CODIS. Sir Alec Jeffreys. minisatellites
|
|
- Erica Sims
- 6 years ago
- Views:
Transcription
1 CODIS Sir Alec Jeffreys minisatellites
2 CODIS - Repetitive DNA Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member genes (e.g. hemoglobin, immunoglobulin)
3 CODIS - Repetitive DNA Satellite DNA Unit - Repeat - Location - Examples bp depending on species times. Generally heterochromatic. Centromeric DNA, telomeric DNA. There are at least 10 distinct human types of satellite DNA. A single type may be more than 1% of the genome (equivalent to 3 entire E. coli genomes).
4 CODIS - Repetitive DNA Human satellite DNA is prone to be multimeric or hierarchical in structure. Human α satellite DNA (centromeric) is typically 171 bp long present as dimers (342 bp) or up to 16 mers (2736 bp) as the repeating units. Generally less length variation than minisatellites or microsatellites.
5 CODIS - Repetitive DNA Human β satellite DNA is present as 30,000-60,000 copies of a 68 bp monomer (2,040,000-4,080,000 bp) on the metacentric chromosome 9 and the acrocentric chromosomes 13, 14, 15, 21, and 22. It is a pericentromeric repeat in humans.
6 CODIS - Repetitive DNA Examples of Satellites from Drosophila virilus. Satellite Primary Copies per Percent of Sequence genome genome I ACAAACT % II ATAAACT % III ACAAATT % 41%
7 CODIS - Repetitive DNA Minisatellite DNA Unit bp (average about 20). Repeat - Location - Examples - Generally times ( bp long). Generally euchromatic. DNA fingerprints. Tandemly repeated but often in dispersed clusters. Also called VNTR s (variable number tandem repeats). Human λ33.1 minisatellite (62 bp) AAGGGTGGGCAGGAAGTGGAGTGTGTGCCTG CTTCCCTTCCCTGTCTTGTCCTGGAAACTCA Human λ33.5 minisatellite (17 bp) YGGGCAGGAGGGGGAGG
8 CODIS - Repetitive DNA Microsatellite DNA Unit bp (most 2). Repeat - on the order of times. Location - Generally euchromatic. Examples - Most useful marker for population level studies. This example is from a water snake......tccagacaaggtggtgtgtgtgtgtgtgtg TGTGTGTGTGTGTTTCTCCAGTGAGATTTA...
9 CODIS - Repetitive DNA Other repetitive elements include Transposable elements - Sequences that have the ability to move around within and between genomes. Most eukaryotes have them while prokaryotes have a different class of mobile elements. LINES, SINES and other retrosequences - Mobile sequences that copy themselves within genomes via an RNA intermediate. High copy number genes - Examples include ribosomal genes and histone genes. Multifamily member genes - Examples include hemoglobin and immunoglobulin genes.
10 CODIS - the database In 1990 the FBI established a pilot project. In 1994 CODIS (Combined DNA Index System) was established. In 1998 it was fully operational. In 2007 it contained more than records. Records contain specimen numbers and DNA profiles but nothing else.
11 CODIS - the markers From wikipedia (28/11/08).
12 DNA databases go too far
13 CODIS and probabilities Juries get confused by numbers.
14 CODIS and LCN In the U.S., to my knowledge, LCN is used only for intelligence and not for evidence.
15 what are your relatives up to? CSI hasn t picked up on this theme yet.
16 AFIS and CODIS are Biometrics Both AFIS and CODIS are examples of biometrics. In today s environment, such methods are becoming increasingly used. Other biometric methods include, Ear shape-structure Facial recognition Hand thermograms Digital voice signatures Gait Hand geometry Iris scans Retinal scans
17 NCBI Science is based on the production and the exchange of knowledge
18 NCBI Science is based on the production and the exchange of knowledge Strong need for places were data could be freely available to verify results to facilitate the progress of research
19 NCBI Science is based on the production and the exchange of knowledge Strong need for places were data could be freely available to verify results to facilitate the progress of research Submission to databases is mandatory prior to article publication sequences (GenBank, EMBL, DDBJ, SWISSPROT) gene expression (Gene Expression Omnibus, Array Express)
20 NCBI Welcome-Trust Sanger Institute The Institute of Genome Research (TIGR) Celera The Craig Venter Institute Genome sequencing center of Washington University at Saint Louis The Broad Institute in Cambridge Mass. Riken Institute in Japan
3I03 - Eukaryotic Genetics Repetitive DNA
Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member
More informationLECTURE 20. Repeated DNA Sequences. Prokaryotes:
LECTURE 20 Repeated DNA Sequences Prokaryotes: 1) Most DNA is in the form of unique sequences. Exceptions are the genes encoding ribosomal RNA (rdna, 10-20 copies) and various recognition sequences (e.g.,
More informationMicrosatellite markers
Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil. Lecture Notes: Features of the Human Genome Reading List International Human Genome Sequencing Consortium (2001). Initial sequencing and analysis
More informationThe wrong file for Lecture 8 was posted on the website. I ve sent the correct file and it should be posted by the time class is out.
The wrong file for Lecture 8 was posted on the website. I ve sent the correct file and it should be posted by the time class is out. Grade Distribution for EXAM 1 45 40 38 No. Scores/Grade 35 30 25 20
More informationBiologia Cellulare Molecolare Avanzata 2.2. Functional & regulatory genomics module
Biologia Cellulare Molecolare Avanzata 2.2 Functional & regulatory genomics module 1. Complexity of eukaryotic genomes. 2. Basic concepts of gene transcription and regulation 3. Transcriptomes 4. Coding,
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
More information"PhD Course Fall 2017"
Prof. Fahd M. Nasr Faculty of Sciences Lebanese University Beirut, Lebanon Winding your way through the genome, transcriptome, proteome to human diseases "PhD Course Fall 2017" Lecture 3 1 Genome structure,
More informationChapter 20: The human genome
Chapter 20: The human genome Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Bioinformatics and Functional Genomics (Wiley-Liss, 3 rd edition, 2015) You may use this PowerPoint for teaching purposes
More informationBiology 445K Winter 2007 DNA Fingerprinting
Biology 445K Winter 2007 DNA Fingerprinting For Friday 3/9 lab: in your lab notebook write out (in bullet style NOT paragraph style) the steps for BOTH the check cell DNA prep and the hair follicle DNA
More informationGenome Projects. Part III. Assembly and sequencing of human genomes
Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences
More informationIntroduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools
Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),
More informationGreene 1. Finishing of DEUG The entire genome of Drosophila eugracilis has recently been sequenced using Roche
Greene 1 Harley Greene Bio434W Elgin Finishing of DEUG4927002 Abstract The entire genome of Drosophila eugracilis has recently been sequenced using Roche 454 pyrosequencing and Illumina paired-end reads
More informationGATE SCIENCE - BIOTECHNOLOGY SAMPLE THEORY
GATE SCIENCE - BIOTECHNOLOGY SAMPLE THEORY GENOME ORGANIZATION MOLECULAR STRUCTURE OF GENE CHROMOSOMES AND CHROMATIN For IIT-JAM, JNU, GATE, NET, NIMCET and Other Entrance Exams 1-C-8, Sheela Chowdhary
More informationwww.iqeducation.in Name : Roll No. :.... Invigilator s Signature :.. CS/B.Sc(H)/MOL.BIO/SEM-3/GNO-304/2012-13 2012 GENOME ORGANIZATION Time Allotted : 3 Hours Full Marks : 70 The figures in the margin
More informationBio 121 Practice Exam 3
The material covered on Exam 3 includes lecture since the last exam and text chapters 13-21. Be sure that you read chapter 19, which was not represented in the notes. 1. Which of the following is an enveloped
More informationThe Human Genome. The raw data. The repeat content. Composition of the human genome bases. A s T s C s and G s and N s.
3000000000 bases The Human Genome The raw data GATCTGATAAGTCCCAGGACTTCAGAAGagctgtgagaccttggccaagt cacttcctccttcaggaacattgcagtgggcctaagtgcctcctctcggg ACTGGTATGGGGACGGTCATGCAATCTGGACAACATTCACCTTTAAAAGT TTATTGATCTTTTGTGACATGCACGTGGGTTCCCAGTAGCAAGAAACTAA
More informationBIO 202 Midterm Exam Winter 2007
BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive
More informationB. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.
MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric
More informationCell Nucleus. Chen Li. Department of Cellular and Genetic Medicine
Cell Nucleus Chen Li Department of Cellular and Genetic Medicine 13 223 chenli2008@fudan.edu.cn Outline A. Historical background B. Structure of the nucleus: nuclear pore complex (NPC), lamina, nucleolus,
More informationPhiladelphia University Faculty of Science Department of Biotechnology and Genetic Engineering Winter Semester, 2009/2010.
Philadelphia University Faculty of Science Department of Biotechnology and Genetic Engineering Winter Semester, 2009/2010 Course Syllabus Course Title: Human Genetics Course Level: Third year Lecture Time:
More informationSome representative viruses
Viruses (Ch. 18) Structure Not cells, not alive. genome, capsid, envelope Function entry, replication, gene expression, selfassembly Some assimilate into host genome Origin as runaway genes Some representative
More informationGenome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007
Genome and DNA Sequence Databases BME 110: CompBio Tools Todd Lowe April 5, 2007 Admin Reading: Chapters 2 & 3 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring07/bme110-calendar.html
More informationGenomes summary. Bacterial genome sizes
Genomes summary 1. >930 bacterial genomes sequenced. 2. Circular. Genes densely packed. 3. 2-10 Mbases, 470-7,000 genes 4. Genomes of >200 eukaryotes (45 higher ) sequenced. 5. Linear chromosomes 6. On
More informationAvailable online Journal of Scientific and Engineering Research, 2016, 3(3): Research Article
Available online www.jsaer.com, 2016, 3(3):663-668 Research Article ISSN: 2394-2630 CODEN(USA): JSERBR Analysis of Housekeeping and Tissue Specific ESTs for Inexact Microsatellites in Capsicum L. Ayse
More informationDNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology
DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology Outline Molecular techniques for the authentication of human cell lines Mechanism
More informationSequencing Genomes. Human Genome Project: History, results and impact. teník, PhD. Beginnings of sequencing
Sequencing Genomes Human Genome Project: History, results and impact MUDr. Jan Pláten teník, PhD. (December 2010) Beginnings of sequencing 1965: Sequence of a yeast trna (80 bp) determined 1977: Sanger
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationCHAPTER 21 GENOMES AND THEIR EVOLUTION
GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of
More informationApplication of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.
Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s
More informationNeed a little extra help?
Need a little extra help? Extra office hours! MWRF from 11:00 till 1:00 or by appointment: Marion.Brodhagen@wwu.edu. edu Tutoring center in Old Main 387: BIOL 205 drop-in tutoring at the following times:
More informationd. reading a DNA strand and making a complementary messenger RNA
Biol/ MBios 301 (General Genetics) Spring 2003 Second Midterm Examination A (100 points possible) Key April 1, 2003 10 Multiple Choice Questions-4 pts. each (Choose the best answer) 1. Transcription involves:
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationMolecular Cell Biology - Problem Drill 06: Genes and Chromosomes
Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes Question No. 1 of 10 1. Which of the following statements about genes is correct? Question #1 (A) Genes carry the information for protein
More information2017 Amplyus, all rights reserved
The Human Genome Project What it is: The initiative that sequenced the entire human genome The Human Genome Project (HGP) is widely recognized as a tremendous success of government initiative and international
More informationHUMAN GENOME. Department of Medical Genetics Poznan University of Medical Sciences Katarzyna Wicher M.Sc.
HUMAN GENOME Department of Medical Genetics Poznan University of Medical Sciences Katarzyna Wicher M.Sc. The human genome is the complete set of genetic information for humans. Nuclear genome Nuclear genome
More informationA) The constituent monomer of DNA and RNA. C) The basic structural unit of chromatin with "bead-on-a-string" morphology
MATCHING. Choose the item in column 2 that best matches each item in column 1. Please select the best match for each term. 1) Centromere 2) Nucleoid 3) Nucleotide 4) Chromosome 5) Nucleosome A) The constituent
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationLecture 6. Chromosome Structure and Function in Mitosis
Lecture 6 Chromosome Structure and Function in Mitosis Outline: Chromosome Organization and Function in Interphase Chromatin effects on replication Effects of nuclear organization on gene expression Chromosomes
More informationThe C-value paradox. PHAR2811: Genome Organisation. Is there too much DNA? C o t plots. What do these life forms have in common?
PHAR2811: enome Organisation Synopsis: -value paradox, different classes of DA, repetitive DA and disease. If protein-coding portions of the human genome make up only 1.5% what is the rest doing? The -value
More informationGENES & GENOME DATABASES
GENES & GENOME DATABASES BME 110/BIOL 181 Computational Biology Tools Prof. Todd Lowe April 5, 2012 ADMIN Discuss Fun Quiz Readings: Dummies Chapters 1, 2 (pp. 29-56), Ch 3; NYTimes piece on Jim Kent Assigned
More informationMolecular Probes. Mitesh Shrestha
Molecular Probes Mitesh Shrestha Molecular Probes Small DNA segments (genomic DNA, cdna or synthetic oligonucleotides) or RNA segments (often synthesized on DNA template) that recognize complementary sequences
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationTheoretical Physics Methods for Computational Biology.
Theoretical Physics Methods for Computational Biology. M. Caselle Dip di Fisica Teorica, Univ. di Torino Berlin, 06/04/2006 Plan of the lectures 1. Introduction: Biological background Genome organization.
More informationBy the beginning of the twenty-first century, molecular
10 MOLECULA STUCTUE OF GENES AND CHOMOSOMES These brightly colored xfish-painted chromosomes are both beautiful and useful in revealing chromosome anomalies and in comparing karyotypes of different species.
More informationChapter Eleven: Chromosome Structure and Transposable Elements
Chapter Eleven: Chromosome Structure and Transposable Elements COMPREHENSION QUESTIONS Section 11.1 *1. How does supercoiling arise? What is the difference between positive and negative supercoiling? Supercoiling
More informationDegenerate site - twofold degenerate site - fourfold degenerate site
Genetic code Codon: triple base pairs defining each amino acid. Why genetic code is triple? double code represents 4 2 = 16 different information triple code: 4 3 = 64 (two much to represent 20 amino acids)
More informationChapter 19. Control of Eukaryotic Genome. AP Biology
Chapter 19. Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationHuman chromosome engineering in DT40 cells
Human chromosome engineering in DT40 cells Three main areas of application: 1. Manipulation of genes/ gene clusters for functional studies. 2. Dissecting the DNA requirements of functional human centromeres
More informationGenome Sequencing-- Strategies
Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that
More informationPacking ratio the length of DNA divided by the length into which it is packaged
DNA Structure DNA Replication Eukaryotic Chromosome Structure Study Questions DNA Structure, Replication and Eukaryotic Chromatin Structure Overheads DNA Structure, Replication and Eukaryotic Chromatin
More informationChromosomes. M.Sc. Biotechnology. Hawler Medical University, Iraq
Chromosomes Bashdar Mahmud Hussen M.Sc. Biotechnology Hawler Medical University, Iraq bashdar@res.hmu.edu.iq bmhscience@yahoo.com History of Chromosome Karl Nagali (1842) E. Russow (1872) first description
More informationAP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?
The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationThe genetic material
Basics of molecular genetics The genetic material 1944: Avery, MacLeod & McCarty DNA is the genetic material 1953: Watson & Crick molecular model of DNA structure The genetic material 1977: Maxam & Gilbert
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationLaboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
More informationThis software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
More informationMolecular Biology (2)
Molecular Biology (2) DNA replication Mamoun Ahram, PhD Second semester, 2018-2019 Resources This lecture Cooper, pp. 191-207 2 Some basic information The entire DNA content of the cell is known as genome.
More informationBioinformatics - Lecture 1
Bioinformatics - Lecture 1 Louis Wehenkel Department of Electrical Engineering and Computer Science University of Liège Montefiore - Liège - September 19, 2007 Find slides: http://montefiore.ulg.ac.be/
More informationIntroduction to Medical Genetics: Human Chromosome
Introduction to Medical Genetics: Human Chromosome Ashley Soosay This OpenCourseWare@UNIMAS and its related course materials are licensed under a Creative Commons Attribution NonCommercial ShareAlike 4.0
More informationDifferences between prokaryotes & eukaryotes. Gene function
GENE REGULATION Differences between prokaryotes & eukaryotes Gene function Description of Prokaryotic Chromosome and E.coli Review Differences between Prokaryotic & Eukaryotic Chromosomes Four differences
More informationData Linkage Challenges in Retail Banking. Don t Build Walls Build Bridges
Data Linkage Challenges in Retail Banking Don t Build Walls Build Bridges Sean Charlton 1 Barclaycard CIO Strategy February 2016 Internal What happens if you hold multiple products? Consumer cards Barclaycard
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationGenomes and Their Evolution
18 CAMPBELL BIOLOGY IN FOCUS Genomes and Their Evolution URRY CAIN WASSERMAN MINORSKY REECE Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION Overview:
More informationNCBI & Other Genome Databases. BME 110/BIOL 181 CompBio Tools
NCBI & Other Genome Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2011 Admin Reading Dummies Ch 3 Assigned Review: "The impact of next-generation sequencing technology on genetics" by E.
More informationFluorescent in-situ Hybridization
Fluorescent in-situ Hybridization Presented for: Presented by: Date: 2 Definition In situ hybridization is the method of localizing/ detecting specific nucleotide sequences in morphologically preserved
More informationResearch techniques in genetics. Medical genetics, 2017.
Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR
More informationThe goal of this project was to prepare the DEUG contig which covers the
Prakash 1 Jaya Prakash Dr. Elgin, Dr. Shaffer Biology 434W 10 February 2017 Finishing of DEUG4927010 Abstract The goal of this project was to prepare the DEUG4927010 contig which covers the terminal 99,279
More informationGenes! (and wins Nobel Prize, 1933)
Today: Mendelian Genetics Wrap-up Adding Chromosomes to the Mix Lunch Inoculate Cultures The Eukaryotic Genome Morgan Discovers Sex-Linked Genes! (and wins Nobel Prize, 1933)? Sex Determination Happens
More informationGenetic code Codon: triple base pairs defining each amino acid.
Genetic code Codon: triple base pairs defining each amino acid. Why genetic code is triple? double code represents 4 2 = 16 different information triple code: 4 3 = 64 (two much to represent 20 amino acids)
More informationCourse Overview. Objectives
Current Topics in Course Overview Objectives Introduce the frontiers in genomics and epigenomic research, including the new concepts in the related fields and the new computational and experimental techniques.
More informationSecurity Application Convergence at the Point of Card Issuance. Kevin Gillick Head of Corporate Marketing Datacard Group
Security Application Convergence at the Point of Card Issuance Kevin Gillick Head of Corporate Marketing Datacard Group The Elements of an ID system Public Key Infrastructure Smart Card Smart Card Biometry
More informationMOLECULAR TYPING TECHNIQUES
MOLECULAR TYPING TECHNIQUES RATIONALE Used for: Identify the origin of a nosocomial infection Identify transmission of disease between individuals Recognise emergence of a hypervirulent strain Recognise
More informationDNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
More informationResearch Finishing a whole-genome shotgun: Release 3 of the Drosophila melanogaster euchromatic genome sequence
http://genomebiology.com/2002/3/12/research/0079.1 Research Finishing a whole-genome shotgun: Release 3 of the Drosophila melanogaster euchromatic genome sequence Susan E Celniker*, David A Wheeler, Brent
More informationNUCLEUS. Fig. 2. Various stages in the condensation of chromatin
NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules
More informationOctober 20 th,
Introduction to Private Identity as a Service (PIDaaS): Secure authentication system, based on biometric recognition technologies through mobile devices. October 20 th, 2015 contacts@pidaas.eu www.pidaas.eu
More informationPauling/Itano Experiment
Chapter 12 Pauling/Itano Experiment Linus Pauling and Harvey Itano knew that hemoglobin, a molecule in red blood cells, contained an electrical charge. They wanted to see if the hemoglobin in normal RBC
More informationRestriction Enzymes (endonucleases)
In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate
More informationThe Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression
The Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression What Are the Characteristics of the Eukaryotic Genome? Key differences between eukaryotic and prokaryotic
More informationIntroduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the
Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics
More informationChapter 6 Genomic Architecture. Molecular Structure of Genes and Chromosomes
Chapter 6 Genomic Architecture Molecular Structure of Genes and Chromosomes Overview: structure of genes and chromosomes Nucleosome: + histone H1 capping the entry and exit of the DNA strand into the nucleosome
More informationBS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt
BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt Introduction to molecular biology Combining genetics, biochemistry, structural chemistry Information flow in biological systems: The Central Dogma
More informationBiochemistry 401G Lecture 32 Andres
Biochemistry 401G Lecture 32 Andres Lecture Summary: Discuss RNA structure and how the chemical differences between DNA and RNA make DNA the better choice for the storage of genetic information. DNA chromatin
More informationModule 17: Genetic Engineering and Biotechnology, Student Learning Guide
Name: Period: Date: Module 17: Genetic Engineering and Biotechnology, Student Learning Guide Instructions: 1. Work in pairs (share a computer). 2. Make sure that you log in for the first quiz so that you
More informationSSRD: simple sequence repeats database of the human genome
Comparative and Functional Genomics Comp Funct Genom 2003; 4: 342 345. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.289 Short Communication SSRD: simple sequence
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationDe novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationPopulation Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
More informationJohn M. Butler and Peter M. Vallone National Institute of Standards and Technology
DNA Biometrics: i Standards and Technology John M. Butler and Peter M. Vallone National Institute of Standards and Technology NDIA Biometrics Conference (Arlington VA) NDIA Biometrics Conference (Arlington,
More informationDNA: The Genetic Material. Chapter 10
DNA: The Genetic Material Chapter 10 DNA as the Genetic Material DNA was first extracted from nuclei in 1870 named nuclein after their source. Chemical analysis determined that DNA was a weak acid rich
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationBruce Blumberg 2113E McGaugh Hall - office hours Wed 12-1 PM (or by appointment) phone
BioSci 145B Lecture #2 4/13/2004 Bruce Blumberg 2113E McGaugh Hall - office hours Wed 12-1 PM (or by appointment) phone 824-8573 blumberg@uci.edu TA Curtis Daly 2113 McGaugh Hall, 924-6873, 3116 lectures
More informationAmy M. Hauth. A dissertation submitted in partial fulfillment of. the requirements for the degree of. Doctor of Philosophy
IDENTIFICATION OF TANDEM REPEATS: SIMPLE AND COMPLEX PATTERN STRUCTURES IN DNA SEQUENCES by Amy M. Hauth A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of
More informationPopulation Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
More informationBENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture
BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism
More information