DNA is contained in the nucleus of every cell in your body. Cell Nucleus
|
|
- Stella Hampton
- 5 years ago
- Views:
Transcription
1 DNA is contained in the nucleus of every cell in your body Cell Nucleus 1
2 DNA has a spiral staircase-like structure. The steps are formed by the nitrogen bases of the nucleotides where adenine pairs with thymine and cytosine with guanine.
3 DNA is made up of Nucleotides Each nucleotide consists of a Phosphate Sugar Base A,T,G or C
4 DNA is contained in chromosomes which contain matching genes called alleles bsapp.com
5 Chromosomes are located in the nucleus of every cell Humans have 23 pairs of chromosomes If uncoiled, the DNA in one cell would stretch 6 feet One strand of DNA contains more than 200,000,000 base pairs There are approximately 20,000 diferent genes If the DNA in your body was streatched end ot end, it would go around the earth about 90,000 times. 5
6 23 chromosome pairs 46 chromosomes 44 autosomes, 2 sex chromosomes X and Y chromosomes XX female XY Male
7 Human Genome Project in the 1990s mapped every gene in human DNA They found that a lot of bases in our DNA don t seem to code for anything They are called non-coding DNA, or Junk DNA 7
8 There seem to be regions on all of our DNA that just don t code for anything 8
9 Non-coding, or Junk DNA, seems to increase as species get more complex Human DNA seems to be about 90% Junk 9
10 Discovery of Satellite DNA When scientists were trying to find out more about DNA, they used a centrifuge to separate out the DNA. They noticed satellite bands above the main DNA layer. Uniform Gradient DNA fragments Centrifugation Satellite bands of DNA Main band of DNA Cell debris 10
11 DNA from the satellite bands was named satellite DNA. Satellite DNA consists of highly repetitive sequences found mostly in centromeres and telomeres. 11
12 The length of repeat unit varies in satellite DNA. DNA with repeat unit from 2 to 6 bases long is called microsatellite DNA because the repeat sequence is shorter. The term microsatellite DNA is based on the historical term of satellite DNA. The location of microsatellite is mostly NOT found on centromeres or telomeres of the chromosomes. 12
13 Terms in genetics: example in human chromosomes Locus is the specific position on the chromosome. Homologous chromosomes (one from father and one from mother) Locus (heterozygous: having two different alleles) Allele is alternative form of a gene at a locus. Homozygous: having the same allele at a locus. Heterozygous: having different alleles at a locus. 13
14 Tandem Repeats Portions of the DNA molecule contain sequences of bases that are repeated numerous times, known as tandem repeats What is important to understand is that all humans have the same type of repeats, but there is tremendous variation in the number of repeats each of us have. 14
15 Those with two-base repeat unit Types of Microsatellites CGACTAGCCACGTGTGTGTGTGTGTGTGTGTGTACAGGACTTAGC 11 repeats (allele 11) Those with three-base repeat unit TTCTAGCCGCTTGTTGTTGTTGTTGTTGTTGTTGCCAGTACTCAG Those with four-base repeat unit 8 repeats (allele 8) GCGAAGTTCCGAATGAATGAATGAATGAATGAATGAATGCCGCATT 7 repeats (allele 7) Most microsatellite DNA loci used in human identification have 4-base pair repeats. Microsatellites are also called Short Tandem Repeats (STRs). 15
16 Slippage during DNA replication creates variation in number of repeat units Normal replication GAC GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG CTG New strand Template strand Slippage in new strand A G C GAC GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG CTG Next replication GAC Insertion mutation (n+1) GAC GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG GAC GAC GAC GAC GAC GAC Normal length Slippage in template GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG C G T Next replication Deletion mutation (n-1) CTG CTG CTG CTG CTG GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG CTG GAC GAC GAC GAC GAC GAC Normal length 16
17 Q: A person has the following microsatellite sequence on one chromosome: Repeat region GCGAAGTTCCGGATGGATGGATGGATGGATGGATGCCGCATT What is the sequence of the repeat unit? A. ATG B. GATG C. ATGGAT D. GGATGG E. None of the above 17
18 The genotype of a person for each locus is shown as the number of repeat units he/she carries. Since a person is diploid and has a pair of homologous chromosomes, the genotype is shown as two numbers. Genotype 6, 8 (6 repeats, 8 repeats) Repeat sequences Repeat sequences Genotype 7, 7 (7 repeats, 7 repeats) 18
19 Q: If this person s homologous chromosomes have the following sequences: Repeat region GCGAAGTTCCGGATGGATGGATGGATGGATGCCGCATT CGCTTCAAGGCCTACCTACCTACCTACCTACGGCGTAA GCGAAGTTCCGGATGGATGGATGGATGGATGGATGGATGCCGCATT CGCTTCAAGGCCTACCTACCTACCTACCTACCTACCTACGGCGTAA What is the sequence of the repeat unit? A. GAT B. GATG C. GATGG D. CTA What is this person s genotype? A. TH01: 4,6 B. TH01: 5, 6 C. TH01: 6, 7 D. TH01: 5, 7 Using Base Pairs of A-T and C-G, what is the complement of TGGAT? A. GGTAT B. TTAGT C. CAACA D. ACCTA 19
20 3 Types of DNA Testing RFLP - Restriction Fragment Length Polymorphism STR Short Tandem Repeats MtDNA Mitochondrial DNA bsapp.com
21 RFLP (Restriction Fragment Length Polymorphism) Oldest/Cheapest test Requires large amounts of nondegraded DNA Utilizes the longer sequences of VNTR s bsapp.com
22
23
24 What to do when there s not much there
25 PCR (Polymorphism Chain Reaction) Does NOT give identity Increases the amount of DNA available for typing by producing millions of copies Use to amplify tiny quantities and degraded samples Extremely sensitive to contamination bsapp.com
26 Heat separates DNA Primer attaches Duplicate strand formed
27
28
29
30
31
32
33 PCR and RFLP PCR technology cannot be applied to RFLP DNA typing. The RFLP strands are too long, often numbering in the thousands of bases. PCR is best used with DNA strands that are no longer than a couple of hundred bases. 33
34 Short Tandem Repeats (STRs) STRs consist of repeating sequences of 3 to 7 bases in length, and the entire strand of an STR is also very short, less than 450 bases in length. They serve as useful markers for identification because they are found in great abundance throughout the human genome. Used to evaluate specific regions (loci) of DNA strands Utilizes shorter stands than VNTR s Usually requires PCR prior to testing 34
35 STR Number of repeats is transferred just like any other DNA material Works on very tiny sample sizes when amplified by PCR thousands of STR sites have been identified
36 Mitochondrial DNA Analysis Used for samples that cannot be analyzed using RFLP or STR Uses DNA extracted from mitochondrion rather than nuclear DNA Mitochondrial DNA degrades at a much slower rate than nuclear DNA Allows analysis of older biological samples, such as hair and bones Not as precise as STR Extremely expensive and time consuming
37 bsapp.com
38 Mitochondria are the powerhouses Oocyte of the Maturation cell. Cellular energy comes from mitochondira. Mitochondria have their own DNA.
39 Regular DNA - from all of your ancestors. Mitochondrial DNA is inherited from your mother ONLY
DNA. Using DNA to solve crimes
DNA Using DNA to solve crimes Physical characteristics are inherited from both parents DNA contains all the inherited information for each person DNA is contained in the nucleus of every cell in your body
More information4.1. Genetics as a Tool in Anthropology
4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of
More informationDNA Analysis Students will learn:
DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How
More informationDNA. Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins
DNA DNA Deoxyribo- Nucleic Acid Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins Parts = nucleotide 1. Sugar (deoxyribose) 2.
More informationWhat is a chromosome and where is it located and what does it
What is a chromosome and where is it located and what does it do? A general overview for neophytes A chromosome is one of the components of the cell inside the nucleus which codes for proteins and controls
More informationDNA. Evidence. How is DNA be used to solve crimes?
DNA Evidence How is DNA be used to solve crimes? How is DNA used as evidence? Each person s DNA is different from other people (except identical twins). DNA collected from a crime scene can either link
More informationPhysical Anthropology 1 Milner-Rose
Physical Anthropology 1 Milner-Rose Chapter 3 Genetics: Reproducing Life and Producing Variation Our Origins By Clark Spencer Larsen Natural Selection operates on the levels of the 1. living, behaving
More informationDNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the
DNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the exact same DNA. DNA patterns from four sets of twins which are identical? DNA fingerprinting
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationGenetics 101. Prepared by: James J. Messina, Ph.D., CCMHC, NCC, DCMHS Assistant Professor, Troy University, Tampa Bay Site
Genetics 101 Prepared by: James J. Messina, Ph.D., CCMHC, NCC, DCMHS Assistant Professor, Troy University, Tampa Bay Site Before we get started! Genetics 101 Additional Resources http://www.genetichealth.com/
More informationMaking sense of DNA For the genealogist
Making sense of DNA For the genealogist Barry Sieger November 7, 2017 Jewish Genealogy Society of Greater Orlando OUTLINE Basic DNA concepts Testing What do the tests tell us? Newer techniques NGS Presentation
More informationDNA: THE INDISPENSIBLE FORENSIC SCIENCE TOOL
Chapter 9 DNA: THE INDISPENSIBLE TOOL By Richard Saferstein Upper Saddle River, NJ 07458 1 Chapter 9 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence
More information4.1 CELL DIVISION AND GENETIC MATERIAL
4.1 CELL DIVISION AND GENETIC MATERIAL GENETICS Field of biology Study how genetic information is passed from one generation of organism/cells to the next THE CELL THEORY developed in mid-1800s 1. All
More informationOverview of Human Genetics
Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationMitochondrial analysis in Forensic Scienses
Mitochondrial analysis in Forensic Scienses 2011 Classification of human genome Genome 3.2 Gb Genic and related (25 %) Coding and regulatory (1.5 %) Non-coding (23.5% - introns, pseudogenes) Extragenic
More informationTHE STUDY OF GENETICS is extremely
Exploring Animal Genetics and Probability THE STUDY OF GENETICS is extremely valuable to several areas of science. From medical to agricultural applications, the development of new techniques in studying
More informationBasic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
More information1. An alteration of genetic information is shown below. 5. Part of a molecule found in cells is represented below.
1. An alteration of genetic information is shown below. 5. Part of a molecule found in cells is represented below. A-G-T-A-C-C-G-A-T A-G-T-G-A-T This type of alteration of the genetic information is an
More informationAppendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
More informationFORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after
More informationDNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each
1 DNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each nucleotide is made up of a sugar called deoxyribose
More informationFurther Reading - DNA
Further Reading - DNA DNA BACKGROUND What is DNA? DNA (short for deoxyribonucleic acid ) is a complex molecule found in the cells of all living things. The blueprint for life, DNA contains all the information
More informationLecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
More informationPOPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the
POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)
More informationTrait: a characteristic that can vary in size or form from individual to individual within a species; can be passed on from generation to generation
The Function of the Nucleus within the Cell (pp. 112-121) Trait: a characteristic that can vary in size or form from individual to individual within a species; can be passed on from generation to generation
More informationMicrosatellite markers
Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.
More informationAGENDA for 10/10/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES: Due Fri, 10-11
AGENDA for 10/10/13 AGENDA: 1. 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment length
More informationStructure of DNA Introductory Videos:
Structure of DNA Introductory Videos: http://www.youtube.com/watch?v=qy8dk5is1f0 http://www.youtube.com/watch?v=zghkhmoyc5i DNA is a macromolecule made of nucleotides. Each human cell carries a complete
More informationPUBH 8445: Lecture 1. Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota
PUBH 8445: Lecture 1 Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota saonli@umn.edu Statistical Genetics It can broadly be classified into three sub categories:
More informationGenetics and Heredity. Mr. Gagnon
Genetics and Heredity Mr. Gagnon Key Terms: Traits Heredity Genetics Purebred Genes Alleles Recessive Allele Dominant Allele Hybrids Key Concepts: What factors control the inheritance of traits in organisms?
More informationMolecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98
Molecular studies (R) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Dr. Imtiaz A. Khan Pr. cientist / PI sugarcane and molecular marker group NIA-2012 NIA-2010
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationSTAT 536: Genetic Statistics
STAT 536: Genetic Statistics Karin S. Dorman Department of Statistics Iowa State University August 22, 2006 What is population genetics? A quantitative field of biology, initiated by Fisher, Haldane and
More informationUNIT MOLECULAR GENETICS AND BIOTECHNOLOGY
UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4
More informationGenetics and Heredity Power Point Questions
Name period date assigned date due date returned Genetics and Heredity Power Point Questions 1. Heredity is the process in which pass from parent to offspring. 2. is the study of heredity. 3. A trait is
More informationDNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology
DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology Outline Molecular techniques for the authentication of human cell lines Mechanism
More informationDNA analysis. Anja Bye Post doktor. K.G. Jebsen Senter for Hjertetrening. Institutt for Sirkulasjon og Bildediagnostikk Det Medisinske Fakultet NTNU
DNA analysis Anja Bye Post doktor K.G. Jebsen Senter for Hjertetrening Institutt for Sirkulasjon og Bildediagnostikk Det Medisinske Fakultet NTNU Focus of this lecture What is DNA? Comparing DNA from different
More informationPurines vs. Pyrimidines
Introduction to Genetics/DNA Replication The DNA molecule is found in the nucleus and is composed of nucleotides The DNA Molecule Composed of 2 polymers of nucleotides Polymers are oriented in antiparallel
More informationAGENDA for 10/11/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES:
AGENDA for 10/11/13 AGENDA: 1. Finish 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment
More informationStructure of DNA. Characteristics of DNA. Carries genetic information for traits in an organism. Twisted, double-helix structure
Structure of DNA Characteristics of DNA Carries genetic information for traits in an organism Twisted, double-helix structure Coding is carried in two sets of complimentary bases: Adenine-Thymine Guanine-Cytosine
More informationobjective To Study basics of DNA Structure Properties Replication Transcription Translation
Basics of DNA Dr. Amol Kharat objective To Study basics of DNA Structure Properties Replication Transcription Translation Cellular composition DNA is contained in nucleus of cell Phospho-lipids and proteins
More informationRead each question, and write your answer in the space provided. 2. How did Mendel s scientific work differ from the work of T. A. Knight?
Name Date Class CHAPTER 8 DIRECTED READING Mendel and Heredity Section 8-1: The Origins of Genetics Mendel and Others Studied Garden-Pea Traits 1. What did T. A. Knight discover? 2. How did Mendel s scientific
More informationAnalysis in Forensic Science
Chapter 16 Gene Cloning & DNA Analysis in Forensic Science 1. DNA analysis in identification of crime suspects 2. Studying kinship by DNA profiling 3. Sex identification by DNA analysis Forensic science
More informationOverview. Introduction
Genetics 101: Introduction Overview Important terminology DNA extraction, gel electrophoresis, PCR Allozymes (Protein electrophoresis) RFLP AFLP Sequencing Microsatellites SNPs Costs, Sample Collection
More informationOverview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR
Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. 2. True or False? The sequence of
More informationLecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6
Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationEOC Review Reporting Category 2 Mechanisms of Genetics
EOC Review Reporting Category 2 Mechanisms of Genetics The student will demonstrate an understanding of the mechanisms of genetics. Langham Creek High School 2012-2013 By PresenterMedia.com TEK 6A Identify
More informationJanuary 07, (adenine, guanine, cytosine, thymine)
(adenine, guanine, cytosine, thymine) DNA at Work - DNA is used to make proteins - proteins are made by linking amino acids (there are 20 possible amino acids) - sequence of amino acids determines shape/function
More informationBIO 202 Midterm Exam Winter 2007
BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive
More informationINTRODUCTION TO MOLECULAR GENETICS. Andrew McQuillin Molecular Psychiatry Laboratory UCL Division of Psychiatry 22 Sept 2017
INTRODUCTION TO MOLECULAR GENETICS Andrew McQuillin Molecular Psychiatry Laboratory UCL Division of Psychiatry 22 Sept 2017 Learning Objectives Understand: The distinction between Quantitative Genetic
More informationPart I: Predicting Genetic Outcomes
Part I: Predicting Genetic Outcomes Deoxyribonucleic acid (DNA) is found in every cell of living organisms, and all of the cells in each organism contain the exact same copy of that organism s DNA. Because
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
More informationL. GORGAN. However, even in sexually reproducing species, not all DNA is inherited from both parents. There are two important exceptions, the uniparen
International Journal of Criminal Investigation Volume 1 Issue 2 103-107 DNA SOURCE OF FORENSIC EVIDENCE Lucian GORGAN * 1) Al.I. Cuza University of Iasi, Faculty of Biology, 22, Blvd. Carol I, 700506,
More informationDNA & THE GENETIC CODE DON T PANIC! THIS SECTION OF SLIDES IS AVAILABLE AT CLASS WEBSITE
DNA & THE GENETIC CODE DON T PANIC! THIS SECTION OF SLIDES IS AVAILABLE AT CLASS WEBSITE Recommended reading: The Double Helix: A Personal Account of the Discovery of the Structure of DNA, by James D.
More informationGeneral DNA Information
1 Use of this PPT This PPT has lots of information. I may or may not discuss each slide. Use the information to answer questions in your Question Packets. The packets are the study guide for the tests
More informationGenetics Lecture 16 Forensics
Genetics Lecture 16 Forensics DNA Forensics Genetics is arguably the most influential science today dramatically affecting technologies in fields as diverse as agriculture, archaeology, medical diagnosis,
More informationDNA and Protein Synthesis Practice. C. protein D. carbohydrate 7. Which of the following best describes how DNA and RNA are similar?
N and Protein Synthesis Practice Name: ate: 1. The discovery of which of the following has most directly led to advances in the identification of suspects in criminal investigations and in the identification
More informationBiology unit. Big Idea. Cells are derived from cells Part 1 Review, what s in a cell!?
Biology unit Big Idea Cells are derived from cells Part 1 Review, what s in a cell!? (cell nucleus and DNA-Gr 10 material for next year) http://www.popsci.com/science/article/2013-03/watch-absolutely-beautiful-animatedexplainer-dna
More informationI. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:
I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction
More informationHeredity and Genotyping Notes:
Vocabulary: Heredity and Genotyping Notes: 02 January 2019 Heredity: the passing of physical characters from parents to offspring Gene: a word used to describe factors that control a trait Alleles: the
More informationCELLULAR PROCESSES; REPRODUCTION. Unit 5
CELLULAR PROCESSES; REPRODUCTION Unit 5 Cell Cycle Chromosomes and their make up Crossover Cytokines Diploid (haploid diploid and karyotypes) Mitosis Meiosis What is Cancer? Somatic Cells THE CELL CYCLE
More informationGenetic Identity. Steve Harris SPASH - Biotechnology
Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)
More informationMore often heard about on television dramas than on the news, DNA is the key to solving crimes the scientific way. Although it has only been
DNA Matching More often heard about on television dramas than on the news, DNA is the key to solving crimes the scientific way. Although it has only been relatively recent (compared the course of forensic
More informationApplied Practice. Inheritance, Genetic Mutations, and DNA Technology STAAR Biology EOC
Applied Practice Inheritance, Genetic Mutations, and DNA Technology STAAR Biology EOC RESOURCE GUIDE Volume 4 Copyright 2013 by Applied Practice All rights reserved. No part of the Answer Key and Explanations
More informationWhat is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are
DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each
More informationAllele: Chromosome DNA fingerprint: Electrophoresis: Gene:
Essential Vocabulary Allele: an alternate form of a gene; for example, a gene for human hair color may have alleles that cause red or brown hair Chromosome: a cell structure that contains genetic information
More informationWrite: Unit 5 Review at the top.
Warm-up Take out a sheet of paper: Write: Unit 5 Review at the top. As each question goes on the board, write that question down and answer it. When answers come up, either write correct next to what you
More informationBiology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
More informationTHE CELLULAR AND MOLECULAR BASIS OF INHERITANCE
Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS
More informationGENETICS. Genetics developed from curiosity about inheritance.
GENETICS Genetics developed from curiosity about inheritance. SMP - 2013 1 Genetics The study of heredity (how traits are passed from one generation to the next (inherited) An inherited trait of an individual
More informationRFLP Method - Restriction Fragment Length Polymorphism
RFLP Method - Restriction Fragment Length Polymorphism RFLP (often pronounced "rif lip", as if it were a word) is a method used by molecular biologists to follow a particular sequence of DNA as it is passed
More informationGenerating Forensic DNA Profiles
Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 12-2012 Generating Forensic DNA Profiles Dan E. Krane Wright State University - Main Campus, dan.krane@wright.edu
More informationDNA: An Introduction to structure and function. DNA by the numbers. Why do we study DNA? Chromosomes and DNA
DA: An Introduction to structure and function Hopefully a review The structure of DA - your job during the PowerPoint: Make a labeled sketch Label the structure of a nucleotide Know which bases pair up
More informationExam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA 2. Which two scientists discovered DNA? a. Mendel and Newton b. Bohr and Crick c. Watson and Crick
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationWhat is Genetics? Genetics The study of how heredity information is passed from parents to offspring. The Modern Theory of Evolution =
What is Genetics? Genetics The study of how heredity information is passed from parents to offspring The Modern Theory of Evolution = Genetics + Darwin s Theory of Natural Selection Gregor Mendel Father
More informationGenetics Test. Multiple Choice Identify the choice that best completes the statement or answers the question.
Genetics Test Multiple Choice Identify the choice that best completes the statement or answers the question. 41. Situations in which one allele for a gene is not completely dominant over another allele
More informationUnit 4-DNA Analysis Review Guide
Name: KEY Match the term on the right with the definition on the left. Unit 4-DNA Analysis Review Guide 1. A procedure used to determine the order of the base pairs that make up a DNA molecule E 2. These
More informationC A T T A G C nitrogenous complimentary G T A A T C G to each other
Name DNA RNA Review Worksheet Date 1. What does DNA stand for? Deoxyribonucleic acid 2. What is DNA s primary function? - Provides a pattern for protein manufacture - Provides a pattern for replication
More informationApplication of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.
Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s
More information3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:
1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what
More information3.A.1 DNA and RNA: Structure and Replication
3.A.1 DNA and RNA: Structure and Replication Each DNA polymer is made of Nucleotides (monomer) which are made of: a) Phosphate group: Negatively charged and polar b) Sugar: deoxyribose- a 5 carbon sugar
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationWhy learn linkage analysis?
Why learn linkage analysis? - and some basic genetics Kaja Selmer 2013 Outline What is linkage analysis and why learn it? An example of a successful linkage analysis story Basic genetics DNA content and
More informationGENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA
Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the
More informationBENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture
BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism
More information1
1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationHow about the genes? Biology or Genes? DNA Structure. DNA Structure DNA. Proteins. Life functions are regulated by proteins:
Biology or Genes? Biological variation Genetics This is what we think of when we say biological differences Race implies genetics Physiology Not all physiological variation is genetically mediated Tanning,
More informationOutline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage
Genetics Outline Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Chromosomes are composed of chromatin, which is DNA and associated
More informationBiology 303 EXAM II 10/27/08
Biology 303 EXAM II 10/27/08 NAME ------------------------------------------------------------------------------------------------------------------ This exam consists of 40 multiple choice questions worth
More informationDNA: The Code of Life
DNA: The Code of Life Chapter Test A Multiple Choice Write the letter of the correct answer on the line at the left. 1. Cancer is a disease in which cells a. grow and divide uncontrollably. b. die before
More informationLiving Environment. Directions: Use Aim # (Unit 4) to complete this study guide.
Name: Date: Period: Living Environment Living Environment Unit 4 Genetics Study Guide Due Date: Test Date: Unit 5 Important Topics: I. Aim # 20 DNA Structure and Function II. Aim # 21 DNA Replication III.
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationDNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
More informationTHE STRUCTURE AND FUNCTION OF DNA
THE STRUCTURE AND FUNCTION OF DNA 1. DNA is our genetic code!!! It is passed from generation to generation. It carries information that controls the functions of our cells. DNA stands for deoxyribonucleic
More information