Parentage-based DNA traceback in beef and dairy cattle

Transcription

1 University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Publications from USDA-ARS / UNL Faculty U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska 2008 Parentage-based DNA traceback in beef and dairy cattle Mike Heaton USDA-ARS Follow this and additional works at: Part of the Agricultural Science Commons Heaton, Mike, "Parentage-based DNA traceback in beef and dairy cattle" (2008). Publications from USDA-ARS / UNL Faculty This Article is brought to you for free and open access by the U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Publications from USDA-ARS / UNL Faculty by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln.

2 Michael P. Heaton, PhD July 15, 2008 Parentage-based DNA traceback in beef and dairy cattle Washington BSE Mike Heaton, Ph.D. USDA, ARS, U.S. Meat Animal Research Center, Clay Center, Nebraska Updated Why is animal ID needed? From a production perspective: Track carcasses at slaughter for beef improvement programs Verify source and age for branded beef programs Identify superior sires in multi-sire mating systems Identify mis-mothering cases Verify artificial insemination records Solve rustling cases Verify claims of tissue-residue violations at slaughter 1

3 Why is animal ID needed? From an animal health perspective: to help protect American animal agriculture from foreign or domestic disease threats. APHIS Goal: to traceback within 48 hours of discovery. Desired outcome: reduced financial and social impact of disease outbreaks Examples: brucellosis and tuberculosis eradication programs foreign animal disease - BSE traceback Our goal: to support DNA-based disease traceback in cattle. Ways to physically label individual cattle Branding Tattooing Tags and passports 2

4 Ways to physically label individual cattle Radio frequency tags/implants Retinal scans (RFID) 213 Problems: Physical labels are moved or removed at some point during beef processing The fidelity of labeling may be disputed Disputes arise even when animal identification systems are in place Example: 2003 Washington State BSE case Alberta BSE Washington BSE Holstein downer cow processed at Moses Lake, WA on December 9th BSE 3

5 The dispute There's some confusion about the paperwork. Which of the 9 downer cattle slaughtered that day had the BSE-infected brain? DNA testing by the best experts available could compare samples from the mad cow and its offspring or parents. Dr. Brian Evans Chief Veterinary Officer Canadian Food Inspection Agency The resolution December 31, 2003 we are sending multiple samples to two laboratories -- one in Canada and one in the United States. USDAs Chief Veterinarian Dr. Ron DeHaven of APHIS the U.S. laboratory is in Nebraska,. [and] It's a USDA laboratory that has that expertise. January 6, 2004 "We now have DNA evidence that allows us to verify with a high degree of certainty, the [Canadian] birthplace of the BSEinfected cow. 4

6 DNA is the label never removed from beef A calf has about 10 trillion cells chromosome from sire chromosome from dam DNA from dam A alleles from each parent DNA from sire nucleus A A 30 chromosome pairs one pair of chromosomes A chromosome has genes and other DNA A chromosome may contain more than 1000 genes. Genes comprise about 1 to 3 % of the genome. physical map of a gene exon 1 exon 2 exon 3 exon 4 intron 1 Intron 2 intron 3 DNA RNA exons are transcribed and processed into messenger RNA messenger RNA is translated into proteins like enzymes, antibodies, hemoglobin, keratin protein 5

7 Genes are encoded by sequences of DNA exon 1 exon 2 exon 3 exon 4 intron 1 Intron 2 intron 3 nucleotides: A, C, G, T At what level does most of the genetic diversity occur in cattle? Most of the genetic diversity in cattle occurs at the nucleotide level DNA sequence of maternal chromosome: 5 -A-T-C-G-A-T-T-3 DNA sequence of paternal chromosome: 5 -A-T-C-T-A-T-T-3 SNP Single nucleotide polymorphisms (SNPs) occur, on average, once in every 100 nucleotides in a diverse group of 96 U.S. cattle Heaton et al., Mamm. Genome,

8 What are SNPs? SNPs are sites in the genome where two different nucleotides may be observed DNA trace file individual #1: maternal chromosome aatggtatcaattaatgctt paternal chromosome aatggtatctattaatgctt A/T 1 SNP per 1000 bp individual #2: maternal chromosome aatggtatcaattaatgctt paternal chromosome aatggtatcaattaatgctt A/A T/T 1 SNP per 100 bp individual #3: maternal chromosome aatggtatctattaatgctt paternal chromosome aatggtatctattaatgctt SNP density distribution per 1 kb genomic region (122 parentage markers tested, 216 beef and dairy cattle sequenced) SNP per 100 base pairs bp/snp Heaton et al., 2006, unpublished results 7

9 Properties of SNPs Abundant (approximately 30 million sites in cattle) Stable (low mutation reversal rate) Amenable to high-throughput automatic scoring Low cost per SNP genotype Many genotyping platforms available SNP scoring is comparable between labs & platforms Bottom line: SNP markers are the new gold standard for genetic analysis Ways to use DNA for traceback DNA fingerprinting (sample matching) comparing genotypes between samples resolves disputes if samples were collected at the point of origin before a disease outbreak occurred. a genetic bar code Advantages: - high degree of power - all genotypes useful Disadvantages: - requires a preexisting sample Example: 20 SNPs were sufficient for verifying sample tracking in dairy beef processing (Heaton et al. J Am Vet Med Assoc. 2005). 8

10 Ways to use DNA for traceback Parentage analysis determining whether alleles are shared between parents and offspring may confirm the origin of a diseased animal if tissues from a parent are available. Advantages: - preexisting sample of case not needed Disadvantages: - not all genotypes useful - requires more markers - requires more samples Sometimes parentage testing is the last resort for DNA-based traceback Worst case scenario: only one parent available 2003 Washington State BSE case dam sire BSE offspring - BSE case 9

11 Using SNP markers for parentage The offspring must share an allele with each parent dam bull calf A,A excluded sire G,G Using SNP markers for parentage The offspring must share an allele with each parent dam bull calf A,A possible sire A,G 10

12 Accurate sire determination requires many DNA markers (example: 9 markers on 9 chromosome pairs) When comparing only sires and offspring (i.e. dams not used).. the calfs homozygous DNA markers are the most useful the calfs heterozygous markers are ignored because every sire will share an allele with the calf for those markers useful ignore A C G C T G T A A A T G C C A T A C Calf 1 Comparing the calf to the sire: elimination Bull 1 G * * * * * * * * G * * * * * * * * 1 (eliminated) A C G C T G T A A A T G C C A T A C Bull 2 G T G T * * * * * A T G T * * * * * (eliminated) Bull 3 G T G C C A C * * A T G T C A C * * (eliminated) Bull 4 G T G C C A C A C A T G T C A T A C (not eliminated) 11

13 Comparing the calf to a possible sire Calf 1 Calf 1 Bull 4 Bull 4 A C G C T G T A A A T G C C A T A C G T G C C A C A C A T G T C A T A C Alleles shared between animals at the homozygous sites of the calf (note: the calfs heterozygous sites [grey text] are ignored because every bull shares an allele with the this calf at those sites) The ideal parentage SNP markers have both alleles in equal proportions in all breeds balanced alleles provide more power are evenly spaced throughout the genome more independent inheritance provides more power can be accurately scored one wrong genotype can confound a traceback dispute are publicly available encourages standardization and fair competition 12

14 The ideal marker is frequent in all breeds A collaborative effort was undertaken to assemble many beef and dairy breeds for testing (screening) allele frequency 96 diverse sires from 19 beef breeds (Drs. Heaton and Laegreid; ARS, MARC) 464 cross-bred Canadian beef cattle containing germplasm primarily from Angus, Charolais, Hereford, Simmental, Galloway, and other breeds (Dr. Moore, University of Alberta) 120 prominent sires from 4 dairy breeds (Drs. Van Tassell and Sonstegard; ARS, BARC) More than 4000 candidate SNPs, mostly from the Bovine Genome Project, were genotyped to select those with best minor allele frequencies (Drs. Heaton, McKay, Moore, and Murdock; MARC and U. Alberta) The ideal markers are evenly distributed across the genome We used the MARC composite map to select regions for markers Developed by Dr. Warren Snelling at MARC, this map contains positions of thousands of DNA markers. We chose SNP candidates in chromosomal regions that were approximately 20 to 50 cm apart X and Y chromosomes not used 13

15 Distribution of minor allele frequencies for 121 parentage SNPs in US and Canadian cattle USMARC Beef Diversity Panel V2.9 BARC Dairy Panel V1.0 U. Alberta Cross-Bred Beef Minor allele frequency Collaborators: Drs. Bennett and Keele, MARC Dr. Moore, U. Alberta. The ideal parentage marker scores accurately One wrong genotype may exclude the true parent. In disease traceback this causes delays, confusion, and loss of credibility. 14

16 Accurate scoring requires that SNPs: are in unique genomic regions (non-repetitive) are in regions with well characterized flanking SNPs have no major insertion/deletions nearby The nucleotide diversity in a typical region of the bovine genome 1 SNP occurs every 100 bp when comparing the 96 diverse beef sires from 19 breeds 80 bp repeat unit SNP to be genotyped (target SNP) SNP nearby (flanking SNP) Insertion/deletion polymorphism (In/Del) Repeat unit Good Bad 15

17 The consequence of 1 SNP every 80 bp Wrong genotype assigned to some animals Because some oligonucleotide primers do not bind correctly oligonucleotide primers in genotyping assay bad primer good primer SNP to be genotyped (target SNP) C or T Flanking SNPs Flanking SNP good primer bad primer C T Aim: accurate amplification of both maternal and paternal alleles Bottom line: hidden SNPs may cause the wrong genotypes to be scored Increases costs Decreases throughput Frustrates customers and genotyping companies Decreases platform flexibility Decreases competition in the genotyping markets Solution: determine the flanking DNA sequence of parentage SNPs in populations to be genotyped 16

18 DNA sequencing strategy: nested PCR Reference Sequences Bovine Genome Project Repetitive DNA elements mapping Drs. Wiedmann and Harhay, MARC C/T MARC ABI 3730 sequencing facility Drs. Smith MARC tracefile database and NCBI submission Mr. Way and Dr. Freking Exon overlapping tracefile reads 1 kb 0.7 kb Produce six or seven tracefile reads over each parentage SNP Parentage SNP population sequencing results 121 different regions with parentage SNPs analyzed USDA Bovine SNP Set for Parentage-Based Traceback (UPT_BTA_ V1) 42 breeds with 24 diverse animals from each breed (1008 total cattle) Angus Ankole-Watusi Ayrshire Beefmaster Belgian Blue Blonde D'Aquitaine Brahman Brahmousin Brangus Braunvieh Brown Swiss Charolais Chianina Corriente Gelbvieh Guernsey Hereford Highland Holstein Jersey Limousin Maine-Anjou Marchigiana Mini-Hereford Mini-Zebu Montbeliard Murray Grey Nelore Piedmontese Pinzgauer Red Angus Red Poll Romagnola Salers Santa Gertrudis Senepol Shorthorn Simmental Tarentaise Texas Longhorn Tuli Wagyu Collaborators: Dr. Neibergs, WSU Dr. Chase, ARS, STARS Dr. Bob Bohlender Mr. Goode, Goode Cattle Recent additions: Indu-Brazil Dexter 17

19 Physical map of one region with a parentage SNP BTA 27, 45 cm, GenBank no. EF bp Parentage SNP Flanking SNP Bovine repetitive elements STS (amplicon) For 121 parentage SNPs (first 216 of 1008 cattle) average minor allele frequency beef average minor allele frequency dairy 1646 adjacent SNPs 259 overlapping amplicons sequenced 137k tracefiles deposited at GenBank 89 Mb of sequence 2004 bovine repetitive elements 258 exons 183 CDSs Average of 9.8 kb annotated per file (1.2 Mb total) Collaborators in depositing GenBank annotation Dr. Anjanette Johnston GenBank Submissions Staff Dr. Ilene Karsch Mizrachi GenBank Coordinator Immediate public access requested During marker development a number of companies wanted immediate access to the results. Some companies needed to design tests as fast as we could generate the marker information How to provide fair public access? GenBank provides access but not easily 18

20 Public access to detailed SNP information Collaborator: Dr. Ted Kalbfleisch, U. of Louisville We first started with a static page for downloading key summary information UPT_BTA_ V1 Next, a set of interactive pages were developed that access relational data base information. Public internet access to flanking SNPs and allele frequencies by breed target SNP breed and allele frequencies allele count 39:0:15:0 flanking SNPs target SNP flanking SNP frequencies 19

21 Individual animal genotypes linked to tracefiles Where are we now? Many of the 121 USDA Parentage-Based Traceback SNPs are on the USDA-Illumina Bov50k SNP chip have been adapted by companies into their parentage tests have been used in additional peer-review research publications Database development and uploading of detailed SNP information is ongoing at U. of Louisville and MARC The 121 USDA Parentage SNPs are continually being sequenced and tested in new breeds to evaluate their utility in the event that an emergency DNA-based traceback is needed. The results are being made available as they are produced This set of SNPs currently represents the best group of wellcharacterized parentage SNPs available. Mike Heaton, Ph.D. USDA, ARS, U.S. Meat Animal Research Center, Clay Center, Nebraska Updated