AGENDA for 02/07/14 AGENDA: HOMEWORK: Due end of period. Due Thurs, OBJECTIVES:

Transcription

1 AGENDA for 02/07/14 AGENDA: 1. Finish 3.2.1: Protein Synthesis (participation) : The Genetic Code OBJECTIVES: 1. Decode the DNA message 2. Investigate the effect that various mutations have on protein production HOMEWORK: Due end of period Activity Packet Due Thurs, Activity Packet

2 3.2 Key Terms 1. Amino Acid 2. Anticodon 3. Codon 4. Hydrophilic 5. Hydrophobic 6. Messenger RNA (mrna) 7. Mutation 8. Nucleotide 9. Protein 10.Protein Synthesis 11.Ribonucleic Acid (RNA) 12.Ribosome 13.Transcription 14.Transfer RNA (trna) 15.Translation

3 Essential Questions for What is the DNA code? 2. What is the connection between genes and proteins? 3. How are proteins produced in a cell?

4 Activity Objectives Explore how the body uses DNA to produce proteins

5 Conclusion Question 1. Describe how the DNA code is translated into messenger RNA. 2. How is the RNA molecule a script for the protein production process? 3. What is the function of hemoglobin in the body?

6 Essential Questions for How does the sequence of nucleotides in DNA determine the sequence of amino acids in a protein? 5. What is a mutation?

7 Activity Objectives Decode the DNA message 2. Investigate the effect that various mutations have on protein production

8 Conclusion Question 1. Describe (in words) the effect of the mutation. 2. Was the mutational effect greater in a substitution or a deletion? Explain your answer clearly. 3. Why do you think scientists call a substitution a point mutation? Why do you think scientists call a deletion (or an insertion) a frameshift mutation? 4. Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the 15 th base was changed from a G to a T. Fill in the corresponding mrna, trna, and letter in the blanks below for the mutated DNA strip. In the space below, explain how this point mutation changes the protein. Normal DNA: GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG mrna: CAACCGCUUACUUGCCUCCGACUGCAGATTCGGAUCUUU UUAACC trna: GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG Sentence: SHE READS A LOT Mutated DNA: GTTGGCGAATGAAC_T GAGGCTGACGTCTAAGCCTAGAAAAATTGG mrna: CAACCGCUUACUUG CUCCGACUGCAGATTCGGAUCUUU UUAACC trna: GUUGGCGAAUGAAC GAGGCUGACGUCUAAGCCUAGAAAAAUUGG Sentence: SHE EADS A LOT 5. What is the difference between normal and sickle hemoglobin at the DNA, RNA, and protein (amino acid) level? 6. What type of mutation is the sickle hemoglobin mutation? Explain. 7. Glutamic acid (Glu) and valine(val) are two amino acids with different molecular structures. (Glutamic acid is a strongly hydrophilic molecule, and valineis a strongly hydrophobic molecule. This is something you will learn more about in the next activity). Why do you think switching the hemoglobin gene s sixth amino acid from glutamic acid to valinewould affect the hemoglobin protein?

9 3.2.2 Activity Checklist Transcribe and Translate Animation (NB) STAMP DNA, mrna and Protein Cut-Outs (NB) STAMP Mistakes Happen (NB) Hemoglobin Sequences (NB) Conclusion Questions 4 (NB) Participation STAMP Total = 16

10 Activity Directions

11 Transcribe and Translate Animation (NB) 1. Refer to curriculum file for more detailed instructions 2. Refer to steps Complete the animation 4. In your NB, write the: 1. Original DNA message 2. mrna codon 3. trna anticodon 4. Sequence of animo acid produced 5. Raise your hand that you have completed the animation (Mr. Hwang will check on his monitor that you have reached the final step of the animation) 6. Get a stamp

12 DNA, mrna and Protein Cut-Outs (NB) 1. Refer to curriculum file for more detailed instructions 2. Refer to steps Each group will be assigned 2DNA sequences in order to decode a protein message 4. From your assigned DNA fragment: 1. Create the corresponding mrna sequence using the cutouts 2. Create the corresponding trna and protein sequence 5. Write the DNA, mrna and the resulting protein sentence in your NB (see step 12) 6. Get a stamp for your cut-out sequences

13 Mistakes Happen 1. Refer to curriculum file for more detailed instructions 2. Refer to steps You will create 2 mutations to each of your 2 DNA sequences (this will be done in your NB with a pen/pencil instead of using the cut-outs) 1. Create substitution mutation (see step 13) 2. Create a deletion mutation (see step 16) 4. Write out the DNA, mrna and resulting proteins for each of the mutations to your 2 DNA sequences in your NB

14 Hemoglobin Sequences (NB) 1. Refer to curriculum file for more detailed instructions 2. Refer to steps You will transcribe and translate 2 sequences in your NB: 1. DNA sequence for normal hemoglobin 2. DNA sequence for Sickle hemoglobin 4. Write the DNA, mrna and amino acid sequences in your NB

15 Conclusion Questions 4 (NB) 1. Refer to curriculum file for more detailed instructions 2. Answer Conclusion Question 4 in your NB

16 Participation 1. Instead of answering Conclusion Questions, we will be trying something different this semester 2. After the activity, reflect on the questions and the objectives of the activities 3. Be prepared to give your responses to: a) Essential Questions b) Conclusion Questions c) Questions about Key Terms d) Questions about the activities e) Your thoughts and explanations 4. You will receive a stamp for 3satisfactory responses