Replication, Transcription, and Translation
|
|
- Amberly Lynch
- 6 years ago
- Views:
Transcription
1 Replication, Transcription, and Translation
2 Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is the synthesis of RNA from DNA. Translation is the synthesis of polypeptides through the combined efforts of rrna, mrna, and trna. Approximately 2% of the nucleotides in DNA result in the formation of polypeptides. These regions in the DNA are called coding regions. The remaining 98% of the nucleotides do not appear to have any function and are called junk DNA.
3 Basic Model of Replication
4 Semiconservative Replication Replication proceeds simultaneously at thousands of replication bubbles along each DNA strand. Replication of an entire DNA strand requires approximately 10 minutes. A single parent DNA duplex molecule is transformed into two daughter DNA duplexes, each containing one strand of the parent DNA and one newly synthesized DNA strand. This form of DNA replication is termed semiconservative.
5 Replication at the Molecular Level Nucleoside triphosphates carrying each of the four bases move into place by forming hydrogen bonds with the bases exposed on the DNA template strand. DNA polymerase catalyzes bond formation between the 5 phosphate group of the arriving nucleoside triphosphate and the 3 OH at the end of the growing polynucleotide strand.
6 Replication Human cell division is extremely complex and takes a little less than one day. Approximately one third of this time is involved in replicating DNA. Replication of DNA is carried out with an error level of less than 1 wrong nucleotide per 10 billion. This extreme accuracy preserves the genetic integrity from generation to generation. DNA replication involves: A replication bubble, with two replication forks. Several Enzymes, including: Unwinding Enzyme DNA polymerase for continuos replication DNA ligase for discontinuous replication Exo- and Endonucleases - to correct errors
7 Replication
8 Replication: The Big Picture The template strand can only be read in the 3 to 5 direction, and the new DNA strand can grow only in the 5 to 3 direction. Only the leading strand, is able to grow continuously; the DNA polymerase traveling in the 3 to 5 direction, is moving in the same direction as the replication fork. On the other strand, the DNA polymerase is moving in the opposite direction as the replication fork. The lagging strand is replicated in short segments called Okazaki fragments. These short DNA segments are joined together by DNA ligase. lagging strand leading strand
9 Transcription Transcription is the synthesis of rrna, trna, and mrna, using the nucleotide sequence information from DNA. The RNA is synthesized as a complementary copy of one of the two DNA single strands (template strand), in a process similar to DNA synthesis. The template strand in a transcription bubble is read by RNA polymerase, starting at an initiation site and ending at a termination site. The error rate of RNA polymerase is less than 1 base in 10,000, much higher than for DNA polymerase.
10 Transcription: The Big Picture Transcription begins when RNA polymerase recognizes a control segment in DNA that precedes the nucleotides to be transcribed.
11 Transcription: The Big Picture RNA polymerase moves down the DNA segment, adding complementary nucleotides to the growing RNA strand. Transcription ends when the RNA polymerase reaches a termination sequence that signals the end of the sequence to be copied.
12 Introns and Exons After its initial synthesis, an RNA molecule is called primary transcript RNA (ptrna). ptrna is subsequently modified by posttranscriptional processing to form m-, r-, and t-rna s. Some posttranscription processing occurs in the nucleus and some in the cytoplasm. An important part of posttranscriptional processing is the deletion of noncoding RNA segments (introns), and splicing together the coding segments (exons).
13 Repressors and Inducers Only a fraction of the DNA in the coding regions of any one cell is actually expressed (~2%). Repressor proteins turn off DNA synthesis coding for proteins not needed in a particular cell type. Inducer proteins turn on DNA synthesis for required proteins. Note: The binding of some inducer and repressor proteins to DNA is influenced through alteration of their three - dimensional structure by interactions with hormone molecules.
14 Translation Translation is the process of polypeptide synthesis, mediated by rrna, mrna, and trna. Translation occurs in the cytoplasm at structures called ribosomes (which contain rrna). mrna binds to a ribosome and provides the genetic message which specifies a particular polypeptide sequence. trna molecules carrying attached α-amino acids supply the amino acids to be polymerized into the peptide.
15 Translation: The Big Picture
16 Ribosomes consist of two subunits, one large and one small, and are composed of rrna (60%) and protein (mostly enzymes required for protein synthesis).
17 trna Structure
18 Translation: trna synthesis Each amino acid is attached to a trna molecule by an enzyme molecule called an aminoacyl-trna synthetase. This enzyme has recognition sites for both the amino acid and the corresponding trna.
19 Translation: trna synthesis
20 Translation at the Molecular Level
21 Translation at the Molecular Level
22 Translation at the Molecular Level
23 Translation at the Molecular Level
24 Translation at the Molecular Level
25 Translation at the Molecular Level
26 Translation at the Molecular Level
27 Translation at Multiple Sites
28 Translation at Multiple Sites
29
30 The Genetic Code The sequence in an mrna is a coded sentence that spells out the order in which amino acid residues should be joined to form a protein. Codon A sequence of three ribonucleotides that codes for a specific amino acid or stops translation. Genetic code The sequence of nucleotides, coded in triplets (codons) in mrna, that determines the sequence of amino acids in protein synthesis.
31 The Genetic Code Of the 64 possible three-base combinations in RNA, 61 code for specific amino acids and 3 code for chain termination (the stop codons). The meaning of each codon is the genetic code, and is universal to all but a few living organisms. Most amino acids are specified by more than one codon. Codons are always written in the 5 to 3 direction.
32 The Genetic Code
33 DNA informational strand: 5 ATG CCA GTA GGC CAC TTG TCA 3 DNA template strand: 3 TAC GGT CAT CCG GTG AAC AGT 5 mrna: 5 AUG CCA GUA GGC CAC UUG UCA 3 Protein: Met Pro Val Gly His Leu Ser
34 Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationCLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code
CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationDNA Model Stations. For the following activity, you will use the following DNA sequence.
Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More information3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:
1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationStation 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.
1. Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.This subunit is composed of what 3 parts? 3.What molecules make
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationPROTEIN SYNTHESIS. Higher Level
PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand
More informationChapter 4 DNA Structure & Gene Expression
Biology 12 Name: Cell Biology Per: Date: Chapter 4 DNA Structure & Gene Expression Complete using BC Biology 12, pages 108-153 4.1 DNA Structure pages 112-114 1. DNA stands for and is the genetic material
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationSection 3: DNA Replication
Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationUnit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated
More informationالحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1
الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء 222Cell Biolgy 1 Lecture 14 222Cell Biolgy 2 DNA replication DNA replication is a semi-conservative
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationZoo-342 Molecular biology Lecture 2. DNA replication
Zoo-342 Molecular biology Lecture 2 DNA replication DNA replication DNA replication is the process in which one doubled-stranded DNA molecule is used to create two double-stranded molecules with identical
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationHonors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
More informationCELL BIOLOGY: DNA. Generalized nucleotide structure: NUCLEOTIDES: Each nucleotide monomer is made up of three linked molecules:
BIOLOGY 12 CELL BIOLOGY: DNA NAME: IMPORTANT FACTS: Nucleic acids are organic compounds found in all living cells and viruses. Two classes of nucleic acids: 1. DNA = ; found in the nucleus only. 2. RNA
More informationMolecular Genetics Unit Test /10C /20 KU /13 TI /22 A
SBI4U Grade 12 University Biology Name: Date: Molecular Genetics Unit Test /10C /20 KU /13 TI /22 A Multiple Choice Answers: [15 KU] Select the best answer by circling the letter corresponding to the question
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationDNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationGenes and Proteins. Objectives
Genes and Proteins Lecture 15 Objectives At the end of this series of lectures, you should be able to: Define terms. Explain the central dogma of molecular biology. Describe the locations, reactants, and
More informationNucleic Acid Structure:
Nucleic Acid Structure: Purine and Pyrimidine nucleotides can be combined to form nucleic acids: 1. Deoxyribonucliec acid (DNA) is composed of deoxyribonucleosides of! Adenine! Guanine! Cytosine! Thymine
More informationMBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationLABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS
LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS OBJECTIVE 1. OBJECTIVE 2. OBJECTIVE 3. OBJECTIVE 4. Describe the structure of DNA. Explain how DNA replicates. Understand the structure
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationName Date Class. The Central Dogma of Biology
Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms
More informationKey Concepts. Ø DNA Replication Ø Protein Synthesis Ø Transcription: Ø Translation: Ø messenger RNA (mrna)
Heredity B-4.3 Explain how DNA functions as the code of life and the blueprint for proteins. (Focus on DNA replication) B-4.4: Summarize the basic process involved in protein synthesis (including transcription
More informationTranscription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationProtein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationGene Expression: From Genes to Proteins
The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationPrinciple 2. Overview of Central. 3. Nucleic Acid Structure 4. The Organization of
Central dogma I and II the flow of genetic information 1. The Transforming Principle 2. Overview of Central Dogma 3. Nucleic Acid Structure 4. The Organization of DNA in Cells 5. DNA Replication 6. Gene
More informationNotes: (Our Friend) DNA. DNA Structure DNA is composed of 2 chains of repeating. A nucleotide = + +
Notes: (Our Friend) DNA Some DNA Basics DNA stands for DNA functions to & genetic info. This information tells an organism s cells what to make and when to make them. Proteins form cell structures and
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationSTRUCTURE OF RNA. Long unbranched,single stranded polymer of ribonucleotide units. A ribonucleotide unit has: 5-Carbon ribose sugar.
STRUCTURE OF RNA & REPLICATION BY:HIMANSHU LATAWA BIOLOGY LECTURER G.G.S.S.SIRHIND MANDI anshu223@gmail.com 9815543311 STRUCTURE OF RNA Long unbranched,single stranded polymer of ribonucleotide units.
More informationFind this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationRapid Learning Center Presents. Teach Yourself High School Biology in 24 Hours. and Functions
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself High School Biology in 24 Hours Gene e Structures and Functions High School Biology Rapid Learning
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationBiology Chapter 12 Test: Molecular Genetics
Class: Date: ID: A Biology Chapter 12 Test: Molecular Genetics True/False Indicate whether the statement is true or false. 1. RNA polymerase has to bind to DMA for an enzyme to be synthesized. 2. The only
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More information