1,500 1,000. LPS + alum. * * Casp1 p10. Casp1 p45
|
|
- Jewel Camilla Mason
- 6 years ago
- Views:
Transcription
1 a NLRP3 Non-stimulation R46 BAY SI TAT LPS R46 BAY SI TAT 1,5 1, c Pro-IL-18 Pro-IL-1 LPS + alum d e f IL-1 p17 Pro-IL Casp1 p1 NLRP3 LPS + alum Supplementary Figure 1 Inhiition of Syk or Jnk do not affect the expression of inflammasome molecules. (a,d,f) Immunolot analysis of inflammasome molecules or (,c,e) Enzyme-linked immunosorent assay of IL-18 in peritoneal macrophages (a,d f), one marrow-derived macrophages (), or U937 cells (c) primed with LPS for 4 h (a), followed y stimulation with nigericin for 9 min ( d), or alum for 6 h (e,f). The indicated kinase inhiitors were added to the cultures 1 h efore stimulation., cell lysates;, supernatants. Data are shown as the means ± s.d. of triplicate samples of one experiment representative of three independent experiments. Data were analyzed y one-way ANOVA with Bonferroni multiple comparison test (,c,e). P <.1 and P <.1. Nature Immunology: doi:1.138/ni.749
2 LPS SykA SykB Mapk8A+Mapk9A Mapk8A+Mapk9B SykB+Mapk8A+Mapk9A SykB+Mapk8A+Mapk9B Control None Control SykB Mapk8A+Mapk9B LPS Control SykA SykB Mapk8A+Mapk9A JNK1A+JNKA Mapk8A+Mapk9B JNK1A+JNKB SykB+Mapk8A+Mapk9B SykB+JNK1A+JNKB None Control SykA SykB Mapk8A+Mapk9A JNK1A+JNKA Mapk8A+Mapk9B JNK1A+JNKB a Syk c 4 3 d 15 Poly(dA:dT) Jnk ND ND + Mapk8A + Mapk8B e f Casp1 p1 Casp1 p1 Poly(dA:dT) Supplementary Figure Knockdown of Syk or Mapk8-Mapk9 in primary macrophages. (a,,e,f) Immunolot analysis of caspase-1 or (c,d) enzyme-linked immunosorent assay of IL-18 in peritoneal macrophages unprimed (a,), primed with LPS for 4 h, followed y stimulation with nigericin for 9 min (c,e), or unprimed macrophages stimulated with poly(da:dt) for 3 h (d,f). Macrophages were transfected with sirnas for 48 h. Control, negative control sirna;, cell lysates;, supernatants; ND, not detected. Data are shown as the means ± s.d. of triplicate samples of one experiment representative of three independent experiments. Data were analyzed y one-way ANOVA with Bonferroni multiple comparison test (c,d). P <.1. Nature Immunology: doi:1.138/ni.749
3 a 4 6 c Casp1 p Syk Syk +/ Syk / Syk +/+ Syk / NLRP3 d e Casp1 p1 Casp1 p1 Syk LPS LPS + nigericin Syk NLRP3 Supplementary Figure 3 Syk is not required for NLRP3 inflammasome activation in dendritic cells. (a,) Enzyme-linked immunosorent assay of IL-18 or (c,d) immunolot analysis of inflammasome molecules in one marrow-derived dendritic cells (a,c,d) or one marrow-derived macrophages (,e) primed with LPS for 4 h, followed y stimulation with nigericin for 9 min. Bone marrow-derived macrophages were prepared using L-cell conditioned medium., cell lysates;, supernatants. Data are shown as the means ± s.d. of triplicate samples of one experiment representative of two independent experiments. Data were analyzed y twotailed unpaired t test with Welch s correction (a,). P <.1. Nature Immunology: doi:1.138/ni.749
4 None Counts LPS a c Nigericin p-syk Syk Poly(dA:dT) p-syk Syk LPS + nigericin BAY BAY (min) IP: a-syk IB: a-p-tyr (min) IP: a-syk IB: a-p-tyr (min) e f LPS + nigericin p-jnk Jnk Poly(dA:dT) g p-jnk Jnk LPS + nigericin (min) BAY (min) BAY 3 6 (min) k ( min) MitoSOX (FL) No staining BAY TAT p-jnk p-jnk Jnk Jnk Syk +/ Syk / d Poly(dA:dT) p-jnk (min) h 15 1 WT Card9 / i 15 1 WT Card9 / j BHA Jnk 5 5 Supplementary Figure 4 Implication that Syk contriutes to inflammasome activity through an unknown mechanism. (a g) Immunolot analysis of kinases, (h j) enzyme-linked immunosorent assay of IL-18, or (k) FACS analysis of mitochondrial ROS in peritoneal macrophages primed with LPS for 4 h, followed y stimulation with nigericin for the indicated times (a,c,e,g,h,j,k), or unprimed macrophages stimulated with poly(da:dt) for 3 h (,d,f,i,j). The kinase inhiitors and BHA (5 mm) were added to the cultures 1 h efore stimulation (a e,j,k). The cells were incuated with nigericin for min in the presence of MitoSOX (5 mm) and analyzed on a flow cytometer (k). Data are shown as the means ± s.d. of triplicate samples of one experiment. Data shown in e,f,h k are representative of three independent experiments and those in a d,g are representative of two independent experiments. Data were analyzed y two-tailed unpaired t test with Welch s correction (h j). P <.1. Nature Immunology: doi:1.138/ni.749
5 speck + cells (fold) a Nuclei Merge WT Mapk8 / Mapk9 / Syk +/ Nuclei Syk / Merge c None Poly(dA:dT) (3 h) BAY d Poly(dA:dT) (3 h) f Poly(dA:dT) ( h) MW I + DSS (kda) 91 Oligomer Dimer 37 8 Monomer Nuclei e BAY BAY Poly(dA:dT) (h) Merge I S Supplementary Figure 5 Requirement of Syk and Jnk for speck formation induced y poly(da:dt). (a d) staining or (e,f) immunolot analysis of in peritoneal macrophages primed with LPS for 4 h, followed y stimulation with nigericin for 9 min (a,), or unprimed macrophages stimulated with poly(da:dt) for the indicated times (c f). The kinase inhiitors were added to the cultures 1 h efore stimulation (c f). is shown in green, nuclei in lue (a c). The numer of speck-positive cell was counted and normalized to that of dimethyl sulfoxide (d). Triton-solule (S) and Triton-insolule (I) fractions (right margin; e) or Tritoninsolule fractions treated with DSS (I + DSS; f). Data are shown as the means ± s.d. of triplicate samples of one experiment. Data shown in c f are representative of three independent experiments and those in a, are representative of two independent experiments. Data were analyzed y Kruskal-Wallis test with Dunn s multiple comparison test (d). Scale ar, 1 mm. P <.5. Nature Immunology: doi:1.138/ni.749
6 T87 S16 T15 T15 T151 S15 S58 S153 S9 T17 T88 T16 S166 T53 T14 T69 T71 S1 T19 S16 S193 T9 S174 S63 S137 Y144 Y36 Y185 Y6 Y64 Y59 Netphos prediction score Supplementary Figure 6 Prediction of phosphorylation sites in mouse. Possile phosphorylation sites in the amino acid sequence of mouse were predicted y using the online program NetPhos.. The threshold is.5. Nature Immunology: doi:1.138/ni.749
7 a NLRP3 R58W Pro-IL-1 IB: a-flag IB: a-casp1 IB: a-il-1 NLRP3 R58W Pro-IL-1 IB: a-flag IB: a-casp1 IB: a-il-1 Supplementary Figure 7 Reconstitution of inflammasome system in HEK93 cells. (a, ) Immunolot analysis of inflammasome molecules in reconstituted HEK93 cells transfected as descried in Fig. 5a,. Nature Immunology: doi:1.138/ni.749
8 PECs ( 1 6 ) Neutrophils ( 1 6 ) F4/8 + cells ( 1 6 ) PECs ( 1 6 ) Neutrophils ( 1 6 ) F4/8 + cells ( 1 6 ) PECs ( 1 6 ) Neutrophils ( 1 6 ) F4/8 + cells ( 1 6 ) PECs ( 1 6 ) Neutrophils ( 1 6 ) F4/8 + cells ( 1 6 ) a 9 6 c Pycard / Pycard / Pycard / d 11 e 6 f g 8 6 Pycard / h Pycard / i 5 4 Pycard / Syk +/ Syk +/ Syk / Syk +/ Syk +/ Syk / Syk +/ Syk +/ Syk / PBS KC PBS KC PBS KC j 1 k l WT WT Mapk8 / Mapk9 / WT WT Mapk8 / Mapk9 / WT WT Mapk8 / Mapk9 / PBS KC PBS KC PBS KC Supplementary Figure 8 Involvement of and Jnk in inflammatory responses to MSU and Alum in vivo. (a f) Infiltration of inflammatory cells in the peritoneal cavity induced y intraperitoneal injection of MSU (a c) or alum (d f) at 6 h after injection. Two hours efore and 3 min later administration of the irritants, the mice were intraperitoneally treated with Jnk inhiitor. (g l) Infiltration of inflammatory cells in the peritoneal cavity induced y intraperitoneal injection of KC or PBS at 1.5 h after injection. Asolute numers of PECs (a,d,g,j), Gr-1 + F4/8 neutrophils (,e,h,k), and F4/8 + monocytes and macrophages (c,f,i,l) in the peritoneum were then determined. Data are shown as dots, and the ars indicate the means ± s.d. (n = 7 for a f; n = 5 for g l; n = 3 for PBS control in g l). Data were analyzed y one-way ANOVA with Bonferroni (a d,f) or Tukey-Kramer (g l) multiple comparison test, or Kruskal-Wallis test with Dunn s multiple comparison test (e)., no significant difference. P <.5, P <.1 and P <.1. Nature Immunology: doi:1.138/ni.749
9 Supplementary Tale 1 List of kinase inhiitors Inhiitor Areviation Target Final conc. R46 R46 Syk 1 M BAY BAY Syk 1 M Syk inhiitor I SI Syk 1 M PP PP Src 5 M 615 JNK 4 M TAT-TI-JIP TAT JNK 4 M SB358 SB p38 1 M FR184 FR Erk 1 M Wortmannin WO PI3K 1 nm Nature Immunology: doi:1.138/ni.749
10 Supplementary Tale Prediction of kinase-specific phosphorylation sites in from different species Tested kinase Target protein Code Position Peptide Score Syk family Mouse Y 144 SVLTEGQYQAVRAET 1.9 JNK family Mouse T 9 KFKMKLLTVQLREGY 1.31 JNK family Mouse T 87 ELAEQLQTTKEESGA 1.65 JNK family Mouse T 88 LAEQLQTTKEESGAV JNK family Mouse S 1 GAVAAAASVPAQSTA JNK family Mouse S 15 AASVPAQSTARTGHF JNK family Mouse S 153 AVRAETTSQDKMRKL JNK family Mouse S 193 LVMDLEQS Syk family Human Y 146 KVLTDEQYQAVRAEP 1.73 JNK family Human Y 187 ALRESQSYLVEDLERY 1.38 JNK family Human S 16 GIQAPPQSAAKPGLHA.5 JNK family Human T 154 QAVRAEPTNPSKMRK JNK family Human T 166 MRKLFSFTPAWNWTC.146 JNK family Human S 195 LVEDLERS 1.54 Syk family Zerafish Y 15 KVITNEDYCTIRNKE 1.89 JNK family Zerafish S 4 QEPRVTKSAIEKLKD JNK family Zerafish T 16 CTIRNKETPQKKMRE 5.14 JNK family Zerafish T 17 KKMRELLTGPITCAG 1.51 Nature Immunology: doi:1.138/ni.749
11 Supplementary Tale 3 List of primers Primer No. Primer used for Direction Sequence 1 mnlrp3 cloning Fw CCTGCGGCCGCAACGAGTGTCCGTTGCAAG mnlrp3 cloning Rv CCTGGTACCCTACCAGGAAATCTCGAAGACTA 3 msyk cloning Fw AGCTTGCGGCCGCGGGAAGTGCTGTGGACAGCGCC 4 msyk cloning Rv CTAGAGTCGACTTAGTTAACCACGTCGTAGTAG 5 mjnk1 cloning Fw CAACTATCGATGAGCAGAAGCAAACGTGACAAC 6 mjnk1 cloning Rv CGCACGGATCCTCATTGCTGCACCTGTGCTAAAGG 7 mjnk cloning Fw CAACTATCGATGAGTGACAGTAAAAGCGATGG 8 mjnk cloning Rv CGCACGGATCCTCACCGGCAGCCTTCCAGGGGTCC 9 NLRP3-R58W mutant Fw CCACTGCTGGGAGGTGAGCCTCAG 1 NLRP3-R58W mutant Rv TCACCTCCCAGCAGTGGATAAAGAA 11 -S16A mutant Fw AACTTGGCCGGGGATGAACTCAAAAAG 1 -S16A mutant Rv ATCCCCGGCCAAGTTTTCAAGAGC 13 -S58A mutant Fw CTTGTCGCCTACTATCTGGAGTCGTATG 14 -S58A mutant Rv ATAGTAGGCGACAAGTTTGTCAGTGAG 15 -T69A mutant Fw GAGCTCGCCATGACTGTGCTTAGAG 16 -T69A mutant Rv AGTCATGGCGAGCTCCAAGCCATAC 17 -S87A/T88A mutant Fw CTGCAAGCCGCTAAAGAAGAGTCTGGA 18 -S87A/T88A mutant Rv CTTCTTTAGCGGCTTGCAGCTGCTCAGC Nature Immunology: doi:1.138/ni.749
12 Primer No. Primer used for Direction Sequence 19 -S9A mutant Fw GAAGAGGCCGGAGCTGTGGCAGCTG -S9A mutant Rv CAGCTCCGGCCTCTTCTTTAGTCGT 1 -S15A/T16A mutant Fw CTCAGGCCGCAGCCAGAACAGGACAC -S15A/T16A mutant Rv CTGGCTGCGGCCTGAGCAGGGACACTG 3 -T15A mutant Fw AGGGTCGCAGAAGTGGACGGAGTGCTG 4 -T15A mutant Rv CACTTCTGCGACCCTGGCAATGAGTGC 5 -T151A/T15A/S153A mutant Fw AGAGGCCGCCGCCCAAGACAAGATGAGGAAG 6 -T151A/T15A/S153A mutant Rv CTTGGGCGGCGGCCTCTGCACGAACTGCCTG 7 -S16A mutant Fw AACTTGGCCGGGGATGAACTCAAAAAG 8 -S16A mutant Rv ATCCCCGGCCAAGTTTTCAAGAGC 9 -T17A mutant Fw AACCTGGCCTGCAAGGACTCCCTC 3 -T17A mutant Rv CTTGCAGGCCAGGTTCCAGGATGG 31 -Y36F mutant Fw GAAGGCTTTGGGCGCATCCCACGC 3 -Y36F mutant Rv GCGCCCAAAGCCTTCTCGCAGTTG 33 -Y144F mutant Fw GGACAGTTCCAGGCAGTTCGTGCA 34 -Y144F mutant Rv TGCCTGGAACTGTCCTTCAGTCAG 35 Deletion of FLAG-tag Fw CTACCATGGCGGCCGCGAATTCATCG 36 Deletion of FLAG-tag Rv GCGGCCGCCATGGTAGATCAATTCTGA Nature Immunology: doi:1.138/ni.749
Nature Immunology: doi: /ni.3015
Supplementary Figure 1 Role of RIP1-RIP3 and PGAM5 in RNA virus induced inflammasome activation. (a) LDH release from LPS-primed BMDMs from wild-type mice (WT), Rip3 -/- or Nlrp3 -/- mice infected with
More informationNature Immunology: doi: /ni.3538
Supplementary Figure 1 PGE 2 does not induce degradation of NLRP3 inflammasome components but rapidly inhibits NLRP3 activation in macrophages. (a-d) LPS-primed BMDM. (a) Lysates (LYS) from PGE 2 (500
More informationSupplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,
More informationSupplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from
More informationTRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
More informationSupplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
More informationWT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al.,
Supplemental material JCB Kimura et al., http://www.jcb.org/cgi/content/full/jcb.201503023/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. TRIMs regulate IFN-γ induced autophagy. (A and B) HC image analysis
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationSupplementary Methods
Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationSupplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationSupplementary figures
Relative intensity Relative intensity Relative intensity Supplementary figures a None Caffeine None Caffeine c None Caffeine 6 6 6 ISG 6 6 6 UBE1L 6 6 6 UBCH8 6 6 6 EFP 1 1 DOX (h) 1 1 CPT (h) 1 1 UV (h)
More informationSupplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationa Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs
a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5
More informationneutrophils (CD11b+, the total Statistical multiple
Supplementary Figure 1. (A) Wild type and Vim / mice were treated with (24mg/kg LPS); lungs were harvested at 48h and enzymaticallyy digested. CD45+ cells were excluded from the total cell population and
More informationSupplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationSupplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
More informationNature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationSupplementary Information
Supplementary Information Inhibition of lethal inflammatory responses through the targeting of membrane-associated Toll-like receptor 4 signaling complexes with a Smad6- derived peptide Youn Sook Lee,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationSupplementary Information
Supplementary Information Mutual reinforcement of inflammation and carcinogenesis by the Helicobacter pylori CagA oncoprotein Nobumi Suzuki, Naoko Murata-Kamiya, Kohei Yanagiya, Wataru Suda, Masahira Hattori,
More informationA group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response
A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily
More informationmonoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern
Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung
More informationSupplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.
α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationFlowcytometry-based purity analysis of peritoneal macrophage culture.
Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate
More informationSupplemental Figure 1
mrna level (fold induction) Supplemental Figure 1 a-flag pmx-rank WT pmx-rank Mt 0 1 3 6 0 1 3 6 (h) c-fos b-actin 5 4 3 2 1 0 0 1 3 6 0 1 3 6 (h) pmx-rank WT pmx-rank Mt TRAP+ Mononuclear pre-ocs/well
More informationFigure S1- Targeting strategy for generating SIK1-T182A, SIK2-T175A and SIK3-T163A KI mice.
Figure S1- Targeting strategy for generating SIK1-T12A, SIK2-T175A and SIK3-T163A mice. Left panel represents a depiction of the genomic loci of each gene, the targeting strategy and the final recombined
More informationBcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein
Bcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein Maybelline Giam 1,2, Toru Okamoto 1,2,3, Justine D. Mintern 1,2,4, Andreas Strasser 1,2 and Philippe Bouillet 1, 2 1 The Walter and Eliza
More informationFigure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly
Supplemental Figure Legends. Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly dependent on caspase 8. GBM6 and GBM12 cells were treated 24 h after plating with
More informationSupplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationThis is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
More informationSupplemental Figure 1
Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationDC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN
CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationFigure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations
Figure S1 A B C Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations (A-B) Murine bone cells were cultured in either M-CSF (5,000 U/ml) or GM-CSF
More informationSupplementary Methods Plasmid constructs
Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned
More informationAlbumin. MMP-9 (tertiary granules) Lactoferrin. MPO (U/ml) ctrl PMN-sec
Figure S1: Antibody cross-linking of CD18 induces release of primary, secondary, and tertiary granules as well as secretory vesicles. Freshly isolated PMN were incubated with primary anti-cd18 mab IB4
More informationSupplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused
More informationGene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'
Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr
More informationisolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
More informationThe PYRIN domain only protein POP3 inhibits ALR inflammasomes and regulates responses to infection with DNA viruses
ARTICLES The PYRIN domain only protein inhibits ALR inflammasomes and regulates responses to infection with DNA viruses Sonal Khare, Rojo A Ratsimandresy, Lúcia de Almeida, Carla M Cuda, Stephanie L Rellick,8,
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationSupporting Information
Supporting Information Casson et al. 10.1073/pnas.1421699112 Sl Materials and Methods Macrophage Infections. In experiments where macrophages were primed with LPS, cells were pretreated with 0.5 μg/ml
More informationNature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
More informationNature Immunology: doi: /ni Supplementary Figure 1. Overexpression of Ym1 reduces eosinophil numbers in the lungs.
Supplementary Figure 1 Overexpression of Ym1 reduces eosinophil numbers in the lungs. (a-d) Absolute numbers per mg of tissue of CD8 + T cells (a), CD4 + T cells (b), CD19 + CD11b - B cells (c) and SigF
More informationSupplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
More informationSupplemental Data. Li et al. (2015). Plant Cell /tpc
Supplemental Data Supplemental Figure 1: Characterization of asr3 T-DNA knockout lines and complementation transgenic lines. (A) The scheme of At2G33550 (ASR3) with gray boxes indicating exons and dash
More informationSupplementary Figure 1
Supplementary Figure 1 PTEN promotes virus-induced expression of IFNB1 and its downstream genes. (a) Quantitative RT-PCR analysis of IFNB1 mrna (left) and ELISA of IFN-β (right) in HEK 293 cells (2 10
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationSUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
More informationSupplementary Materials
Supplementary Materials Figure S1. Anti-pY128 Cas antibody is specific. HEK293 cells were transfected with Flagtagged WT or Y128F mutant p130 Cas plasmid. Cell lysates were immunoprecipitated with anti-
More information14_integrins_EGFR
α1 Integrin α1 -/- fibroblasts from integrin α1 knockout animals Figure S1. Serum-starved fibroblasts from α -/- 1 and +/+ mice were stimulated with 10% FBS for 30 min. (FBS) or plated on collagen I (CI)
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationSupporting Information
Supporting Information He et al. 10.1073/pnas.1116302108 SI Methods Cell Culture. Mouse J774A.1 and RAW 264.7 macrophages were obtained from ATCC and were cultured in MEM supplemented with 10% FS (Sigma)
More informationSupplementary Figures
Supplementary Figures 1 Supplementary Figure 1. Expression of TFF2 in splenic T cells. (a) Accumulation of CD11b + Gr-1 + cells in spleen upon 2.5% DSS treatment. The values presented as mean ±s.d. per
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
More informationErk activation drives intestinal tumorigenesis in Apc min/+ mice
correction notice Nat. Med. 16, 665 670 (2010) Erk activation drives intestinal tumorigenesis in Apc min/+ mice Sung Hee Lee, Li-Li Hu, Jose Gonzalez-Navajas, Geom Seog Seo, Carol Shen, Jonathan Brick,
More informationSupplementary Figure 1 Activated B cells are subdivided into three groups
Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation
More informationPost-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
More informationMultivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy
In the format provided by the authors and unedited. DOI: 10.1038/NNANO.2017.69 Multivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy Hengfeng Yuan, Wen Jiang,* Christina A.
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41
Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 were assessed on purified platelets from Casp8 fl/fl and
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationSupporting Online Material. 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice
Supporting Online Material 1. Materials and Methods 2. Generation of TRIF-deficient mice 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice 4. Measurement of LPS-induced IRAK-1 kinase
More informationSupplementary Figures and Legends.
Supplementary Figures and Legends. Supplementary Figure 1: Impact of injury on Rb1 and PPARϒ expression. Following ipsilateral axotomy injury, adult DRG expression of Rb1 mrna declined (*p
More informationSupplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
More informationSupplementary Information
Supplementary Information stability is regulated by CK2-dependent interaction with R2TP complex Patrick von Morgen 1,2, Kamila Burdova 1, Thomas G. Flower 3, Nicola J. O'Reilly 4, Simon J. Boulton 5, Stephen
More informationSupplementary Information
Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated
More informationP-selectin primes leukocyte integrin activation during inflammation
7 Nature Publishing Group http://www.nature.com/natureimmunology P-selectin primes leukocyte integrin activation during inflammation Hai-Bo Wang 1,4, Jin-Tao Wang 1,4, Lei Zhang 1,4, Zhen H Geng,4, Wei-Li
More informationSupplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
More informationSupplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationA novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated
A novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated cancer therapeutic antibodies Supplemental Data File in this Data Supplement: Supplementary Figure 1-4
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationSupplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSupplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating
Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/258/rs3/dc1 Supplementary Materials for A Genome-Wide sirna Screen Reveals Positive and Negative Regulators of the NOD2 and NF-κB Signaling Pathways Neil Warner,
More informationSupplementary Information Supplementary Figure 1
Bararia, Kwok et al, Supplementary Page 1 Supplementary Information Supplementary Figure 1 S1 Bararia, Kwok et al, Supplementary Page 2 Supplementary Figure 1 (cont.) S2 Bararia, Kwok et al, Supplementary
More informationSupplementary Online Material
Material and Methods Supplementary Online Material Reagents and antibodies Wortmannin, JNK inhibitor II (Anthra[1,9-cd]pyrazol-6(2H)-one 1,9-pyrazoloanthrone), SB 2358, and PD 9859 were purchased from
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationSupporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
More informationSI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers
SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationStargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSupplemental Information. By Capturing Inflammatory Lipids Released. from Dying Cells, the Receptor CD14 Induces
Immunity, Volume 47 Supplemental Information By Capturing Inflammatory Lipids Released from Dying Cells, the Receptor CD14 Induces Inflammasome-Dependent Phagocyte Hyperactivation Ivan Zanoni, Yunhao Tan,
More information