary Figure 11. Hydrodynamic properties of isolated MIC1 and its metal-mediated oligomers. a) (top) Size-exclusion chromatogram of a MIC1 solution obtained following isolation from inclusion bodies and metal-affinity chromatography; the majority of the protein is in a monomeric state with a minor fraction existing as large, but soluble aggregates that elute in the dead volume. (bottom) Size-exclusion chromatogram of MIC1 exchanged into solutions containing equimolar Cu II (blue trace), Ni II (green trace) and Zn II (black trace). b) Sedimentation velocity profiles of various fractions (indicated with numbers 1-4 in (a)) isolated via size-exclusion chromatography. S18
19 Supplementary Figure 12. Hydrodynamic properties of isolated D131A/E134A MIC1 and its Cu-mediated oligomers. a) Size-exclusion chromatogram of a D131A/E134A MIC1 solution obtained following isolation from inclusion bodies and metalaffinity chromatography (red trace), and upon exchange of the monomeric fraction into a Cu-containing solution (blue trace). b) Sedimentation velocity profiles of various fractions (indicated with numbers 1-2 in (a)) isolated via size-exclusion chromatography. In contrast to MIC1 (Supplementary Fig. 11), the majority of the as-isolated protein is found as large aggregates that elute in the dead volume of the SEC column; a small fraction is separated as monomeric species (elution time ~300 min). This monomeric fraction is nearly quantitatively converted into a 24meric cage upon Cu II binding (elution time ~155 min). S19
20 Supplementary Figure 13. Hydrodynamic properties of isolated H173A MIC1 and its Cu-mediated oligomers. a) Sizeexclusion chromatogram of a H173A MIC1 solution obtained following isolation from inclusion bodies and metal-affinity chromatography (red trace), and upon exchange of the monomeric fraction into a Cu-containing solution (blue trace). b) Sedimentation velocity profiles of various fractions (indicated with numbers 1-3 in (a)) isolated via size-exclusion chromatography. Judging from the SEC elution profiles, the monomeric fraction is converted upon reconstitution with Cu II into higher-order species (24mer or larger, elution time ~150 min), and what appears to be a dimeric form (elution time ~280 min, approximate concentration at elution is <50 µm). Only when this dimeric fraction is concentrated to above 200 µm for SV measurements (d), it is nearly fully converted to a 24meric cage. S20
21 Supplementary Figure 14. Backbone superpositions of Cu-4His-ΔC*, Cu-MIC1, and apo-mic1 structures. a) Cu-4His-ΔC* (green) vs. Cu-MIC1 (magenta). b) Cu-MIC1 (magenta) vs, apo-mic1 (cyan). S21
22 Supplementary Figure 15. Cu II coordination in the C 4 pore of the Cu-MIC1 cage. The 2F o -F c map is contoured at 1.5 σ. S22
23 Supplementary Figure 16. Chemical and thermal unfolding of various MIC1 species as monitored by CD spectroscopy at 222 nm. The coloring scheme matches that of Fig. 5 and is as follows: MIC1 monomer (magenta), Cu-induced MIC cage (blue), EDTA-treated MIC1 cage (green), Cu-reconstituted MIC1 cage (black). For both the chemical (a), and the thermal unfolding measurements, the data represent mean values ± s.d. of three independent measurements. S23
24 Supplementary Figure 17. Linear relationship between the unfolding free energy of various MIC1 cage species and GuHCl concentrations used to obtain cage stabilities at [GuHCl] = 0 M (as described in Online Methods). The coloring scheme is the same as that in Fig. 5. The data represent mean values ± s.d. of three independent measurements. S24
SUPPLEMENTARY INFORMATION
This supplementary information is an extension of the letter with the same title and includes further discussion on the comparison of our designed Fe B Mb (computer model and crystal structure) with the
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Crystallographic statistics CRM1-SNUPN complex Space group P6 4 22 a=b=250.4, c=190.4 Data collection statistics: CRM1-selenomethionine SNUPN MAD data Peak Inflection Remote Native
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06147 SUPPLEMENTARY INFORMATION Figure S1 The genomic and domain structure of Dscam. The Dscam gene comprises 24 exons, encoding a signal peptide (SP), 10 IgSF domains, 6 fibronectin
More informationSupplementary materials for Structure of an open clamp type II topoisomerase-dna complex provides a mechanism for DNA capture and transport
Supplementary materials for Structure of an open clamp type II topoisomerase-dna complex provides a mechanism for DNA capture and transport Ivan Laponogov 1,2, Dennis A. Veselkov 1, Isabelle M-T. Crevel
More informationSUPPLEMENTARY INFORMATION
Results Construct purification and coupling. Two A1-GP1bα ReaLiSM constructs, with and without cysteine residues near the N and C-termini (Fig. S2a), were expressed and purified by Ni affinity chromatography
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10258 Supplementary Figure 1 Reconstitution of the CENP-A nucleosome with recombinant human histones H2A, H2B, H4, and CENP-A. a, Purified recombinant human
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures 1-8
SUPPLEMENTARY INFORMATION Supplementary Figures 1-8 Supplementary Figure 1. TFAM residues contacting the DNA minor groove (A) TFAM contacts on nonspecific DNA. Leu58, Ile81, Asn163, Pro178, and Leu182
More informationSuppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid
Supplementary Figures Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid sequence of Drosophila RCC1. Same colors are for Figure 1 with sequence of β-wedge that interacts with Ran in
More informationSupplementary Information For. A genetically encoded tool for manipulation of NADP + /NADPH in living cells
Supplementary Information For A genetically encoded tool for manipulation of NADP + /NADPH in living cells Valentin Cracan 1,2,3, Denis V. Titov 1,2,3, Hongying Shen 1,2,3, Zenon Grabarek 1* and Vamsi
More informationSupplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain
Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain architecture. Various C-terminal fragments were cloned and
More informationEvaluation of Cu(I) Binding to the E2 Domain of the Amyloid. Precursor Protein A Lesson in Quantification of Metal Binding to
Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 2017 Evaluation of Cu(I) Binding to the E2 Domain of the Amyloid Precursor Protein A Lesson in Quantification
More information1 24 C63 C β- β-
M40 Signal leaved RS1 Domain 59 110 142 Discoidin Domain 223 1 24 63 219 224 + - β- β- M M e e O O H H His 6 -Tag 250 150 100 75 50 37 * 25 20 Supplementary Figure 1 Purification of wild-type retinoschisin.
More informationSupporting Information
Supporting Information Peroxidase vs. Peroxygenase Activity: Substrate Substituent Effects as Modulators of Enzyme Function in the Multifunctional Catalytic Globin Dehaloperoxidase Ashlyn H. McGuire, Leiah
More informationSUPPLEMENTARY INFORMATION. Determinants of laminin polymerization revealed. by the structure of the α5 chain amino-terminal region
SUPPLEMENTARY INFORMATION Determinants of laminin polymerization revealed by the structure of the α5 chain amino-terminal region Sadaf-Ahmahni Hussain 1, Federico Carafoli 1 & Erhard Hohenester 1 1 Department
More informationTo remove S-tag and enterokinase cleavage site from pet-32a, PCR was carried out using
Supporting Information Creation of a type 1 blue copper site within a de novo coiled-coil protein scaffold Daigo Shiga, Daisuke Nakane, Tomohiko Inomata, Yasuhiro Funahashi, Hideki Masuda, Akihiro Kikuchi,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10324 Fig. S1: Two dimensional IEF/SDS-PAGE/Western blot analysis of RBC lysate crosslinked with 4 mm BS 3. The blot was probed with αsyn antibody C20. Fig. S2: SDS-PAGE/silver stain
More informationAcceleration of protein folding by four orders of magnitude through a single amino acid substitution
Acceleration of protein folding by four orders of magnitude through a single amino acid substitution Daniel J. A. Roderer 1, Martin A. Schärer 1, Marina Rubini 2 * and Rudi Glockshuber 1 AUTHOR ADDRESS
More informationFigure S1
Supplementary Figure 1 The distribution of chlorophyll containing complexes eluted from DEAE-cellulose column in a sucrose gradient tube Six pigment-containing bands were resolved and identified as: B1,
More informationSupplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0
More informationStructure determination and activity manipulation of the turfgrass ABA receptor FePYR1
Supplemental information for: Structure determination and activity manipulation of the turfgrass AA receptor FePYR1 Zhizhong Ren 1, 2,#, Zhen Wang 1, 2,#, X Edward Zhou 3, Huazhong Shi 4, Yechun Hong 1,
More informationHEK293T. Fig. 1 in the
Supplementary Information Supplementary Figure 1 Zinc uptake assay of hzip4 and hzip4-δecd transiently expressed in HEK293T cells. The results of one representative e experiment are shown in Fig. 1 in
More informationThe Skap-hom Dimerization and PH Domains Comprise
Molecular Cell, Volume 32 Supplemental Data The Skap-hom Dimerization and PH Domains Comprise a 3 -Phosphoinositide-Gated Molecular Switch Kenneth D. Swanson, Yong Tang, Derek F. Ceccarelli, Florence Poy,
More informationSUPPLEMENTARY INFORMATION
Molecular basis of RNA-dependent RNA polymerase II activity Elisabeth Lehmann, Florian Brueckner, and Patrick Cramer Gene Center Munich and Center for integrated Protein Science CiPS M, Department of Chemistry
More informationSupporting Information
Supporting Information Chan et al. 10.1073/pnas.0903849106 SI Text Protein Purification. PCSK9 proteins were expressed either transiently in 2936E cells (1), or stably in HepG2 cells. Conditioned culture
More informationSUPPLEMENTARY INFORMATION. Design and Characterization of Bivalent BET Inhibitors
SUPPLEMENTARY INFORMATION Design and Characterization of Bivalent BET Inhibitors Minoru Tanaka 1,2,#, Justin M. Roberts 1,#, Hyuk-Soo Seo 3, Amanda Souza 1, Joshiawa Paulk 1, Thomas G. Scott 1, Stephen
More informationSecondary structure of hvps4b (above) and sequence alignments of VPS4 proteins from
Supplemental Figure 1. Secondary structure of hvps4b (above) and sequence alignments of VPS4 proteins from different species as well as four other representative members of the meiotic clade of AAA ATPases.
More informationSupplementary Online Material. Structural mimicry in transcription regulation of human RNA polymerase II by the. DNA helicase RECQL5
Supplementary Online Material Structural mimicry in transcription regulation of human RNA polymerase II by the DNA helicase RECQL5 Susanne A. Kassube, Martin Jinek, Jie Fang, Susan Tsutakawa and Eva Nogales
More informationChapter 6. Techniques of Protein and Nucleic Acid Purification
Chapter 6 Techniques of Protein and Nucleic Acid Purification Considerations in protein expression and purification Protein source Natural sources Recombinant sources Methods of lysis and solubilization
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,
More informationSUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS
SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS Riccardo Miggiano 1, Valentina Casazza 1, Silvia Garavaglia 1,
More informationX-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction
X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction Tomohisa Shimasaki 1, Hiromi Yoshida 2, Shigehiro Kamitori 2 & Koji
More informationTurn Plasticity Distinguishes Different Modes of Amyloid-β Aggregation
SUPPORTING INFORMATION Turn Plasticity Distinguishes Different Modes of Amyloid-β Aggregation Nasrollah Rezaei-Ghaleh, Mehriar Amininasab, Karin Giller, Sathish Kumar, Anne Stündl, Anja Schneider, Stefan
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Multiple sequence alignments of four Swi2/Snf2 subfamily proteins, ScChd1, SsoRad54 and the RNA helicase Vasa. The sequence alignments of the Swi2/Snf2 subfamily proteins, ScChd1
More informationBACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34.
BACTERIAL PRODUCTION PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT 2015-XXXX XXXX pet-32a 50.9 kda (full-length) 34.0 kda (cleaved) EXPRESSION METHOD OVERVIEW: Plasmid DNA was transformed into BL21
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter
More informationProSEC 300S. Protein Characterization columns
ProSEC 300S Protein Characterization columns Agilent s ProSEC 300S is a silica-based material specifically designed for the analysis of proteins by aqueous size exclusion chromatography. With a proprietary
More informationSupporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez
Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez DNA sequences Strand Sequence 1- GGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGG
More informationHigh-Affinity Binding of Monomeric but Not Oligomeric Amyloid-β to Ganglioside GM1 Containing Nanodiscs
Supporting information High-Affinity Binding of Monomeric but Not Oligomeric Amyloid-β to Ganglioside GM1 Containing Nanodiscs Maren Thomaier 1,2, Lothar Gremer 1,2, Christina Dammers 1, Judith Fabig 1,
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start
More informationOrange fluorescent proteins shift constructed from cyanobacteriochromes. chromophorylated with phycoerythrobilin. Kai-Hong Zhao 1 Ming Zhou 1, *
Electronic Supplementary Material (ESI) for Photochemical. This journal is The Royal Society of Chemistry and Owner Societies 2014 Orange fluorescent proteins shift constructed from cyanobacteriochromes
More informationStabilization of a virus-like particle and its application as a nanoreactor at physiological conditions
Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van
More informationSeparate and Quantify Rituximab Aggregates and Fragments with High-Resolution SEC
Separate and Quantify Rituximab Aggregates and Fragments with High-Resolution SEC The Agilent 126 Infinity Bio-Inert Quaternary LC System and the AdvanceBio SEC 3Å, 2.7 µm Column Application Note Biologics
More informationSite-specific time-resolved FRET reveals local variations in the unfolding mechanism in an apparently two-state protein unfolding transition
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2017 Supplementary information for Site-specific time-resolved FRET reveals local variations
More informationAn anti-galvanic replacement reaction of DNA templated silver. nanoclusters monitored by light-scattering technique
Electronic Supplementary Information An anti-galvanic replacement reaction of DNA templated silver nanoclusters monitored by light-scattering technique Guoliang Liu, a Da-Qian Feng, a Wenjie Zheng, a Tianfeng
More informationCurrent ( pa) Current (pa) Voltage (mv) Voltage ( mv)
Current ( pa) 3000 2000 1000 0-1000 -2000-3000 a -400-200 0 200 400 Voltage (mv) P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 P15 P16 P17 P18 Average Current (pa) 4500 3000 1500 0-1500 -3000-4500 b -400-200
More informationDimeric WH2 domains in Vibrio VopF promote actin filament barbed end uncapping and assisted elongation
Dimeric WH2 domains in Vibrio VopF promote actin filament barbed end uncapping and assisted elongation Julien Pernier, Jozsef Orban 1, Balendu Sankara Avvaru, Antoine Jégou, Guillaume Romet- Lemonne, Bérengère
More informationSupplementary Information. Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly
Supplementary Information Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly Joshua M. Karchin, Jeung-Hoi Ha, Kevin E. Namitz, Michael S. Cosgrove, and
More informationPreparative Protein Chemistry
Biochemistry 412 Preparative Protein Chemistry 19 February 2008 The Three Eras of Protein Purification 1. The Classical (Pre-Recombinant DNA) Era (pre-1978) - Proteins purified from natural sources only
More informationSEC Column Selection Guide for the Separation of Water-soluble Polymers
SEC Column Selection Guide for the Separation of Water-soluble Polymers Dextrans Molecular weight (Da) 1 6 1 5 1 4 1 3 SRT-1 SRT-15 SRT-3 SRT-5 SRT-1 SRT- 67 kd 41 kd 7 kd 15 kd 8 kd 5 kd 5 kd 1 kd 5 kd
More informationLecture 25: Introduction to Chromatography and Gel Filtration
Biological Chemistry Laboratory Biology 3515/Chemistry 3515 Spring 2018 Lecture 25: Introduction to Chromatography and Gel Filtration 10 April 2018 c David P. Goldenberg University of Utah goldenberg@biology.utah.edu
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/7/e1614/dc1 Supplementary Materials for Copper-induced structural conversion templates prion protein oligomerization and neurotoxicity Chi-Fu Yen, Dilshan S.
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationSupplementary Information
Supplementary Information Disulfide-Bond Scanning Reveals Assembly State and β-strand Tilt Angle of PFO β-barrel Takehiro K. Sato, Rodney K. Tweten, and Arthur E. Johnson Supplementary Results Supplementary
More informationNature Structural & Molecular Biology: doi: /nsmb.2548
Supplementary Figure 1. Structure of GltPhout. (a) Stereo view of a slice through a single GltPhout protomer shown in stick representation along with 2Fo-Fc and anomalous difference electron maps. The
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/11/e1601625/dc1 Supplementary Materials for A molecular mechanism of chaperone-client recognition This PDF file includes: Lichun He, Timothy Sharpe, Adam Mazur,
More informationINSECT CELL/BACULOVIRUS PRODUCTION
INSECT CELL/BACULOVIRUS PRODUCTION PEF # GENE NAME TRANSFER VECTOR BEVS MOLECULAR WEIGHT 2015-XXXX XXXX pbac1 flashbacultra TM 36.0 kda EXPRESSION METHOD OVERVIEW: Insect cells Spodoptera frugiperda (Sf9)
More informationLecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry
Lecture 5: 8/31 CHAPTER 5 Techniques in Protein Biochemistry Chapter 5 Outline The proteome is the entire set of proteins expressed and modified by a cell under a particular set of biochemical conditions.
More informationfibrils, however, oligomeric structures and amorphous protein aggregates were
Supplementary Figure 1: Effect of equimolar EGCG on αs and Aβ aggregate formation. A D B E αs C F Figure S1: (A-C) Analysis of EGCG treated αs (1 µm) aggregation reactions by EM. A 1:1 molar ratio of EGCG
More informationQuantitative Evaluation of the Ability of Ionic Liquids to Offset the Cold- Induced Unfolding of Proteins
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2014 Supplimentary informations Quantitative Evaluation of the Ability of Ionic Liquids
More informationSupporting Information for
Supporting Information for Building Electromagnetic Hot Spots in Living Cells via Target-Triggered Nanoparticle Dimerization Wen Zhou, 1,2 Qiang Li, 1 Huiqiao Liu, 1 Jie Yang, 1 Dingbin Liu 1,2 * 1. College
More informationSUPPLEMENTARY INFORMATION Figures. Supplementary Figure 1 a. Page 1 of 30. Nature Chemical Biology: doi: /nchembio.2528
SUPPLEMENTARY INFORMATION Figures Supplementary Figure 1 a b c Page 1 of 0 11 Supplementary Figure 1: Biochemical characterisation and binding validation of the reversible USP inhibitor 1. a, Biochemical
More informationSolutions to 7.02 Quiz II 10/27/05
Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover
More informationSize-exclusion chromatography TT30 sample was analyzed using a Tosoh Haas TSK Gel G3000SW XL 7.8 mm 30cm column at 1 ml/min and 280 nm detection.
Analytical ultracentrifugation (AUC) and size exclusion chromatography (SEC-HPLC) were used to assess TT30 molecular weight distribution. The sedimentation distribution of TT30 is shown in Fig. S1A. The
More informationThe practical task of monoclonal IgG purification with CHT TM ceramic hydroxyapatite
The practical task of monoclonal IgG purification with CHT TM ceramic hydroxyapatite Pete Gagnon, Jie He, Paul Ng, Julia Zhen, Cheryl Aberin, Heather Mekosh 11th Annual Waterside Conference, Chicago, May
More informationInstant-Bands Protein Sample Loading Buffer for SDS-PAGE. User s Manual. View Protein Bands in an SDS Gel. Instantly. EZBiolab.
Instant-Bands Protein Sample Loading Buffer for SDS-PAGE User s Manual View Protein Bands in an SDS Gel Instantly www.ezbiolab.com 2 Instant-Bands User s Manual Table of Contents Introduction 3 Storage
More informationMycobacterium tuberculosis (Mtb) and Mycobacterium smegmatis (Msmeg) contain two ε (dnaq) exonuclease homologs.
Supplementary Figure 1 Mycobacterium tuberculosis (Mtb) and Mycobacterium smegmatis (Msmeg) contain two ε (dnaq) exonuclease homologs. (a) Sequence alignment of the ε-exonuclease homologs from four different
More informationSean M. McCarthy and Martin Gilar Waters Corporation, Milford, MA, U.S. INTRODUCTION EXPERIMENTAL RESULTS AND DISCUSSION
UPLC Separation of DNA Duplexes Sean M. McCarthy and Martin Gilar Waters Corporation, Milford, MA, U.S. INTRODUCTION Over the past 2 years there has been a considerable amount of effort focused on the
More informationPDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.
More informationQ22M, T44W, R81G, H83G, T84M, N130G, N172M, A234S, T236L, C9G, V48G, L50W, T78S, S101E, E237M, T265S, W267F 7, 11, , 239,
111 Table 4-1. Summary of design calculations for Kemp elimination enzymes. The residues allowed for each required catalytic contact are indicated along with the actual catalytic residue chosen from the
More informationSupplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a
Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a HNH-state 1 in PDB 4OO8, in which the distance from the C atom of the HNH catalytic residue 840 to the
More informationStructural Aspects of Immunogenicity: Aggregates
Structural Aspects of Immunogenicity: Aggregates Ronald Smulders 19 November 2009 Pharmaceutical Sciences & Drug Metabolism EIP-Protein Characterization Subcommittee Mission of the EIP-PCS: To discuss
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Mechanism for signal-induced opening of the DNA box. a, An atomic model of the DNA box held closed by locks (orange and blue) that are double helices formed by two short strands
More informationIsolation of the recombinant middle and head + middle modules.
Supplementary Figure 1 Isolation of the recombinant middle and head + middle modules. (a) Scheme illustrating the multi-step purification protocol for the reconstituted middle module. Extract from infected
More informationSupplementary Note 1. Enzymatic properties of the purified Syn BVR
Supplementary Note 1. Enzymatic properties of the purified Syn BVR The expression vector pet15b-syn bvr allowed us to routinely prepare 15 mg of electrophoretically homogenous Syn BVR from 2.5 L of TB-medium
More informationSupporting Information
Supporting Information Copper and zinc ions specifically promote non-amyloid aggregation of the highly stable human γ-d crystallin Liliana Quintanar, 1,* José A. Domínguez-Calva, 1 Eugene Serebryany, 2
More informationNature Structural and Molecular Biology: doi: /nsmb.2937
Supplementary Figure 1 Multiple sequence alignment of the CtIP N-terminal domain, purified CtIP protein constructs and details of the 2F o F c electron density map of CtIP-NTD. (a) Multiple sequence alignment,
More informationSupplemental Information Molecular Cell, Volume 41
Supplemental Information Molecular Cell, Volume 41 Molecular Mechanisms for the RNA-Dependent ATPase Activity of Upf1 and Its Regulation by Upf2 Sutapa Chakrabarti, Uma Jayachandran, Fabien Bonneau, Francesca
More informationPhysical Methods in Models of Cataract Disease. O. P. Srivastava Department of Vision Science University of Alabama at Birmingham
Physical Methods in Models of Cataract Disease O. P. Srivastava Department of Vision Science University of Alabama at Birmingham Function of the Lens: Refraction Lens Specific Structural Proteins (α-,
More informationSingle-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition
SUPPLEMENTARY INFORMATION Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition Mari-Liis Visnapuu 1 and Eric C. Greene 1 1 Department of Biochemistry &
More informationSequence of C-terminal tail regions of myosin heavy chains in class XI of Nicotiana benthamiana (Nb
Fig. S1 Sequence of C-terminal tail regions of myosin heavy chains in class XI of Nicotiana benthamiana (Nb myosin XI-2, -F and K) and BY-2 cell (Nt 170-kD myosin and Nt 175-kD myosin). Amino acids identical
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10963 Supplementary Table 1 Data collection, phasing and refinement statistics. Crystal Native Derivative-1 (OsO 4 ) Derivative-2 (Orange-Pt) Data collection Space group C2 C2 C2 Cell
More informationHis-Spin Protein Miniprep
INSTRUCTIONS His-Spin Protein Miniprep Catalog No. P2001 (10 purifications) and P2002 (50 purifications). Highlights Fast 5 minute protocol to purify His-tagged proteins from cell-free extracts Screen
More informationMBP Excellose handbook - Purification of MBP fusion proteins -
Introduction MBP Excellose handbook - Purification of MBP fusion proteins - MBP Excellose is a affinity chromatography medium used for simple and rapid purification of MBP (maltose binding protein) fusion
More informationSite-specific protein cross-linking by peroxidase-catalyzed activation of a tyrosine-containing peptide tag
Supporting Information Site-specific protein cross-linking by peroxidase-catalyzed activation of a tyrosine-containing peptide tag Kosuke Minamihata 1, Masahiro Goto 1,2, Noriho Kamiya 1,2* 1 Department
More informationProduct. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin
Novagen offers a large variety of affinity supports and kits for the purification of recombinant proteins containing popular peptide fusion tags, including His Tag, GST Tag, S Tag and T7 Tag sequences.
More informationCharacterization of IgG monomers & their aggregates
Characterization of IgG monomers & their aggregates A comparison between column calibration & multi-detection SEC PROTEIN AGGREGATION MOLECULAR SIZE MOLECULAR STRUCTURE MOLECULAR WEIGHT Introduction In
More informationThe molecular basis of lysine 48 ubiquitin chain synthesis by Ube2K
Supplementary Information The molecular basis of lysine 48 ubiquitin chain synthesis by Adam J. Middleton, Catherine L. Day* Department of Biochemistry, Otago School of Medical Sciences, University of
More informationSupplementary Information. Intra- and inter-nucleosomal interactions of the histone H4 tail revealed with a human nucleosome core particle with
Supplementary Information Intra- and inter-nucleosomal interactions of the histone H4 tail revealed with a human nucleosome core particle with genetically-incorporated H4 tetra-acetylation Masatoshi Wakamori
More informationApplication note. Purification of PEGlyated proteins with Contichrom
Application note Purification of PEGlyated proteins with Contichrom ChromaCon AG // Purification of PEGylated proteins with Contichrom // www.chromacon.ch // ver. May 2013 1 Summary The purification of
More informationPurification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract
Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural
More informationPurification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!
Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural
More informationSupplemental Material
Supplemental Material Molecular basis for oncohistone H3 recognition by SETD2 methyltransferase Shuang Yang, 1, 2 Xiangdong Zheng, 1, 2, 3 Chao Lu, 4 Guo-Min Li, 2 C. David Allis, 4 1, 2, 3, 5* and Haitao
More informationMechanism of Transcription Termination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element
Molecular Cell Supplemental Information Mechanism of ranscription ermination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element Aneeshkumar G. Arimbasseri and Richard
More informationSupplementary Figure 1. Botrocetin induces binding of human VWF to human
Supplementary Figure 1: Supplementary Figure 1. Botrocetin induces binding of human VWF to human platelets in the absence of elevated shear and induces platelet agglutination as detected by flow cytometry.
More informationNature Structural & Molecular Biology: doi: /nsmb.2307
A novel locally-closed conformation of a bacterial pentameric proton-gated ion channel Marie S. Prevost*, Ludovic Sauguet*, Hugues Nury, Catherine Van Renterghem, Christèle Huon, Frederic Poitevin, Marc
More information1. Bloomsbury BBSRC Centre for Structural Biology, Birkbeck College and University College London.
Purification/Polishing of His-tagged proteins - Application of Centrifugal Vivapure Ion-exchange Membrane Devices to the Purification/Polishing of Histagged Background Multi-milligram quantities of highly
More informationA Domain Swapping Study of Nano-Capsule Proteins. Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner*
A Domain Swapping Study of Nano-Capsule Proteins Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner* Figure S1. Amino acid sequences of proteins used in this study. Grey shading
More informationNonionic Polymer Enhancement of Aggregate Removal in Ion Exchange
Nonionic Polymer Enhancement of Aggregate Removal in Ion Exchange and Hydroxyapatite Chromatography Pete Gagnon, Richard Richieri, Simin Zaidi 12th Annual Waterside Conference, San Juan, Puerto Rico, April
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Purification and biochemical characterization of acid phosphatase-i from seeds of Nelumbo nucifera Sanaullah Khan a*, Shahnaz Asmat c, Sajida Batool a, Mushtaq Ahmed b a Department
More informationSupplementary information to eif4b stimulates eif4a ATPase and unwinding activities by direct
Supplementary information to eif4b stimulates eif4a ATPase and unwinding activities by direct interaction through its 7-repeats region, Alexandra Z. Andreou, Ulf Harms & Dagmar Klostermeier. Supplementary
More information