Sequencing a North American yak genome
|
|
- Chloe Todd
- 5 years ago
- Views:
Transcription
1 Sequencing a North American yak genome Presentation for the annual meeting of the International Yak association Denver Colorado, January 24, 2014 Mike Heaton, Ph.D. USDA Meat Animal Research Center (USMARC), Clay Center, Nebraska An equal opportunity provider and employer Topics Introduction to USMARC, aims, and role Answering cattle questions with Yak DNA Publication of the Chinese yak genome sequence Opportunities to improve herds with DNA testing 1
2 USDA Meat Animal Research Center 35,000 acres 250 employees 54 scientists 6300 cows 5000 calves 720 litters 4000 ewes 7000 lambs USDA Meat Animal Research Center Federal appropriation: Sale of animals: $18.1 M $6.5 M 2013 operating budget: $24.6 M We host about 1700 visitors from 40 states and 28 countries per year Federally approved 6000-head capacity feedlot 2
3 M. Heaton USMARC Aim To deliver timely research for solving problems facing our stakeholders Michael P. Heaton, PhD Interest: reducing the impact of infectious disease Bacteria cell wall assembly: targets for antibiotics University of Nebraska-Lincoln, NE Northwestern University, Evanston, IL Super bugs antibiotic resistance Rockefeller University, New York, NY mating and gene transfer Donor (Vancomycin resistant) Recipient (Vancomycin susceptible) 3
4 Michael P. Heaton, PhD USMARC Animal Health Research (since 1996) Identify genetic resistance to infectious disease Bovine respiratory disease complex Ovine progressive pneumonia in sheep Genetics of prion disease Failure of passive transfer in neonatal calves Develop efficient DNA marker systems for cattle and sheep: disease traceback and animal identification parentage testing disease testing in sheep What is the goal? To read an animal s DNA sequence and predict its risk for disease. Outcome: DNA tests to improve herds 4
5 Who benefits from the research? DNA testing companies Agencies that use or perform DNA testing services Livestock breed associations and producers Researchers USDA firewall Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. What is DNA and how can we use it? A calf has about 10 trillion cells A allele from one parent, T allele from other from sire A T Phoebe, Grunniens Ranch nucleus from dam 30 chromosome pairs Bovine pulmonary endothelial cell-invitrogen 5
6 Two important concepts for understanding the genome Genes have DNA sequences encoding proteins. Proteins do the work in cells and regulate the body s tissues and organs. For more information, click to play short videos: Genes are encoded by sequences of DNA exon 1 exon 2 exon 3 exon 4 intron 1 Intron 2 intron 3 nucleotides: A, C, G, T Most of the genetic diversity in livestock occurs at this level 6
7 What are SNPs? Single Nucleotide Polymorphisms Sites in the genome where two different nucleotides occur DNA trace file individual #1: maternal chromosome paternal chromosome aatggtataaattaatgctt aatggtatatattaatgctt A/T individual #2: maternal chromosome paternal chromosome individual #3: maternal chromosome paternal chromosome aatggtataaattaatgctt aatggtataaattaatgctt aatggtatatattaatgctt aatggtatatattaatgctt A/A T/T DNA markers in cattle for parentage aatggtatcatattaatgctt aatggtatcatattaatgctt aatggtatcaaattaatgctt aatggtatcaaattaatgctt T/T A/A The calf must share an allele with each parent A/T aatggtatcaaattaatgctt aatggtatcaattaatgctt aatggtatctattaatgctt With 50 informative SNPs, the probability that a randomly chosen sire will be excluded from paternity >99% 7
8 Why not use microsatellite markers instead? (also known as variable number tandem repeats: VNTRs) A good microsatellite marker is five times more powerful than a good SNP allele. Tradition (legacy data), genotyping infrastructure However, SNP platforms now routinely use 50 to 700,000 markers SNPs ,000 8,000 50, ,000 Whole genome Use Traits/Traceback Parentage/Inbreeding Genomic Selection Genomic Selection Gene Mapping Gene Mapping Causative Mutations Genomic advances in yak research 8
9 History of USMARC with IYAK research , Sep: The late Jerry McRoberts visited USMARC in 2006 to discuss yaks. 2007, Mar: IYAK board contacted for help in getting yak tissues for DNA. 2007, May: Received 2 yak steer livers from Mike Swartz. 2008, Jan: Planned for collecting 24 yaks across N. American population. 2008, Apr: Received 2 yak livers from Jim Watson. 2008, Dec: Received hair follicles from 11 yak from Jim Watson. 2009, Jan: 15 IYAK samples run on bovine 50k SNP chip by collaborator. 2009, Apr: Received 2 yak livers from Jim Watson (cattle genome published) 2009, Jul: Received 9 blood samples from Jim Watson Bulls 2009, Oct: IYAK DNA used in National Academy of Sciences paper (PNAS) 2010, Jan: Queen Allante passes away, tissue saved, sent to USMARC 2011, Jan: Received about 10 blood samples from Lawrence Richards 2012, Jan: IYAK DNA used in PLOS Genetics paper (sheep research) 2012, Jul: Chinese yak genome sequence published 2013, Dec: USMARC extracts good quality DNA from Queen Allante 2013, Dec: USMARC-Intrepid map Chinese yak genome to cattle genome--makes public 2014, Jan: Present results at annual IYAK meeting in Denver Research articles published with IYAK DNA 9
10 Research articles published with IYAK DNA Why am I here today? Minke whale There is an opportunity to sequence the genome of a North American yak 10
11 Genome Sequencing costs cattle pig sheep yak anything Today: any animal sequenced (10X) for <$3000 What can you do with 10x whole genome sequence of a N. American yak? Design custom N. American yak-specific DNA tests for: Parentage determination and pedigree analysis Estimating percent Bos taurus DNA in an animal Manage inbreeding (conservation genetics) Traceback (forensics) Animal identification Genotype yak for newly discovered genes Map royal, trim solid coat color Disease resistance Wool Monogenic traits Learn how to use genomics to advance the IYAK mission 11
12 How does it work? Map 350M Chinese yak reads to cattle reference genome A G G L1 Dominette C C G,A nucleotide difference compared to cattle Yak SNP Chinese yak Huangyuan County of Qinghai Province Dr. Ted Kalbfleisch Yak reads mapped to cattle red-black gene (MC1R) 12
13 Yak sequence differences in MC1R gene Yak-specific SNPs in the MC1R gene C/G yak SNP C = yak T = cattle nucleotide difference compared to cattle 13
14 Mapping a N. American yak genome Map 350M Chinese yak reads to cattle reference genome A G G C Map 350M Queen Allante reads to cattle reference genome L1 Dominette Chinese yak Huangyuan County of Qinghai Province C C G,A G,T IYAK SNP Queen Allante D171 How to turn IYAK DNA into IYAK tests IYAK DNA Contract sequencing outfit Bioinformatics, storage and web access outfit Identify > 100,000 SNPs Validation and use SNP tests in sets of 50 markers each ~300 SNPs For each test design Commercial genotyping outfit Genetic test design 14
15 What can you do with 10x whole genome sequence of a N. American yak? Design custom N. American yak-specific DNA tests for: Parentage determination and pedigree analysis Estimating percent Bos taurus DNA in an animal Manage inbreeding (conservation genetics) Traceback (forensics) Animal identification Genotype yak for new genes discovered in cattle or sheep: Map royal, trim solid coat color Disease resistance Wool Monogenic traits 15
Appendix-B Registry Progression - RECAP
Slide 1 GENOMIC RESEARCH PRESENTATION AT INTERNATIONAL YAK ASSOCIATION 2018 DENVER MEMBERSHIP MEETING By Lawrence G. Richards Chair IYAK Genome Committee SPEAKER NOTES TEXT - In blue The This is a 3 section
More informationWhat do I need to know about Genomically Enhanced EPD Values? Lisa A. Kriese Anderson Extension Animal Scientist Auburn University.
What do I need to know about Genomically Enhanced EPD Values? Lisa A. Kriese Anderson Extension Animal Scientist Auburn University Take Home Message Genomically enhanced EPD values are used exactly like
More informationDeveloping Accurate Parentage Markers for Cattle: From BSE Traceback to 50k SNP Chips. Gary Bennett
Developing Accurate Parentage Markers for Cattle: From BSE Traceback to 50k SNP Chips Gary Bennett USDA, ARS, US Meat Animal Research Center Clay Center, Nebraska What are SNPs? SNPs are sites in the genome
More informationTraditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.
1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection
More information2/22/2012. Impact of Genomics on Dairy Cattle Breeding. Basics of the DNA molecule. Genomic data revolutionize dairy cattle breeding
Impact of Genomics on Dairy Cattle Breeding Bennet Cassell Virginia Tech 2012 VSFA/VA Tech Nutrition Cow College Genomic data revolutionize dairy cattle breeding Accuracy of selection prior to progeny
More informationThe what, why and how of Genomics for the beef cattle breeder
The what, why and how of Genomics for the beef cattle breeder Este van Marle-Köster (Pr. Anim. Sci) 25 January 2019 Waguy info day 2 Today s talk Focus on what is genomics Brief definition & references
More informationGenomic selection in cattle industry: achievements and impact
Genomic selection in cattle industry: achievements and impact Dr. Fritz Schmitz-Hsu Senior Geneticist Swissgenetics CH-3052 Zollikofen Scientific Seminar WBFSH 2016 1 Source: https://i.ytimg.com/vi/cuvjxlhu79a/hqdefault.jpg
More informationParentage-based DNA traceback in beef and dairy cattle
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Publications from USDA-ARS / UNL Faculty U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska
More informationSection 4 - Guidelines for DNA Technology. Version October, 2017
Section 4 - Guidelines for DNA Technology Section 4 DNA Technology Table of Contents Overview 1 Molecular genetics... 4 1.1 Introduction... 4 1.2 Current and potential uses of DNA technologies... 4 1.2.1
More informationWelcome to Igenity Brangus and the Power of Confident Selection
Now available exclusively through the International Brangus Breeders Association: Welcome to Igenity Brangus and the Power of Confident Selection - - - - - - - - - - - - - - - - - - - - - - - - - - - -
More informationIntroduction to Animal Breeding & Genomics
Introduction to Animal Breeding & Genomics Sinead McParland Teagasc, Moorepark, Ireland Sinead.McParland@teagasc.ie Overview Changes to traditional animal breeding Using DNA in animal breeding What is
More informationGenomic selection in the Australian sheep industry
Genomic selection in the Australian sheep industry Andrew A Swan Animal Genetics and Breeding Unit (AGBU), University of New England, Armidale, NSW, 2351, AGBU is a joint venture between NSW Department
More informationIntegrating DNA Information into Beef Cattle Production Systems
Integrating DNA Information into Beef Cattle Production Systems Project Director: Dr. Alison Van Eenennaam, University of California, Davis, CA Collaborators: Dr. Darrh Bullock, Extension Professor, University
More informationTHE STUDY OF GENETICS is extremely
Exploring Animal Genetics and Probability THE STUDY OF GENETICS is extremely valuable to several areas of science. From medical to agricultural applications, the development of new techniques in studying
More informationGenomic selection for sheep and beef systems, dispelling the myths for farmers. Dewi Jones January 2016
Genomic selection for sheep and beef systems, dispelling the myths for farmers Dewi Jones January 2016 First things first Selective culling Selective culling First things first Selective culling Performance
More informationHow might DNA-based information generate value in the beef cattle sector?
How might DNA-based information generate value in the beef cattle sector? Animal Biotechnology & Genomics Cooperative Extension Specialist Department of Animal Science University of California, Davis Davis,
More informationBull Selection Strategies Using Genomic Estimated Breeding Values
R R Bull Selection Strategies Using Genomic Estimated Breeding Values Larry Schaeffer CGIL, University of Guelph ICAR-Interbull Meeting Niagara Falls, NY June 8, 2008 Understanding Cancer and Related Topics
More informationGenetic Evaluations. Stephen Scott Canadian Hereford Association
Genetic Evaluations Stephen Scott Canadian Hereford Association Canadian Hereford Association Herefords were first imported into Canada in 1860 The CHA was incorporated in 1902 under the Government of
More informationApplications of Genomic Technology to Cattle Breeding and Management
Applications of Genomic Technology to Cattle Breeding and Management The Role of DNA CSI (cattle science investigations) Introducing Scidera, Inc. Recognized Leader in Livestock Genomics On March 18, 2011,
More informationAlison Van Eenennaam, Ph.D.
"Integrating DNA Information into Beef Cattle Production Systems" Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics Department of Animal Science University
More information2/12/13% 20 investigators 10 institutions
Iowa%State%University% Dr.DorianGarrick Dr.StephanieHansen Dr.DanLoy Dr.MeganVanEmon % Texas%A&M%University% Dr.ChrisSeabury % University%of%Illinois% Dr.JonBeever Dr.DanShike University%of%Minnesota%
More informationA brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
More informationStrategy for Applying Genome-Wide Selection in Dairy Cattle
Strategy for Applying Genome-Wide Selection in Dairy Cattle L. R. Schaeffer Centre for Genetic Improvement of Livestock Department of Animal & Poultry Science University of Guelph, Guelph, ON, Canada N1G
More information29 th Annual BIC Bull Sale
One Bar Eleven Ranch John E. Rouse Beef Improvement Center 29 th Annual BIC Bull Sale Monday April 13 th, 12:30 p.m. Selling Approximately 50 Yearling Bulls One Bar Eleven Ranch John E. Rouse Beef Improvement
More informationGenotyping Dairy Cattle Samples with Infinium BovSNP50 BeadChips and VeraCode Universal Oligo Beads
Genotyping Dairy Cattle Samples with Infinium BovSNP50 BeadChips and VeraCode Universal Oligo Beads Dr. Michael Cowan General Manager Genetic Visions, Inc. Traditional Pedigree Selection Sire of Sire Sire
More informationAlison Van Eenennaam, Ph.D. Cooperative Extension Specialist
Beef Cattle Industry Structure: Implications for whole genome selection Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics Department of Animal Science University
More informationGENOMICS AND YOUR DAIRY HERD
GENOMICS AND YOUR DAIRY HERD Genomics uses DNA information to predict the genetic merit of bulls and cows. Available in Australia since 2011, genomic information is routinely used to calculate genomic
More informationGenomic management of animal genetic diversity
Genomic management of animal genetic diversity 15.00 hrs Welcome by Roel Veerkamp 15.05 hrs Kor Oldenbroek: Introduction & challenges 15.20 hrs Jesús Fernández: Genomic tools to define genetic diversity
More informationDomestic animal genomes meet animal breeding translational biology in the ag-biotech sector. Jerry Taylor University of Missouri-Columbia
Domestic animal genomes meet animal breeding translational biology in the ag-biotech sector Jerry Taylor University of Missouri-Columbia Worldwide distribution and use of cattle A brief history of cattle
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationHaplotypes, recessives and genetic codes explained
Haplotypes, recessives and genetic codes explained This document is designed to help explain the current genetic codes which are found after the names of registered Holstein animals on pedigrees, web factsheets
More informationAlison Van Eenennaam, Ph.D.
WHAT ARE HERD BULLS ACCOMPLISHING IN MULTIPLE SIRE BREEDING PASTURES?" Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics Department of Animal Science University
More informationJoão Dürr Interbull Centre Director. Animal identification and traceability Interbull s s and Interbeef s perspectives
João Dürr Interbull Centre Director Animal identification and traceability Interbull s s and Interbeef s perspectives Summary Interbull & Interbeef Genetic improvement essentials Globalization of cattle
More information13-1 Changing the Living World
13-1 Changing the Living World In the past, variation was limited to the variations already in nature or random variations that resulted from mutations. Now, scientists can change DNA and swap genes from
More information11/30/2018. Introduction to Genomic Selection OUTLINE. 1. What is different between pedigree based and genomic selection? 2.
Introduction to Genomic Selection imagefriend.com OUTLINE 1. What is different between pedigree based and genomic selection? 2. Selection tools - Selection Indexes - Genotyping resources 3. DNA-based markers
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationValidating Genetic Markers
Validating Genetic Markers Dick Quaas, Cornell University Mark Thallman, USMARC Alison Van Eenennaam, UC Davis Cooperative Extension Specialist Animal Biotechnology and Genomics alvaneenennaam@ucdavis.edu
More informationLecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types
Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting
More informationGenetics and Health: Genetic Approaches to Reduce Bovine Respiratory Disease in Beef Cattle ORGANIZATION
Genetics and Health: Genetic Approaches to Reduce Bovine Respiratory Disease in Beef Cattle http://www.brdcomplex.org/ Holly Neibergs neibergs@wsu.edu Washington State University ORGANIZATION James Womack
More informationAlison Van Eenennaam, Ph.D.
Update: Integrating DNA Information into Beef Cattle Production Systems" Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics Department of Animal Science University
More informationBreeding your cows for genetic gain. Max Tweedie, B+LNZ Genetics
Breeding your cows for genetic gain Max Tweedie, B+LNZ Genetics Genetic improvement Genetic improvement should be the key objective for a stud breeder. Occurs when the sire team you select are of higher
More informationThe powerful new genomic selection tool. Built By Angus Genetics Inc.
The powerful new genomic selection tool Built By Angus Genetics Inc. For Angus. by angus. Angus GS sets the standard for genetic testing in Angus cattle. More power More accuracy More value As a new genomic
More informationDNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the
DNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the exact same DNA. DNA patterns from four sets of twins which are identical? DNA fingerprinting
More informationFundamentals of Genomic Selection
Fundamentals of Genomic Selection Jack Dekkers Animal Breeding & Genetics Department of Animal Science Iowa State University Past and Current Selection Strategies selection Black box of Genes Quantitative
More information11/30/11. Lb output/beef cow. Corn Yields. Corn and Wheat
Dr. Jack Whittier Extension Beef Specialist, Colorado State University XXII Range Beef Cow Symposium, Mitchell, Nebraska November 29, 30 and December 1, 2011 Genomics the basics What it means Is it something
More informationProfiting from Information Management and Genomics
Profiting from Information Management and Genomics AARD Workshop Lethbridge 13 th Fed 2015 John J. Crowley Research Associate, University of Alberta Director of Science, Canadian Beef Breeds Council Livestock
More informationAnnex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D PL 13372 01 00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 22.05.2014 to 25.03.2017
More informationAn Introduction to SNP Testing. Michelle Miller, MSc, MBA Director of Operations Canadian Livestock Records Corp. AGM April 16,
An Introduction to SNP Testing Michelle Miller, MSc, MBA Director of Operations Canadian Livestock Records Corp. AGM April 16, 2016 1 Agenda Delta Genomics Microsatellites vs SNPs Transition Process, Challenges
More informationDanika Bannasch DVM PhD. School of Veterinary Medicine University of California Davis
Genetics 101 Danika Bannasch DVM PhD Maxine Adler Endowed Chair in Genetics School of Veterinary Medicine University of California Davis Outline Basic genetics: The Rules Not so basic genetics: The exceptions
More informationCattle on Feed. United States Cattle on Feed Up 4 Percent
Cattle on Feed ISSN: 948- Released July, 07, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on Feed Up
More informationThe promise of genomics for animal improvement. Daniela Lourenco
The promise of genomics for animal improvement Daniela Lourenco Athens, GA - 05/21/2018 Traditional evaluation Pedigree Phenotype EPD BLUP EBV sum of gene effects What if we could know the genes/dna variants
More informationCattle on Feed. United States Cattle on Feed Up 3 Percent
Cattle on Feed ISSN: 948-98 Released July,, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on Feed Up
More informationFertility Factors Fertility Research: Genetic Factors that Affect Fertility By Heather Smith-Thomas
Fertility Factors Fertility Research: Genetic Factors that Affect Fertility By Heather Smith-Thomas With genomic sequencing technology, it is now possible to find genetic markers for various traits (good
More information, 2018 (1) AGIL
What is cooking at AGIL? Dr Paul VanRaden and chef Dan Null USDA Animal Genomics and Improvement Lab, Beltsville, MD 20705 Email: paul.vanraden@ars.usda.gov Web site: https://aipl.arsusda.gov/ Council
More informationProceedings, The Range Beef Cow Symposium XXI December 1, 2 and 3, 2009, Casper, WY USING INFORMATION TO MAKE INFORMED SELECTION DECISIONS
Proceedings, The Range Beef Cow Symposium XXI December 1, 2 and 3, 2009, Casper, WY Formatted: Right: 1.25" USING INFORMATION TO MAKE INFORMED SELECTION DECISIONS Matt Spangler Department of Animal Science
More informationCattle on Feed. United States Cattle on Feed Up 5 Percent
Cattle on Feed ISSN: 948-98 Released April,, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on Feed Up
More informationlatestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe
Overviewof Illumina s latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe Seminar der Studienrichtung Tierwissenschaften, TÜM, July 1, 2009 Overviewof Illumina
More informationGenomic-Polygenic and Polygenic Evaluation of Multibreed Angus-Brahman Cattle for Direct and Maternal Growth Traits Under Subtropical Conditions
Genomic-Polygenic and Polygenic Evaluation of Multibreed Angus-Brahman Cattle for Direct and Maternal Growth Traits Under Subtropical Conditions M. A. Elzo 1, M. G. Thomas 2, D. D. Johnson 1, C. A. Martinez
More informationCattle on Feed. United States Cattle on Feed Up 5 Percent
Cattle on Feed ISSN: 948-8 Released October,, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on Feed Up
More informationCattle on Feed. United States Cattle on Feed Up 1 Percent
Cattle on Feed ISSN: 948-9080 Released May 22, 205, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on
More informationDecoding genomic selection and the benefit for unconventional traits
Decoding genomic selection and the benefit for unconventional traits Pete Hansen Dept. of Animal Sciences University of Florida Change in Breeding Value for Milk Yield in Holsteins 1957-2013 Breeding Value
More informationEnhancing End Product
Managing Genetic Defects and Enhancing End Product Scott P. Greiner, Ph.D. Extension Animal Scientist Virginia Tech sgreiner@vt.edu 540.231.9159 2009 Tri-State t Cow/Calf Conference Arthrogryposis Multiplex
More informationGeneSeek, Inc. a Neogen Company, was founded in Neogen Corporate Profile
GeneSeek, Inc. a Neogen Company, was founded in 1998 and has developed into a comprehensive agricultural biotechnology service provider. Gene Seek s corporate headquarters are in a large custom-built laboratory
More informationGenetics Effective Use of New and Existing Methods
Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for
More informationApplication of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.
Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s
More informationA journey: opportunities & challenges of melding genomics into U.S. sheep breeding programs
A journey: opportunities & challenges of melding genomics into U.S. sheep breeding programs Presenter: Dr. Ron Lewis, Department of Animal Science, University of Nebraska-Lincoln Host/Moderator: Dr. Jay
More informationDNA. Using DNA to solve crimes
DNA Using DNA to solve crimes Physical characteristics are inherited from both parents DNA contains all the inherited information for each person DNA is contained in the nucleus of every cell in your body
More informationOBJECTIVES-ACTIVITIES 2-4
OBJECTIVES-ACTIVITIES 2-4 Germplasm Phenotyping Genomics PBA BIMS MAB Pipeline Implementation GOALS, ACTIVITIES, & DELIVERABLES Cameron Peace, project co-director & MAB Pipeline Team leader Outline of
More informationCurrent Reality of the Ayrshire Breed and the Opportunity of Technology for Future Growth
Current Reality of the Ayrshire Breed and the Opportunity of Technology for Future Growth First Current Reality August 2016 US CDCB-AGIL Genetic Breed Difference From Holstein Breed Milk Fat Protein Productive
More informationAllele: Chromosome DNA fingerprint: Electrophoresis: Gene:
Essential Vocabulary Allele: an alternate form of a gene; for example, a gene for human hair color may have alleles that cause red or brown hair Chromosome: a cell structure that contains genetic information
More informationQuestion. In the last 100 years. What is Feed Efficiency? Genetics of Feed Efficiency and Applications for the Dairy Industry
Question Genetics of Feed Efficiency and Applications for the Dairy Industry Can we increase milk yield while decreasing feed cost? If so, how can we accomplish this? Stephanie McKay University of Vermont
More informationCattle on Feed. United States Cattle on Feed Up 5 Percent
Cattle on Feed ISSN: 98-98 Released January,, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on Feed Up
More informationCattle on Feed. United States Cattle on Feed Up 4 Percent
Cattle on Feed ISSN: 948- Released July 0, 08, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on Feed
More informationDNA Technologies and Production Markers
DNA Technologies and Production Markers Alison Van Eenennaam, PhD Cooperative Extension Specialist Animal Biotechnology and Genomics University of California, Davis, USA Email: alvaneenennaam@ucdavis.edu
More informationGenetics of Beef Cattle: Moving to the genomics era Matt Spangler, Assistant Professor, Animal Science, University of Nebraska-Lincoln
Genetics of Beef Cattle: Moving to the genomics era Matt Spangler, Assistant Professor, Animal Science, University of Nebraska-Lincoln Several companies offer DNA marker tests for a wide range of traits
More informationBLUP and Genomic Selection
BLUP and Genomic Selection Alison Van Eenennaam Cooperative Extension Specialist Animal Biotechnology and Genomics University of California, Davis, USA alvaneenennaam@ucdavis.edu http://animalscience.ucdavis.edu/animalbiotech/
More informationBENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture
BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism
More informationGenetics of dairy production
Genetics of dairy production E-learning course from ESA Charlotte DEZETTER ZBO101R11550 Table of contents I - Genetics of dairy production 3 1. Learning objectives... 3 2. Review of Mendelian genetics...
More informationTexas Adapted Genetic Strategies for Beef Cattle XI:
Texas Adapted Genetic Strategies for Beef Cattle XI: Marker Assisted Selection for Beef Improvement Joe C. Paschal Livestock Specialist Texas Cooperative Extension, Corpus Christi, Texas j-paschal@tamu.edu
More informationChapter 20 Biotechnology and Animal Breeding
Source: NILGS (Japan) I. Reproductive Technologies II. Molecular Technologies Learning Objective: To learn about recent biotechnologies that are currently available and are likely to affect animal breeding.
More informationDNA Pooling Rationale. GWAS pooling study. DNA pooling. Cost. Larry Kuehn, U.S. Meat Animal Research Center. June 10, 2015
Genomic Discover of Bovine Respiratory Disease Traits Using Commercial Data and DNA Pooling U.S. Meat Animal Research The USDA is an equal opportunity employer. DNA Pooling Rationale Running the Bovine
More informationECONOMICS OF USING DNA MARKERS FOR SORTING FEEDLOT CATTLE Alison Van Eenennaam, Ph.D.
ECONOMICS OF USING DNA MARKERS FOR SORTING FEEDLOT CATTLE Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics University of California, Davis alvaneenennaam@ucdavis.edu
More informationProblem Set 2
ame: 2006 7.012 Problem Set 2 Due before 5 PM on FRIDAY, September 29, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YUR ASWERS THIS PRITUT. 1. You are doing a genetics experiment with
More informationGenetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
More informationProceedings, The Range Beef Cow Symposium XXIV November 17, 18 and 19, 2015, Loveland, Colorado HOW TO USE COMMERCIALLY AVAILABLE GENOMIC PREDICTIONS
Proceedings, The Range Beef Cow Symposium XXIV November 17, 18 and 19, 2015, Loveland, Colorado HOW TO USE COMMERCIALLY AVAILABLE GENOMIC PREDICTIONS M.G. Gonda Department of Animal Science South Dakota
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationSNP production markers and how genomic technologies will influence breeding decisions. Elisa Marques, PhD GeneSeek, a Neogen Company
SNP production markers and how genomic technologies will influence breeding decisions Elisa Marques, PhD GeneSeek, a Neogen Company About GeneSeek Started in 1998 with one student intern Vision: Affordable,
More informationCattle on Feed. Special Note
Cattle on Feed ISSN: 948-8 Released September, 8, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). Special Note The December
More informationFREQUENTLY ASKED QUESTIONS
FREQUENTLY ASKED QUESTIONS GENEMAX ADVANTAGE : THE SOLUTION FOR COMMERCIAL ANGUS HEIFER SELECTION August 2016 GENEMAX ADVANTAGE Q. What is GeneMax Advantage? A. GeneMax Advantage is a DNA test for prospective
More informationCattle on Feed. United States Cattle on Feed Up 2 Percent
Cattle on Feed ISSN: 948-90 Released October 23, 20, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on
More informationUnderstanding genomic selection in poultry breeding
doi:10.1017/s0043933914000324 Understanding genomic selection in poultry breeding A. WOLC 1, 2 1 Hy-Line International, Dallas Center, IA, USA; 2 Iowa State University, Ames, IA, USA Corresponding author:
More informationCattle on Feed. United States Cattle on Feed Down 6 Percent
Cattle on Feed ISSN: 8- Released December 2, 202, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). United s Cattle on Feed
More informationMILK PROTEIN GENOTYPE EFFECTS ON MILK PRODUCTION IN BEEF HEIFERS AND CALF PERFORMANCE: PRELIMINARY RESULTS. Story in Brief
MILK PROTEIN GENOTYPE EFFECTS ON MILK PRODUCTION IN BEEF HEIFERS AND CALF PERFORMANCE: PRELIMINARY RESULTS Gary K. Ziehe1, Daniel Pomp2 and David S. Buchanan3 Story in Brief Genotypes at the j3-lactoglobulinand
More informationCattle on Feed. U.S. Cattle on Feed Up 3 Percent
Cattle on Feed ISSN: 948- Released October,, by the National Agricultural Statistics Service (NASS), Agricultural Statistics Board, United s Department of Agriculture (USDA). U.S. Cattle on Feed Up 3 Percent
More informationThe Changing Impact of Economics on Managing Bovine Respiratory Disease Complex in Feedlot Cattle
The Changing Impact of Economics on Managing Bovine Respiratory Disease Complex in Feedlot Cattle AABP Conference - BRDC Symposium Shannon Neibergs Associate Professor Extension Economist School of Economic
More informationHuman Chromosomes Section 14.1
Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families
More informationCourse Syllabus for FISH/CMBL 7660 Fall 2008
Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.
More informationICAR meeting State of the art of genomic evaluation and international implications. Reinhard Reents. vit, IT solutions for Animal Prduction
ICAR meeting 2009 State of the art of genomic evaluation and international implications Reinhard Reents vit, IT solutions for Animal Prduction Chairman of the Steering Committee of Interbull 25. Mai 2009
More informationExome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.
Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all
More informationProducer Uptake: How might genomic information be translated to industry outcomes? Alison Van Eenennaam, Ph.D.
Producer Uptake: How might genomic information be translated to industry outcomes? Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics Department of Animal Science
More information