Supplementary Data. Santiago Grijalvo and Ramón Eritja *
|
|
- Clyde Dickerson
- 6 years ago
- Views:
Transcription
1 Supplementary Data Synthesis and in vitro Inhibition Properties of Oligonucleotide Conjugates Carrying Amphipathic Proline-rich Peptide Derivatives of the Sweet Arrow Peptide (SAP) Santiago Grijalvo and Ramón Eritja * Institute for Research in Biomedicine (IRB Barcelona); Institute for Advanced Chemistry of Catalonia (IQAC); Networking Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN); Spanish Research Council (CSIC); Cluster Building, Baldiri Reixac 10, E Barcelona, Spain. * recgma@cid.csic.es S-1
2 Summary Table 1. MALDI-TOFF mass spectrometry... S-4 SAP-oligonucleotide conjugates. HPLC chromatograms and MALDI-TOF mass spectrometry spectra 6a... S-5 6b S-6 9a S-7 9b S-8 13a..... S-9 13b S-10 14a S-11 14b S-12 SAP-antisense phosphorothioate conjugates. HPLC chromatograms and MALDI- TOF mass spectrometry spectra 6c S-13 6d... S-14 9c S-15 9d S-16 13c..... S-17 14c S-18 Scr-Orn..... S-19 Polyacrylamide gel electrophoresis (PAGE) Fig. 1S Analysis of the formation of complexes between unmodified antisense phosphorothioate and SAP peptide by native PAGE.. S-20 Fig. 2S Denaturing PAGE of the SAP-antisense oligonucleotide phosphorothioate conjugates synthesized in this study.. S-20 S-2
3 Cell culture Fig. 3S Gene-specific silencing activities of antisense phosphorothioate oligonucleotide conjugates without lipofectamine at 300 nm oligonucleotide concentration S-21 Fig. 4S Dose-response experiments of SAP: antisense phosphorothioate complexes at 150 nm and 300 nm oligonucleotide concentration.... S-22 Fig. 5S Gene-specific silencing activities for antisense phosphorothioate oligonucleotide conjugates using SAP peptide as a transfecting agent. S-23 S-3
4 Table 1S. MALDI-TOFF mass spectrometry Sequence SAP-ODN MW (calc) MW (found) (5 ->3 ) conjugate A 6a A 6b B 6c B 6d A 9a A 9b B 9c * B 9d 7968 n.d. A 13a A 13b B 13c A 14a A 14b B 14c * B Scr-Orn * A unmodified n.d n.d. B unmodified Sequence A (phosphate form): 5 -CGCGAATTCGCG-3 Sequence B (phosphorothioate form): 5 - AGGTCTTGTTTCCTTTGC-3 n.d. not determined; *the mass corresponds to the removal of the whole peptide and the two spacers S-4
5 SAP-ODN conjugates. HPLC chromatograms and MALDI-TOFF mass spectrometry spectra (VKLPPP) 3 GCGCTTAAGCGC 6a S-5
6 (VKLPPP) 3 GCGCTTAAGCGC 6b S-6
7 (VOrnLPPP) 3 CGCGAATTCGCG 9a S-7
8 (VOrnLPPP) 3 CGCGAATTCGCG 9b S-8
9 (VHArgLPPP) 3 CGCGAATTCGCG 13a S-9
10 (VHArgLPPP) 3 CGCGAATTCGCG 13b S-10
11 (VArgLPPP) 3 CGCGAATTCGCG 14a S-11
12 (VArgLPPP) 3 CGCGAATTCGCG 14b S-12
13 SAP-antisense phosphorothioate conjugates. HPLC chromatograms and MALDI-TOFF mass spectrometry spectra (VKLPPP) 3 CGTTTCCTTTGTTCTGGA 6c S-13
14 (VKLPPP) 3 CGTTTCCTTTGTTCTGGA 6d S-14
15 (VOrnLPPP) 3 CGTTTCCTTTGTTCTGGA 9c S-15
16 (VOrnLPPP) 3 CGTTTCCTTTGTTCTGGA 9d S-16
17 (VHArgLPPP) 3 CGTTTCCTTTGTTCTGGA 13c S-17
18 (VArgLPPP) 3 CGTTTCCTTTGTTCTGGA 14c S-18
19 (Val Orn Leu Pro Pro Pro)3 Scr-Orn S-19
20 Polyacrylamide gel electrophoresis (SDS-PAGE) Fig. 1S. Native SDS-PAGE gel shift assay to analyze the ability of SAP peptide to form complexes with unmodified oligonucleotide phosphorothioate (wt). SAP peptide shows the highest propensity for the formation of the complex with the phosphorothioate oligonucleotide at a 10-fold molar excess of SAP Fig. 2S 7M urea PAGE of SAP-antisense phosphorothioate conjugates 20 % Polyacrylamide, 8M urea gel electrophoresis of SAP-antisense phosphorothioate conjugates. The gel was stained with STAINS-ALL. Lane 1: SAP-antisense phosphorothioate 6c; Lane 2: 6d; Lane 3: 9c; Lane 4: 9d; Lane 5: 13c; Lane 6: 14c S-20
21 Cell Culture Fig. 3S Gene-specific silencing activities of antisense phosphorothioate oligonucleotide conjugates without lipofectamine at 300 nm oligonucleotide concentration Gene-specific silencing activities for unmodified phosphorothioate oligonucleotide (wt), and SAP-antisense phosphorothioate conjugates (6c, 15, 9c, 16, 13c and 14c; 300 nm per well) targeting the Renilla luciferase mrna expressed in SH-SY5Y cells. Transfection of antisense oligonucleotides was carried out without using Lipofectamine S-21
22 Fig. 4S Dose-response experiments of SAP: antisense phosphorothioate complexes at 150 nm and 300 nm oligonucleotide concentration Gene-specific silencing activities for unmodified antisense oligonucleotide (wt) complexed with SAP peptide. The concentration of antisense oligonucleotide was 150 nm and 300 nm, respectively. The molar peptide: antisense oligonucleotide ratio used was 4:1, 6:1 and 10:1 targeting the Renilla luciferase mrna expressed in SH-SY5Y cells. Transfection was carried out using SAP peptide as transfecting agent. The bar wt represents the value of the luciferase activity without using SAP peptide as transfecting agent. A scramble sequence combined with SAP peptide in a 6:1 M ratio gave no Renilla luciferase inhibition. S-22
23 Fig. 5S Gene-specific silencing activities for antisense phosphorothioate oligonucleotide conjugates using SAP peptide as a transfecting agent at a molar ratio of 6:1 (SAP peptide / oligonucleotide). A B Gene-specific silencing activities for phosphorothiote oligonucleotide conjugates (wt, 6c, 6d, 9c, 9d, 13c, 14c and Scr-Orn) targeting the Renilla luciferase mrna expressed in SH-SY5Y cells. Transfection of antisense oligonucleotides was carried out using SAP peptide as transfecting agent in a 6-fold molar excess (peptide:sap-antisense conjugate) (A) Experiment was performed at 150 nm oligonucleotide concentration; (B) Experiment was performed at 300 nm oligonucleotide concentration. Scrambled sequence (Scr-Orn) gave no Renilla luciferase inhibition. S-23
Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient
Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,
More informationSilencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna
Catalog #: Various Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna General Product Details and User Information Refer to page
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationSupporting Information
Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a
More informationPrice List. Primers and Oligonucleotides. DNA and RNA Oligos. Content
Content Content... 1 Unmodified DNA Oligonucleotides... 2 Modified DNA Oligonucleotides - 5' Fluorescent Labels... 2 Modified DNA Oligonucleotides - 5' Non-Fluorescent Labels... 3 Modified DNA Oligonucleotides
More informationProteomics. Proteomics is the study of all proteins within organism. Challenges
Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationAdvances in analytical biochemistry and systems biology: Proteomics
Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current
More informationZool 3200: Cell Biology Exam 3 3/6/15
Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationPrimiano Pio Di Mauro, Biomedical Engineer, PhD in Bioengineering
Primiano Pio Di Mauro, Biomedical Engineer, PhD in Bioengineering pri.dimauro@gmail.com Mobile: 0034 689326511 Carrer de la Diputació 478 1º2ª, 08013, Barcelona, Spain https://www.linkedin.com/in/pridimauro/
More informationENCODE RBP Antibody Characterization Guidelines
ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationSupplementary Material
Supplementary Material Repressor CopG prevents access of RN polymerase to promoter and actively dissociates open complexes na M. Hernández-rriaga, Tania S. Rubio-Lepe, Manuel Espinosa and Gloria del Solar
More informationPurification of Lactate Dehydrogenase
Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase
More informationVyužití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS
Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS Michal Godula Ph.D. Thermo Fisher Scientific The world leader in serving science
More informationDNA/RNA Oligonucleotide Services General Price List; valid from
Optimised Application Oligos All our application oligos are optimised and scientifically proven to show highly consistent results in respective application Online synthesis reports, data sheets and quality
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationActive targeting of the nucleus using non-peptidic boronate tags
Supporting Information Active targeting of the nucleus using non-peptidic boronate tags Rui Tang 1, Ming Wang 2, Moumita Ray 1, Ying Jiang 1, Ziwen Jiang 1, Qiaobing Xu 2 *, Vincent M. Rotello 1 * 1 Department
More informationRNA/aTNA Chimeras: RNAi Effects and Nucleases Resistance of Single and Double Stranded RNAs
Molecules 2014, 19, 17872-17896; doi:10.3390/molecules191117872 PEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article RNA/aTNA Chimeras: RNAi Effects and Nucleases Resistance of Single
More informationOLIGONUCLEOTIDE ANALOGUES: FROM SUPRAMOLECULAR PRINCIPLES TO BIOLOGICAL PROPERTIES
PL1 Oligonucleotide Analogues 21 OLIGONUCLEOTIDE ANALOGUES: FROM SUPRAMOLECULAR PRINCIPLES TO BIOLOGICAL PROPERTIES Damian ITTIG, Dorte RENNEBERG, David VONLANTHEN, Samuel LUISIER and Christian J. LEUMANN*
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationUse of Antisense Oligonucleotides for the Treatment of Inheritable Rare Disorders. C. Frank Bennett Isis Pharmaceuticals
Use of Antisense ligonucleotides for the Treatment of Inheritable Rare Disorders C. Frank Bennett Isis Pharmaceuticals Agenda Review different antisense strategies Delivery of oligonucleotides to the skin,
More information2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11
Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationDNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli
Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain
More informationEnable New Experimental Possibilities with Custom RNA Synthesis
Custom RNA Synthesis Enable New Experimental Possibilities with Custom RNA Synthesis Dharmacon custom RNA synthesis enables additional experimental abilities and scientific discoveries through unique chemistry,
More informationProtein Electrophoresis EZ-Run Protein Gel Solution EZ-Run Protein Standards EZ-Run Gel Staining Solution Traditional SDS-PAGE Reagents
Protein Electrophoresis EZ-Run Protein Gel Solution EZ-Run Protein Standards EZ-Run Gel Staining Solution Traditional SDS-PAGE Reagents Reliability. Purity. Certainty. Introduction Sodium dodecyl sulfate
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationGenetic analysis of the Nd-s mutation in the silkworm,
Jpn. J. Genet. (1984) 59, pp. 307-313 Genetic analysis of the Nd-s mutation in the silkworm, Bombyx mori BY Fusaho TAKEI, Ken-ichi KIMURA, Shigeki MIZUNo, Toshio YAMAMOTO1' and Kensuke SHIMURA2' Laboratory
More informationPurification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract
Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural
More informationPurification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!
Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,
More informationamaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3
Contents amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Background Information 4 Cell culture 4 Supporting Data 5-8 Equipment
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter
More informationSupporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy
Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More informationDetermination of Dimeric Disulfide Linkage in a Recombinant Human Prolactin. Antagonist. A Senior Honors Thesis
Determination of Dimeric Disulfide Linkage in a Recombinant Human Prolactin Antagonist A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for Graduation with Distinction in Biochemistry
More informationmir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
More informationInvestigation of a Mammalian Cellular Model for Differential Protein Expression Analysis Using 1D PAGE and Cleavable ICAT Reagents
pplication Note 1D PGE and Cleavable ICT Reagents Investigation of a Mammalian Cellular Model for Differential Protein Expression nalysis Using 1D PGE and Cleavable ICT Reagents Overview The use of two-dimensional
More informationENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2007
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2007 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2007 Supporting Information for C-Terminal Incorporation
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationTHE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL
THE DELIVERY EXPERTS INTERFERin in vitro sirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna transfection reagent that ensures efficient gene silencing and reproducible transfection
More informationSupporting Information. for. Advanced Materials, adma Wiley-VCH 2008
Supporting Information for Advanced Materials, adma.200700866 Wiley-VCH 2008 69451 Weinheim, Germany DNA Block Copolymer Micelles A Combinatorial Tool for Cancer Nanotechnology** Fikri E. Alemdaroglu,
More informationGalina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
More informationDirecte d Mutagenesis
Directe d Mutagenesis A Practical Approac h M. J. McPHERSON 1. Mutagenesis facilitated by the removal or introduction of unique restriction sites 1 P. Carte r 1. Introduction to site-directed mutagenesis
More informationSynthesis of Oligonucleotides Carrying Thiol Groups Using a Simple Reagent Derived from Threoninol
Molecules 2012, 17, 10026-10045; doi:10.3390/molecules170910026 PEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Synthesis of ligonucleotides Carrying Thiol Groups Using a Simple
More informationMasayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies
Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationLecture 8: Affinity Chromatography-III
Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationRecent Advancements in Analytical Methods of Drug Detection
Recent Advancements in Analytical Methods of Drug Detection Mario Thevis Gene and Cell Doping Symposium Beijing, June 5/6, 2013 www.wada-ama.org Challenges at the time accepted by anti-doping authorities
More informationAnaTag HiLyte Fluor 647 Protein Labeling Kit
AnaTag HiLyte Fluor 647 Protein Labeling Kit Catalog # 72049 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 647 SE to proteins (e.g., IgG). It provides ample materials
More informationSupplemental Information. Natural RNA Polymerase Aptamers. Regulate Transcription in E. coli
Molecular Cell, Volume 67 Supplemental Information Natural RNA Polymerase Aptamers Regulate Transcription in E. coli Nadezda Sedlyarova, Philipp Rescheneder, Andrés Magán, Niko Popitsch, Natascha Rziha,
More informationCertified. TransIT Broad Spectrum Transfection Reagents. TransIT-X2. TransIT -LT1. TransIT TransIT -mrna
Broad Spectrum Reagents For more than two decades Mirus Bio has been dedicated to developing reagents that feature high efficiency, low toxicity transfections. The products included in this piece are our
More informationPROTEOMICS: STUDY OF PROTEINS. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University
PROTEOMICS: STUDY OF PROTEINS HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 Why study proteins? Proteins are mainly studied because of their
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationLight Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2016 Light Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers
More informationSynthetic oligonucleotides are omnipresent in most laboratories as a result of the highly
RAMON ERITJA Synthesis and properties of modified oligonucleotides Synthetic oligonucleotides are omnipresent in most laboratories as a result of the highly optimised protocols developed for solid-phase
More informationDETERMINATION OF SERUM FERRITIN GLYCOSYLATION IN HYPERFERRITINEMIA
DETERMINATION OF SERUM FERRITIN GLYCOSYLATION IN HYPERFERRITINEMIA ASSOCIATED TO IRON OVERLOAD AND INFLAMMATION. Bethina Isasi Gasser 1,2 1 Medical University of Innsbruck, Department of Medicine II Gastroenterology
More informationTop down proteomics approaches: (a) to monitor protein purification; (b) to resolve PTM isoforms and protein complexes
Top down proteomics approaches: (a) to monitor protein purification; (b) to resolve PTM isoforms and protein complexes Jan 11, 2013 BMG744 Helen Kim Department of Pharmacology and Toxicology Targeted Metabolomics
More informationSupplementary Information
Supplementary Information Deletion of the B-B and C-C regions of inverted terminal repeats reduces raav productivity but increases transgene expression Qingzhang Zhou 1, Wenhong Tian 2, Chunguo Liu 3,
More informationEukaryotic Transcription
Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).
More informationAdvanced RNA Synthesis as a Key Tool In RNA Biology Research.
Advanced RNA Synthesis as a Key Tool In RNA iology Research. Andrei Laikhter io-synthesis, Inc. RNA iology Challenges ptimizing chemistry and design of the corresponding small RNA (i.e. optimizing target
More informationENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog
More informationTranscriptional Regulation in Eukaryotes
Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationChapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates
Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates The work described in this chapter was accomplished in collaboration with V. Rucker (Dervan
More informationApplication Note USD Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent
Application Note USD 241 Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent What this Study Demonstrates T h i s s t u d y o n C a
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationCustom DNA Oligonucleotides. accelerate > primers
Custom DNA Oligonucleotides accelerate > primers Custom DNA Oligonucleotides accelerate > primers Highest quality oligos with rigorous quality control Industry-leading pricing Reliable delivery times
More informationKPL LumiGLO Reserve Chemiluminescent Substrate
DESCRIPTION KPL LumiGLO Reserve contains a luminol-based chemiluminescent substrate designed for use with peroxidase-labeled (HRP) reporter molecules. KPL LumiGLO Reserve offers improvements in the way
More informationAll your genetic analyses on a single instrument
GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All on a single instrument Perform your genetic assays on one instrument A
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationSupplemental Material for Xue et al. List. Supplemental Figure legends. Figure S1. Related to Figure 1. Figure S2. Related to Figure 3
Supplemental Material for Xue et al List Supplemental Figure legends Figure S1. Related to Figure 1 Figure S. Related to Figure 3 Figure S3. Related to Figure 4 Figure S4. Related to Figure 4 Figure S5.
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
More informationSpecific Sequence Features, Recognized by the SMN Complex, Identify snrnas and Determine Their Fate as snrnps
MOLECULAR AND CELLULAR BIOLOGY, Nov. 2005, p. 10989 11004 Vol. 25, No. 24 0270-7306/05/$08.00 0 doi:10.1128/mcb.25.24.10989 11004.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved.
More informationSupplementary Material (ESI) for Organic & Biomolecular Chemistry This journal is The Royal Society of Chemistry 2011
Supplementary Material (ESI) for rganic & Biomolecular Chemistry Supplementary material Characterization of the TDP-D-ravidosamine biosynthetic pathway: one-pot enzymatic synthesis of TDP-D-ravidosamine
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationHigh Yield/ Routine Applications Problematic templates, High GC/AT High Fidelity Heat-Activated Long Products High Specificity DHPLC Compatible
Yield/ Routine Applications Problematic templates, GC/AT Fidelity Heat-Activated Long Products Specificity DHPLC Compatible Polymerases Optimised dntp/ Polymerase Mixes Introduction are essential tools
More informationElectro refers to electron flow or current. Thus Electrophoresis is movement under electric current.
ELECTROPHORESIS Electrophoresis Electro refers to electron flow or current. Phoresis refers to movement. Thus Electrophoresis is movement under electric current. This technique therefore can separate molecules
More informationINTERFERin sirna transfection reagent
INTERFERin in vitro sirna Transfection Protocol Company Information... 2 Product Information... 3 1. Standard sirna transfection of adherent cells... 4 (forward transfection)... 4 1.1 Cell seeding... 5
More information2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.
From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how
More informationApplied Microbiology and Biotechnology. Isolation of a bacterial consortium able to degrade the fungicide thiabendazole:
Applied Microbiology and Biotechnology Isolation of a bacterial consortium able to degrade the fungicide thiabendazole: the key role of a Sphingomonas phylotype Chiara Perruchon 1, Antonis Chatzinotas
More informationGene Expression Translation U C A G A G
Why? ene Expression Translation How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how your body works is carried out by cells through
More informationSeparating Proteins by pi-values Can 2D LC
Separating Proteins by pi-values Can D LC Replace D GE? Tyge Greibrokk, 1 Milaim Pepaj, 1 Elsa Lundanes, 1 Thomas Andersen and Katerina Novotna 1Department of Chemistry, University of Oslo, Norway, G&T
More information2 The abbreviations used are: AAA, ATPases associated with a variety of cellular
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 50, pp. 39523 39535, December 10, 2010 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. The C Terminus of
More informationTranscription is the first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme, RNA polymerase.
Transcription in Bacteria Transcription in Bacteria Transcription in Bacteria Transcription is the first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme,
More informationChem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary
More informationGenome Biology and Biotechnology
Genome Biology and Biotechnology 10. The proteome Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course
More informationRaw Materials for Oligonucleotide and Phosphoramidite Synthesis
Raw Materials for Oligonucleotide and Phosphoramidite Synthesis AIC offers a wide variety of high purity reagents for use in oligonucleotide and phosphoramidite synthesis. These reagents are competitively
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More informationExam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
More informationCase 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 29 September 2005
Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 9 September 005 Focus concept Purification of a novel seed storage protein allows sequence analysis and
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationInstant-Bands Protein Sample Loading Buffer for SDS-PAGE. User s Manual. View Protein Bands in an SDS Gel. Instantly. EZBiolab.
Instant-Bands Protein Sample Loading Buffer for SDS-PAGE User s Manual View Protein Bands in an SDS Gel Instantly www.ezbiolab.com 2 Instant-Bands User s Manual Table of Contents Introduction 3 Storage
More information