Supporting Information
|
|
- Jerome Lucas
- 6 years ago
- Views:
Transcription
1 Supporting Information Nowakowski et al /pnas SI Materials and Methods Primary Antibodies. Primary antibodies used in this study were raised against BrdU (rat, 1:50; Abcam), cleaved caspase 3 (rabbit, 1:50; Cell Signaling), GFP (goat, 1:400; Abcam), HuC/D (mouse, 1:150; Sigma), Pax6 (rabbit, 1:300; Covance), Sox2 (rabbit, 1:3,000; Milipore), Sox9 (1:1,500; Millipore), and Tbr2 (rabbit, 1:100; Abcam). Constructs. The CAG-cre-IRES-EGFP construct containing the cytomegalovirus early enhancer element and chicken β-actin promoter (CAG) element, internal ribosomal entry site (IRES), and enhanced green fluorescent protein (EGFP) was provided by Anjen Chenn (Northwestern University, Chicago, IL). To overexpress mir-92b, we used a strong mammalian expression vector containing the CAG promoter element upstream of myristolated, destabilized enhanced GFP (myr-degfp) coding sequence (1). The genomic pre-mir-92b hairpin sequence (2) was amplified from the genomic DNA using the following primers: forward, ATACTCCCCAGAGCACTCCA; reverse, GCTCGGTA- GAGATCGAAAGC. The 3 UTR of the mouse Eomes coding the Tbr2 transcription factor was amplified from the genomic DNA by nested PCR using the Expand High Fidelity Plus PCR system (Roche) using the following primers: forward1, GTGGCGCTTATCAGAGGAAG; reverse1, GGATTAAGCCTGCAGAGCAC; subsequently, forward2, AAGATCAGCTTGCCAAGGAA; reverse2, GAAAG- GGGGCAGAAAGAAAC. The UTR was subcloned into psicheck-2 (Promega) and is referred to as the WT 3 UTR in this paper. Nucleotides of the Eomes mrna coding sequence were deleted using the QuickChangeII XL kit (Agilent) using the following primers: sense, CCTTCCACCTTTGATG- TATCCTGTTTTTCTCTGAGAGAAGG; antisense, CCTTCT- CTCAGAGAAAAACAGGATACATCAAAGGTGGAAGG. For sponge experiments, six copies of the mir92 binding site (GGAGGCCGGGAAAGTGCAATA) were ligated downstream of the destabilized D2EGFP coding sequence and then subcloned into the pcag-ires-egfp expression vector. The scrambled control sequence was published before (3). To generate scrambled sponge or mir-92b sponge expressing retroviruses, six copies of the sponge were subcloned into the PmeI site of the CAG-GFP (Addgene plasmid 16664) retroviral vector (4). Replication incompetent retroviruses were produced by transient cotransfection of Platinum GP cells (Cell Biolabs) with pseudotyping vector VSV-G and the retroviral expression vector. The supernatant was harvested h after transfection, centrifuged, and filtered through a 0.45-μm filter (Millipore). Viral particles were concentrated at 25,000 g for 2 h at 4 C, resuspended in PBS, and stored at 80 C. Final titer tested in 3T3 cells was found to be cfu/ml. Retrovirus injection used the same surgery as for in utero electroporation. Quantification of Immunopositive Cells in Sections. Three nonadjacent coronal sections through the central telencephalon were selected for quantifications of immunopositive cells. Optical sections through the dorso-lateral telencephalon containing electroporated cells were acquired at constant separation, and three to four optical sections through the center of the section were summed using the image processing software ImageJ. Counting ladders consisting of 200 (wide) 40-μm (deep) boxes, 10 for E14.5 and 12 for E15.5, were positioned in Adobe Photoshop with the base along the ventricular edge. Exceptions included counts of cleaved caspase-3 positive cells, where only a single 300-μm-wide box was used, spanning the entire thickness of the dorsal telencephalic wall (E15.5) or of the cortical plate (E18.5). Between 7 and 12 embryos from at least three surgeries were analyzed per genotype for each quantification. For postnatal sections of in utero electroporated Dicer1 fl mice interbred with the Rosa26RYFP mice (5), brains of all surviving mice were sectioned and analyzed for GFP expression. Only brains with GFP + cells in the dorso-lateral cortex were considered. Counting ladders consisting of μm boxes spanning the entire thickness of the cortical wall were positioned with the base along the pial edge. For mice injected with CAG-GFPmiR-92b or scrambled sponge expressing retroviruses, five nonadjacent 20-μm coronal sections were analyzed by counting all detectable GFP immunoreactive cells in the neocortex. Astrocyte identity was confirmed by Sox9 immunostaining and morphology. Borders between cortical layers were established based on nuclear counterstaining with DAPI. 1. Wu S, et al. (2002) Characterization of ubiquilin 1, an mtor-interacting protein. Biochim Biophys Acta 1542(1-3): Griffiths-Jones S (2004) The microrna registry. Nucleic Acids Res 32(Database issue): D109 D Gentner B, et al. (2009) Stable knockdown of microrna in vivo by lentiviral vectors. Nat Methods 6(1): Zhao C, Teng EM, Summers RG, Jr., Ming GL, Gage FH (2006) Distinct morphological stages of dentate granule neuron maturation in the adult mouse hippocampus. J Neurosci 26(1): Srinivas S, et al. (2001) Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1:4. 1of6
2 Fig. S1. Evidence for efficient, rapid depletion of Dicer1 following electroporation at E13.5. (A) Schema showing experimental approach. E13.5 Dicer1 fl/fl or Dicer1 +/fl embryos were electroporated with cre expression vector. On E14.5, tissue containing GFP + cells was dissected, and dissociated cells were either subjected to FACS to isolate GFP + cells for extraction of (B) RNA or (C P) plated and reacted with LNA riboprobes for mature mir9 or mir124. (B) Quantification of Dicer1 mrna levels relative to GAPDH levels 1 d after electroporation (n = 3). (C P) Levels of two brain-enriched mature mirnas, mir9 and mir124, are reduced in cells 1 d after electroporation. (C J) Examples show in situ hybridization staining for mir9 in dissociated cells. Electroporated Dicer1 fl/fl (C) and control Dicer1 fl/+ (D) cells were identified based on the expression of GFP (filled arrowheads). GFP-positive (GFP + ) cells were chosen at random and paired with nearby GFP-negative (GFP ) cells (C and D, open arrows). Among (E) Dicer1 fl/fl and (F) control Dicer1 fl/+ cells, grayscale image intensity profiles were determined for pairs of GFP + and GFP cells (boxes). (Scale bar, 10 μm.) (G J) Examples of image intensity profiles for the individual cells boxed in E and F:(G) Dicer1 fl/fl GFP +, (H) Dicer1 fl/fl GFP,(I) Dicer1 fl/+ GFP +, and (J) Dicer1 fl/+ GFP ; lower grayscale values correspond to more intense in situ staining and hence more mirna. To evaluate the amount of mirna staining in GFP + cells compared with GFP cells, values of total image intensity were calculated for each cell by integrating its image intensity profile (G J) according to the equation in K, and for each pair of GFP + and GFP cells, the total intensity values were subtracted according to the equation in L. (M P) Estimating the proportion of Dicer1 fl/fl cells that underwent depletion was done by examining the distributions of intensity differences. (M) In controls, because both mir124 and mir9 are expressed by all cells in the developing cortex with about 50% expressing them strongly (1, 2) (dark shading, cells expressing high level of mirna; lighter shadings, cells expressing moderate to low level of mirna), analysis of mirna in situ staining using the equation in L is expected to result in either a number close to zero (cases 1 and 4), a positive number (case 2), or a negative number (case 3). (N) If Dicer1 is efficiently depleted, little or no in situ staining is expected in GFP + cells (lightest shading), and so the differences should be less than zero in all cases. (O and P) Distributions of intensity differences among Dicer1 fl/+ (filled bars) and Dicer1 fl/fl (open bars) cell pairs for in situ staining for (O) mir124 and (P) mir9: in controls, data were normally distributed around zero, as predicted, and in Dicer1 fl/fl cells, distributions were shifted such that the vast majority of pairs (85 90%) showed differences of less than zero. These wholesale shifts in the distributions indicate rapid and efficient depletion of these mirnas from almost all GFP + Dicer1 fl/fl cells, as illustrated in N. Data represent analysis of results pooled from three experiments, each analyzing pairs of cells. 1. Landgraf P, et al. (2007) A mammalian microrna expression atlas based on small RNA library sequencing. Cell 129(7): Maiorano NA, Mallamaci A (2009) Promotion of embryonic cortico-cerebral neuronogenesis by mir-124. Neural Dev 4:40. 2of6
3 Fig. S2. No evidence of increased apoptosis following the loss of functional Dicer. (A D) Images of coronal sections containing (A, B, and B ) Dicer1 +/ and (C and D) Dicer1 / cells at (A and C) E15.5 and (B and D) E18.5 showing immunostaining for GFP and the marker of apoptosis, cleaved caspase 3 (arrows). B shows an image of a positive control immunostaining for cleaved caspase 3 in the corpus callosum, where high levels of apoptosis have been reported (1), from the brain in B. (Scale bars, 100 μm.) (E) Enumeration of density of cells double-positive for GFP and cleaved caspase 3 in the dorsal telencephalon (dtel) at E15.5 or the cortical plate (CP) at E18.5 shows no difference between genotypes (n = 6). (F) To further test whether loss of functional Dicer results in abnormal levels of cell death, we performed the following experiment: Dicer1 fl/fl and control Dicer1 fl/+ embryos carrying the R26RYFP reporter allele were electroporated with cre-expression plasmid at E13.5 and developed until P14. Cells derived from electroporated radial glia were found reproducibly in the lateral cortex (red box). (G and H) Examples of coronal sections of cortex show Dicer1 +/ and Dicer1 / GFP/YFP cells. (Scale bar, 50 μm.) (I) The contribution of GFP/YFP cells to superficial cortical layers (I III) and deep cortical layers (IV VI) was higher in Dicer1 fl/fl than in Dicer1 fl/+ mice. Data represent means ± SEM from six animals from three surgeries with five sections analyzed per animal; borders between cortical layers were identified with DAPI nuclear counterstain. *P < 0.05, Tukey s test. 1. Niquille M, et al. (2009) Transient neuronal populations are required to guide callosal axons: a role for semaphorin 3C. PLoS Biol 7(10):e of6
4 Fig. S3. Comparison of mir-92b and the response element in the 3 UTR of Tbr2. (A) Multiple sequence alignment of sections of Tbr2 mrnas from 16 mammalian species containing the response element to mir-92b (highlighted in yellow). (B) Alignment of precursor mir-92b sequences from nine mammalian species including rodents and primates (MirBase accession numbers next to mirna name). Mature mmu-mir-92b is highlighted in yellow. Most of the nucleotides are identical in all species (*). Mouse pre-mir-92b differs from other species at a few residues (highlighted in green). (C) Predicted secondary structure of the mouse pre-mir-92b hairpin shows that residues that are different between the mouse and other mammals are not part of the mature mirna sequence and are not involved in base-pairing. All sequence alignments were performed using ClustalW. 4of6
5 Fig. S4. Mature mir-92b interacts with the 3 UTR of Tbr2. Dual luciferase assay in HEK-293 cells demonstrates that mir-92b can inhibit the expression of Renilla luciferase by interacting with the WT 3 UTR sequence of the Tbr2 mrna but not when nucleotides are mutated (n = 3 experiments). 5of6
6 Fig. S5. Results of prolonged inhibition of mir-92b. Following intraventricular injection of retrovirus expressing GFP-miR-92b sponge or GFP-scrambled sponge at E12.5, mice were allowed to develop until P14. (A A ) Example images of brains injected with GFP-scrambled sponge stained for (A) GFPand(A ) overlay image with nuclear counterstain DAPI. Oblique arrows indicate GFP expressing neurons and horizontal arrows indicate astrocytes, whose identities were confirmed by staining for astrocyte marker Sox9 (A A ; astrocytes accounted for 24 45% of GFP-positive cells in these control brains) (Scale bar, 50 μm.) (B B ) Example images of brain sections from mice injected with retrovirus expressing mir-92b sponge showing (B) GFP immunostaining and (B ) overlay image with nuclear counterstain DAPI. The distributions were shifted toward superficial layers, and the vast majority had neuronal morphologies, with 7 17% of cells identified as astrocytes on the basis of morphology and Sox9 staining. (Scale bar in A, A, B, and B, 100 μm.) (C) Quantification of the relative proportions of superficial and deep layer neurons in brains injected with retrovirus expressing scrambled sponge (brains 1 and 2) or mir-92b sponge (brains 3 5). Values for each brain represent mean ± SEM of all neurons counted in five nonadjacent 20-μm sections. ANOVA indicated a statistically significant difference in the relative proportions of superficial and deep layer neurons between treatment groups. Post hoc Student t tests indicated that all differences between scrambled and mir-92b sponge-treated brains were significant (P < 0.05). 6of6
(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for
Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/323/5911/256/dc1 Supporting Online Material for HDAC4 Regulates Neuronal Survival in Normal and Diseased Retinas Bo Chen and Constance L. Cepko E-mail: bochen@genetics.med.harvard.edu,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11094 Supplementary Figures Supplementary Figure 1: Analysis of GFP expression in P0 wild type and mutant ( E1-4) Fezf2-Gfp BAC transgenic mice. Epifluorescent images of sagittal forebrain
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationSupplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)
Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus
More informationUTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationSupplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
More informationInventory of Supplemental Information for Melkman-Zehavi et al.
Inventory of Supplemental Information for Melkman-Zehavi et al. Supplementary methods for Melkman et al. Supplementary Figures Figure S1, related to Figure 2 Islet size and total beta cell mass of mutant
More informationSupplementary Fig. 1 Expression levels of 5 mirnas cycling in PDF cells under LD conditions.
Supplementary Fig. 1 Expression levels of 5 mirnas cycling in PDF cells under LD conditions. RT-qPCR quantification of mirna levels in PDF cells entrained under LD cycles in WT flies (PDF-GAL4;UAS-mCD8::GFP).
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10810 Supplementary Fig. 1: Mutation of the loqs gene leads to shortened lifespan and adult-onset brain degeneration. a. Northern blot of control and loqs f00791 mutant flies. loqs f00791
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationSupplemental Table/Figure Legends
MiR-26a is required for skeletal muscle differentiation and regeneration in mice Bijan K. Dey, Jeffrey Gagan, Zhen Yan #, Anindya Dutta Supplemental Table/Figure Legends Suppl. Table 1: Effect of overexpression
More informationA Survey of Genetic Methods
IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA
More informationEmbryonic Origin of Postnatal Neural Stem Cells
Cell Supplemental Information Embryonic Origin of Postnatal Neural Stem Cells Luis C. Fuentealba, Santiago B. Rompani, Jose I. Parraguez, Kirsten Obernier, Ricardo Romero, Constance L. Cepko, and Arturo
More informationSupplemental Figures Supplemental Figure 1
Supplemental Figures Supplemental Figure 1 The de novo and salvage purine synthesis pathways are shown converging on GMP synthesis (A). Enzymes and intermediates not involved in MPA action and/or guanosine
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationCytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
More informationRegulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132
Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew
More informationSupplementary Figure 1.
Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate
More informationParthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss
SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,
More informationDCLK-immunopositive. Bars, 100 µm for B, 50 µm for C.
Supplementary Figure S1. Characterization of rabbit polyclonal anti-dclk antibody. (A) Immunoblotting of COS7 cells transfected with DCLK1-GFP and DCLK2-GFP expression plasmids probed with anti-dclk antibody
More informationA population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity
A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico
More informationSupplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
More informationSupplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
More informationPre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression
Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected
More informationGalina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
More informationTo generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR
Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886
More informationGM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
More informationSupplementary Figure 1 A
Supplementary Figure A B M. mullata p53, 3 UTR Luciferase activity (%) mir-5b 8 Le et al. Supplementary Information NC-DP - + - - - - - NC-DP - - + - - - - NC-DP3 - - - + - - - 5b-DP - - - - + + + NC-AS
More information3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc
3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget Application Guide OriGene Technologies, Inc Package Contents and Storage Conditions 3 UTR reporter clone as 10ug lyophilized plasmid
More informationSupplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the
More informationSupplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern
Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung
More informationSummary MicroRNAs (mirnas) are genomically encoded small RNAs used by organisms to regulate the expression of proteins generated from messenger RNA
Summary MicroRNAs (mirnas) are genomically encoded small RNAs used by organisms to regulate the expression of proteins generated from messenger RNA transcripts. The in vivo requirement of specific mirnas
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.
Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
More informationBlimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling
1 2 3 4 5 6 7 8 9 10 11 Supplementary Methods Antibodies Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling (Danvers, MA) and used at 1:1000 to detect the total PRDM1 protein
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Design and sequence of system 1 for targeted demethylation.
Supplementary Figure 1 Design and sequence of system 1 for targeted demethylation. (a) Design of system 1 for targeted demethylation. TET1CD was fused to a catalytic inactive Cas9 nuclease (dcas9) and
More informationNature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationSupplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.
Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)
More informationClontech Product Selection Guide
New New Clontech Product Selection Guide PCR THigh Yield - TITANIUM Taq High Yield & Fidelity - Advantage 2 polymerase High Fidelity CloneAmp HiFi Direct PCR- Terra PCR Direct polymearase Transfection
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationSUPPLEMENTARY NOTE 3. Supplememtary Note 3, Wehr et al., Monitoring Regulated Protein-Protein Interactions Using Split-TEV 1
SUPPLEMENTARY NOTE 3 Fluorescent Proteolysis-only TEV-Reporters We generated TEV reporter that allow visualizing TEV activity at the membrane and in the cytosol of living cells not relying on the addition
More informationGenomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two
Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSupplemental Figure S1. PGRN Binding to Sortilin.
1 Neuron, volume 68 Supplemental Data Sortilin-Mediated Endocytosis Determines Levels of the Frontotemporal Dementia Protein, Progranulin Fenghua Hu, Thihan Padukkavidana, Christian B. Vægter, Owen A.
More informationWT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
More informationFig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationPositive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More information1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.
Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga
More informationPeter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre
Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,
More informationsherwood - UltramiR shrna Collections
sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome
More informationSUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES
SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Generation of inducible BICD2 knock-out mice. A) The mouse BICD2 locus and gene targeting constructs. To generate an inducible Bicd2
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Experimental schema for the identification of circular RNAs in six normal tissues and seven cancerous tissues. Supplementary Fiure 2 Comparison of human circrnas
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More information- Supplementary Information -
TRIM32 dependent transcription in adult neural progenitor cells regulates neuronal differentiation. - Supplementary Information - Anna-Lena Hillje 1, 2#, Maria Angeliki S. Pavlou 1, 2#, Elisabeth Beckmann
More informationTRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
More informationSupporting Information
Supporting Information Ho et al. 10.1073/pnas.0808899106 SI Materials and Methods In immunostaining, antibodies from Developmental Studies Hybridoma ank were -FasII (mouse, 1:200), - (mouse, 1:100), and
More informationRegulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
More informationsupplementary information
Figure S1 ZEB1 full length mrna. (a) Analysis of the ZEB1 mrna using the UCSC genome browser (http://genome.ucsc.edu) revealed truncation of the annotated Refseq sequence (NM_030751). The probable terminus
More informationMicroRNA Destabilization Enables. Dynamic Regulation of the mir-16 Family. In Response to Cell-Cycle Changes SUPPLEMENTAL INFORMATION
Molecular Cell, Volume 43 SUPPLEMENTAL INFORMATION MicroRNA Destabilization Enables Dynamic Regulation of the mir-16 Family In Response to Cell-Cycle Changes Olivia S. Risland, Sue-Jean Hong, and David
More informationSupplementary Materials
Supplementary Materials Supplementary Methods Supplementary Discussion Supplementary Figure 1 Calculated frequencies of embryo cells bearing bi-allelic alterations. Targeted indel mutations induced by
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationXiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
Cell, Volume 135 Supplemental Data Hypothalamic IKKβ/NF-κB and ER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
More informationEmanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera
SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationRevised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
More informationControl of cortex development by ULK4, a rare risk gene for mental disorders including schizophrenia
Control of cortex development by ULK4, a rare risk gene for mental disorders including schizophrenia Bing Lang, Lei Zhang, Guanyu Jiang, Ling Hu, Wei Lan, Lei Zhao, Irene Hunter, Michal Pruski, Ning-Ning
More informationPartial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
More informationPremade Lentiviral Particles for ips Stem Factors: Single vector system. For generation of induced pluripotent stem (ips) cells and other applications
Premade Lentiviral Particles for ips Stem Factors: Single vector system For generation of induced pluripotent stem (ips) cells and other applications RESEARCH USE ONLY, not for diagnostics or therapeutics
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationSupplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected
More informationIn general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days
Animal injections and tissue processing In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days before they received any injections. Mice were injected with sesame seed oil
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationSupplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
More informationFig Hypoxia causes growth retardation and developmental delay. (A) Morphology of wildtype zebrafish embryos at 48 hours post fertilization
FIGURES AND TABLES Fig. 1-1. Hypoxia causes growth retardation and developmental delay. (A) Morphology of wildtype zebrafish embryos at 48 hours post fertilization (hpf) after 24 h of normoxia or hypoxia
More informationSupplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
More informationTable S1. Primers used in RT-PCR studies (all in 5 to 3 direction)
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG
More informationSupplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860
Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More information