Sangtae Kim. Dissertation: Generating Functions of Tandem Mass Spectra and Their Applications to Peptide Identifications Advisor: Pavel Pevzner
|
|
|
- Suzanna Cunningham
- 6 years ago
- Views:
Transcription
1 Sangtae Kim and Engineering 9500 Gilman Drive, La Jolla, CA Tel: (858) Education Ph.D. in Computer Science Sep May 2012 Dissertation: Generating Functions of Tandem Mass Spectra and Their Applications to Peptide Identifications Advisor: Pavel Pevzner Master in Computer Science Mar Feb Dissertation: An Efficient Algorithm to Find All Normalized Local Alignments Above a Threshold Advisor: Kunsoo Park Bachelor in Computer Science Mar Feb Professional Experience Graduate Student Researcher and Engineering Full-time Researcher Research Center for Computer Technology Hanyang University, Seoul, Korea Full-time Lecturer Korea Military Academy, Seoul, Korea Served as an officer in the Republic of Korea army for mandatory military service. Sep Present Jul Aug Apr Jun Publications Refereed Journal Papers Applications for Database Searches of Tandem Mass Spectra, Molecular & Cellular Proteomics, 10, M , Sangtae Kim, Nikolai Mischerikow, Nuno Bandeira, J. Daniel Navarro, Louis Wich, Shabaz Mohammed, Albert J. R. Heck and Pavel Pevzner, The Generating Function of CID, ETD and CID/ETD Pairs of Tandem Mass Spectra: Applications to Database Search, Molecular & Cellular Proteomics, 9, , Sangtae Kim, Nuno Bandeira and Pavel Pevzner, Spectral Profiles: A Novel Representation of Tandem Mass Spectra and its Applications for de Novo Peptide Sequencing and Identification, Molecular & Cellular Proteomics, 8, , (Highlighted on the cover of the June 2009 issue of Molecular & Cellular Proteomics.)
2 Sangtae Kim, Nitin Gupta, Nuno Bandeira and Pavel Pevzner, Spectral Dictionaries: Integrating De Novo Peptide Sequencing with Database Search of Tandem Mass Spectra, Molecular & Cellular Proteomics, 8, 53-69, Pavel Pevzner, Sangtae Kim and Julio Ng, Comment on Protein Sequences from Mastodon and Tyrannosaurus Rex Revealed by Mass Spectrometry, Science, 321 (5892), 1040, Sangtae Kim, Nitin Gupta and Pavel Pevzner, Spectral Probabilities and Generating Functions of Tandem Mass Spectra: A Strike against Decoy Databases, Journal of Proteome Research, 7, , (Noted as one of the 20 most cited articles of the journal in recent 3 years.) Sangtae Kim, Seungjin Na, Ji Woong Sim, Heejin Park, Jaeho Jeong, Hokeun Kim, Younghwan Seo, Jawon Seo, Kong-Joo Lee and Eunok Paek, MOD i : A Powerful and Convenient Web Server for Identifying Multiple Post-translational Peptide Modifications from Tandem Mass Spectra, Nucleic Acids Research, 34, W258-W263, Sangtae Kim, Jeong Seop Sim, Heejin Park, Kunsoo Park, Hyunseok Park and Jeong-Sun Seo, A Heuristic Algorithm to Find All Normalized Local Alignments Above Threshold, Genomics & Informatics, 1, 26-32, Refereed Conference Papers Applications for Database Searches of Tandem Mass Spectra, In Proceedings of the Fourteenth International Conference on Research in Computational Molecular Biology (RECOMB-2010), , Aug Working Papers Sangtae Kim and Pavel Pevzner, MS-GF+: A Universal Database Search Tool for Mass Spectrometry, in preparation. Kyowon Jeong, Sangtae Kim and Pavel Pevzner, UniNovo: Universal de Novo Sequencing Tool for Tandem Mass Spectrometry, in preparation. Hosein Mohimani, Sangtae Kim and Pavel Pevzner, Statistical Significance of Cyclic Peptide Spectral Identifications, in preparation. To-ju Huang, Claudiu Farcas, Jeremy Carver, Natalie Castellana, Ari Frank, Sangtae Kim, Jian Wang, Xiaowen Liu, Pavel A. Pevzner, Vineet Bafna, Ingolf Krüger and Nuno Bandeira, ProteoSAFe: A Scalable, Accessible, and Flexible Software Environment for Proteomics Analysis, in preparation. Kyowon Jeong, Sangtae Kim and Nuno Bandeira, False Discovery Rates in Spectral Identification: a Target- decoy approach, submitted. Presentations Conference Oral Presentations Sangtae Kim and Pavel Pevzner, MS-GF+: Universal and Sensitive Database Search Engine for Mass Spectrometry, 60th American Society for Mass Spectrometry Conference (ASMS 2012), Vancouver, Canada, May Sangtae Kim and Pavel Pevzner, MS-GF+: Universal Database Search Engine for Mass Spectrometry, 8th Annual US HUPO (US-HUPO 2012), San Francisco, USA, Mar Applications for Database Searches of Tandem Mass Spectra, 14th International Conference on Research in Computational Molecular Biology (RECOMB 2010), Lisbon, Portugal, Aug
3 Sangtae Kim, Nuno Bandeira and Pavel Pevzner, Spectral Profiles: A Novel Representation of Tandem Mass Spectra and its Application for Gapped Peptide Generation, 57th American Society for Mass Spectrometry Conference (ASMS 2009), Philadelphia, USA, June Sangtae Kim, Nuno Bandeira and Pavel Pevzner, Spectral Profiles: A Novel Representation of Tandem Mass Spectra and its Applications for De Novo Peptide Sequencing and Identifications, 5th Annual US HUPO Conference (US-HUPO 2009), San Diego, USA, Feb Sangtae Kim, Nitin Gupta and Pavel Pevzner, Evaluating Statistical Significance of Peptide Identifications Using the Partition Function of Tandem Mass Spectra, HUPO 6th Annual World Congress, Seoul (HUPO 2007), Korea, Oct Tutorials Sangtae Kim, A Tour of MS-GF+: A Universal and Sensitive MS/MS Database Search, RECOMB Satellite Conference on Computational Mass Spectrometry (RECOMB-CP 2012), San Diego, USA, April Sangtae Kim, False Discovery Rate of Peptide Identifications: Target-Decoy Approach and Generating Function Approach, RECOMB Satellite Conference on Computational Mass Spectrometry (RECOMB-CP 2011), San Diego, USA, Mar Sangtae Kim, Assigning Statistical Significance to Peptide/Protein Identifications, RECOMB Satellite Conference on Computational Mass Spectrometry (RECOMB-CP 2010), San Diego, USA, Mar Invited Talks MS/MS identification tools with and without help of public data, ProteomeXchange 2 nd meeting, San Diego, USA, March MS-GF for High-Precision Mass Spectra, Pacific Northwest National Laboratory (PNNL), Richland, USA, Oct Generating Functions of Tandem Mass Spectra: Estimating Error Rates of Peptide Identifications and their Applications to Database Search, Korea Institute of Science & Technology (KIST), Seoul, Korea, June Bioinformatics: How to Apply Computer Algorithms to Solve Biological Problems?, Korea University, Seoul, Korea, June Conference Poster Presentations ASMS 2011, ASMS 2010, ASMS 2008, La Jolla Proteomics Conference 2008, UCSD Research Expo 2008, HUPO 2007, Algorithmic Biology 2006, HUPO 2005, ISMB 2005, HUPO 2004, ISMB 2004, RECOMB Teaching Experience Instructor Korea Military Academy, Seoul, Korea Introduction to Computers Programming Language (C) Computer Networks Teaching Assistant Molecular Sequence Analysis Aug Jun Mar Jun Sep Dec. 2000
4 Teaching Assistant and Engineering Automata Theory Professional Service Program Committee Member RECOMB Satellite Conference on Computational Proteomics (RECOMB-CP 2010), Mar International Workshop on Bio-inspired computing for Hybrid Information Technology (BHIT 2010), Dec Organizing Committee Chair RECOMB Satellite Conference on Computational Proteomics (RECOMB-CP 2012), Apr RECOMB Satellite Conference on Bioinformatics Education (RECOMB-BE 2010), May RECOMB Satellite Conference on Computational Proteomics (RECOMB-CP 2010), Mar Organizing Committee Member RECOMB Satellite Conference on Bioinformatics Education (RECOMB-BE 2009), Mar Reviewer Journal of Proteome Research Journal of Proteomics PLOS Computational Biology BMC Bioinformatics Bioinformatics Advances in Bioinformatics 15 th International Conference on Research in Computational Molecular Biology (RECOMB 2011) 10 th Workshop on Algorithms in Bioinformatics (WABI 2010) Honors & Awards Distinguished Graduate Student Scholarship, Chang-Hyun Foundation for Education, Merit-based Scholarship, Seoul National University, 1998, Admission Scholarship, Seoul National University, Reference Pavel Pevzner, Ph.D. Professor of Computer Science and Engineering (858) Vineet Bafna, Ph.D. Professor of Computer Science and Engineering (858)
5 Nuno Bandeira, Ph.D. Assistant Professor of Computer Science and Engineering, Skaggs School of Pharmacy and Pharmaceutical Sciences (858) Eunok Paek, Ph.D. Professor of Mechanical and Information Engineering University of Seoul +82 (2)
CRITICAL INSIGHT. Target-Decoy Approach and False Discovery Rate: When Things May Go Wrong
B American Society for Mass Spectrometry, 2011 J. Am. Soc. Mass Spectrom. (2011) 22:1111Y1120 DOI: 10.1007/s13361-011-0139-3 CRITICAL INSIGHT Target-Decoy Approach and False Discovery Rate: When Things
School of Management & Labor Relations, Rutgers University, Piscataway, NJ Assistant Professor, Human Resource Management
Han 1 JOO HUN HAN School of Management & Labor Relations Rutgers, The State University of New Jersey Janice H. Levin Building, Room 210 94 Rockafeller Road, Piscataway, NJ 08854 Tel: 848-445-9448 Fax:
UC San Diego UC San Diego Electronic Theses and Dissertations
UC San Diego UC San Diego Electronic Theses and Dissertations Title Protein Identification via Assembly of Tandem Mass Spectra Permalink https://escholarship.org/uc/item/5p61q5st Author Guthals, Adrian
R E S E A R C H I N T E R E S T. High-dimensional data, big data, machine learning, statistical genetics E D U C AT I O N
C h o n g W u A460 Mayo Building, MMC 303 420 Delaware St SE, Minneapolis, MN, 55455 : chongwu@umn.edu; : 612-516-2222 : http://wuchong.org R E S E A R C H I N T E R E S T High-dimensional data, big data,
Mochen Yang EDUCATION RESEARCH INTERESTS JOURNAL PUBLICATIONS PAPERS UNDER REVIEW
Mochen Yang PhD. Candidate, Carlson School of Management, University of Minnesota 4-365 Carlson School of Management, Minneapolis, MN, 55455 E-mail: yang3653@umn.edu Phone: 612-481-8074 Web: mochenyang.github.io
Alex Scott Purdue University, B.S., Industrial Engineering, West Lafayette, IN
Alex Scott Department of Supply Chain & Information Systems, Smeal College of Business Pennsylvania State University, University Park, PA 16802 alexscott@psu.edu; 312-350-5030 EDUCATION 2012 Present Ph.D.
EDUCATION. Graduate Certificate, Project Management Missouri University of Science and Technology, 2011
William L. Gillis III, PhD, PE, PMP, LEED AP, M.ASCE, M.ASHRAE Assistant Teaching Professor Civil, Architectural, and Environmental Engineering Missouri University of Science and Technology 333 Butler-Carlton
GAMZE ARMAN
September 2016 GAMZE ARMAN gamze.arman@mef.edu.tr EDUCATION 2016 DePaul University, Chicago, IL, USA Ph.D. in Industrial/Organizational Psychology Minor Degree Concentration in Communication Dissertation:
Curriculum Vitae Xinglin Lu
Curriculum Vitae Educational Background Ph.D. 2015. Municipal Engineering, Harbin Institute of Technology. Title of Ph.D. Dissertation: "Mechanisms and Control Strategies of Fouling Propensity and Reverse
CURRICULUM VITA. Jaeheum Yeon, Ph.D.
CURRICULUM VITA Jaeheum Yeon, Ph.D. Assistant Professor Construction Engineering Program Department of Engineering and Technology College of Science and Engineering Texas A&M University-Commerce Commerce,
GRADUATE AND POSTDOCTORAL STUDIES FINAL ORAL EXAMINATION
GRADUATE AND POSTDOCTORAL STUDIES MCGILL UNIVERSITY FINAL ORAL EXAMINATION FOR THE DEGREE OF DOCTOR OF PHILOSOPHY OF MOHAMED LEILA DEPARTMENT OF NATURAL RESOURCE SCIENCES SPATIAL AND TEMPORAL OPTIMIZATION
SSPPS STRATEGIC PLAN. Pharmacy Education, Pharmaceutical Sciences Research, Clinical Pharmacy Practice. April 30, Overview
SSPPS STRATEGIC PLAN Pharmacy Education, Pharmaceutical Sciences Research, Clinical Pharmacy Practice April 30, 2012 Overview Here we present the 2012-2017 strategic plan for the Skaggs School of Pharmacy
PI SERVER 2015 AND FUTURE DATA
PI SERVER 2015 AND FUTURE DATA Steve Kwan, Denis Vacher Tuesday, December 16, 2015 Agenda Why Future Data? What s PI Server 2015? + how to get the Beta version Demo! + sneak peek at PI Visualization 2015
Fast Multi-blind Modification Search through Tandem Mass Spectrometry* S
Fast Multi-blind Modification Search through Tandem Mass Spectrometry* S Seungjin Na, Nuno Bandeira **, and Eunok Paek Technological Innovation and Resources 2012 by The American Society for Biochemistry
STRATEGIC PLAN 17/04/2016. Powered by
STRATEGIC PLAN 17/04/2016 Powered by OUR PLAN "To be the leading language institute in Australia" Sophisticated Modern Passionate Supportive Active Community Focus Areas Redevelop learning centers: 3 centers
Chamber Temperature Measurement of Micro PCR Chip Using Thermocouple
Chamber Temperature Measurement of Micro PCR Chip Using Thermocouple Jong-Dae Kim 1,2, Chan-Young Park 1,2,*, Sang-Yoon Kim 2,3, Ok-Dong Gwak 3, Deuk- Joo Lee 2,3, Yu-Seop Kim 1,2 and Hye-Jung Song 1,2
About OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
Curriculum Vitae Bora Kwon 1051 Teaberry Lane A8, State College, PA
Curriculum Vitae Bora Kwon 1051 Teaberry Lane A8, State College, PA 16803 +1 814 321 3768 Email: bxk268@psu.edu Education Ph.D., The Pennsylvania State University, University Park, PA (August, 2017) Workforce
Bioinformatics Specialist
Bioinformatics Specialist At a Glance Bioinformatics specialists use their knowledge of computers and math to collect, analyze, and store biological data. Search by Cluster Computers & Telecom Science
PhD Dissertation Defense Presentation
PhD Dissertation Defense Presentation Wednesday, September 11 th, 2013 11:00am 1:00pm C103 Engineering Research Complex ADVANCED INVERTER CONTROL FOR UNINTERRUPTIBLE POWER SUPPLIES AND GRID-CONNECTED RENEWABLE
Bioinformatics 2. Lecture 1
Bioinformatics 2 Introduction Lecture 1 Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology
COMPUTATIONAL PROTEOMICS: HIGH-THROUGHPUT ANALYSIS FOR SYSTEMS BIOLOGY
COMPUTATIONAL PROTEOMICS: HIGH-THROUGHPUT ANALYSIS FOR SYSTEMS BIOLOGY WILLIAM CANNON Computational Biology & Bioinformatics, Pacific Northwest National Laboratory Richland, WA 99352 USA BOBBIE-JO WEBB-ROBERTSON
Alice Alipour CV - Page 1 of 5
Alice Azadeh Alipour, Ph.D., P.E. Assistant Professor Department of Civil and Environmental Engineering 234A Marston Hall, 130 Natural Resources Road University of Massachusetts Amherst, MA 01003-9293
Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know?
Lecture 1 Bioinformatics 2 Introduction Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology
Global Market Pulp Statistics
Global Market Pulp Statistics Bleached Kraft Pulp November Data 217 Global Statistics for Bleached Kraft Market Pulp The statistics in this file is based on EPIS (European Pulp Industry Sector) data, distributed
PRINCIPAL FIELDS OF INTEREST
NARI KIM, Ph.D. Assistant Specialist/ Lecturer, Strategy Area Paul Merage School of Business, University of California, Irvine SB2 #319, Irvine, CA 92617 Phone: (518) 488-8432 E-mail: narik1@uci.edu EDUCATION
Hee Man Park. The Ohio State University, Max M. Fisher College of Business Ph.D. in Management and Human Resources, 2017
ACADEMIC APPOINTMENT Hee Man Park School of Labor and Employment Relations The Pennsylvania State University 506D Keller Building University Park, PA, 16802 651-276-7802 hxp176@psu.edu The Pennsylvania
Institute of Industrial Relations fonds
Institute of Industrial Relations fonds Last revised November 2010 *** Institutional records -- researcher access subject to review *** University of British Columbia Archives Table of Contents Fonds Description
Curriculum Vitae Natalia Giugni Vidal. Anderson School of Management University of New Mexico 1924 Las Lomas NE Albuquerque, NM 87106
Curriculum Vitae Natalia Giugni Vidal Anderson School of Management University of New Mexico 1924 Las Lomas NE Albuquerque, NM 87106 T: 505-277-0332 nvidal@unm.edu EDUCATION PhD MSc BSc The University
Curriculum Vitae (June 2013) Zhiqing Zhou. Department of Psychology, University of South Florida Phone: /
Curriculum Vitae (June 2013) Zhiqing Zhou Department of Psychology, University of South Florida Phone: 813-335-5626/ Email: zhiqing@mail.usf.edu EDUCATION Ph.D. Industrial & Organizational Psychology,
Ishan G. Thakkar Curriculum Vitae
Ishan G. Thakkar Curriculum Vitae Work Address: Colorado State University, 1373 Campus Delivery, Fort Collins, CO 80523, USA Phone: (405) 778-0066 Email: ishan.thakkar@colostate.edu Website: www.engr.colostate.edu/~ishan9it
Elina Tang. Doctor of Philosophy, Marketing (2011) University of Missouri, Robert J. Trulaske Sr. College of Business Supporting Area: Statistics
Elina Tang 2208 University Hall, MC 243 College of Business Administration University of Illinois at Chicago 601 S. Morgan St. Chicago IL, 60607 Phone: (312) 996-5349 Fax: (312) 996-3559 Email: etang@uic.edu
COURSE LISTING. Courses Listed. with Business Intelligence (BI) Crystal Reports. 26 December 2017 (18:02 GMT)
with Business Intelligence (BI) Crystal Reports Courses Listed BOC345 - SAP Crystal Reports 2011: Optimizing Report Data Processing BOC320 - SAP Crystal Reports: - BOCE10 - SAP Crystal Reports for Enterprise:
Administration Division Public Works Department Anchorage: Performance. Value. Results.
Administration Division Anchorage: Performance. Value. Results. Mission Provide administrative, budgetary, fiscal, and personnel support to ensure departmental compliance with Municipal policies and procedures,
Advances in analytical biochemistry and systems biology: Proteomics
Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current
KURT B. WALDMAN 513 North Park Avenue, Bloomington, IN
KURT B. WALDMAN 513 North Park Avenue, Bloomington, IN 47408-3895 kbwaldma@iu.edu TEL. (607) 206-4364 CURRENT POSITION Research Fellow, Ostrom Workshop in Political Theory and Policy Analysis Indiana University,
MIN Z. CARTER. Master of Business Administration (December 2002) Troy State University, Troy, Alabama
MIN Z. CARTER EDUCATION Ph.D. in Management (December 2009) Auburn University, Auburn, Alabama Winner of the Distinguished Dissertation Award in the Social Sciences Category, Auburn University, 2010 Master
OMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions Omics International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
Artem Korobenko. Research Interests. Education. Scholarships, Honors and Awards. Curriculum Vitae
Artem Korobenko Curriculum Vitae Assistant Professor Phone: 864-650-6943 Department of Mechanical and Manufacturing Email: artem.korobenko@ucalgary.edu Engineering Website: www.korobenkocfsm.com University
Case Study. BiOWiSH Aqua has Positive Long-Term Effects. Biological Help for the Human Race
Case Study BiOWiSH Aqua has Positive Long-Term Effects After Two Years, Sustains Improved Effluent Quality in South Korean Slaughterhouse Executive Summary BiOWiSH Aqua was implemented in a South Korean
Supply Chain Management; Capacity and Inventory Planning; Electricity Markets; Healthcare Analytics.
ALEX ANGELUS Mays Business School Wehner Building Texas A&M University 4113 TAMU 210 Olsen Blvd College Station, Texas 77843 E-mail: aangelus@mays.tamu.edu http://mays.tamu.edu/directory/alex_angelus/
Monoclonal Antibody Characterization on Q Exactive and Oribtrap Elite. Yi Zhang, Ph.D Senior Proteomic Marketing Specialist Oct.
Monoclonal Antibody Characterization on Q Exactive and Oribtrap Elite Yi Zhang, Ph.D Senior Proteomic Marketing Specialist Oct. 12, 211 Outline Orbitrap Mass Spectrometer in mab Characterization Intact
La Ferle, Carrie and Kara Chan (2008), Determinants for Materialism Among Adolescents in Singapore, Young Consumers, Vol. 9 (3),
Carrie La Ferle, Ph.D. Associate Professor Temerlin Advertising Institute, Southern Methodist University 6101 Bishop Blvd., Suite 1120, Dallas, TX 75275 Office: 214-768-3378 // Email: laferle@smu.edu January
The Call Center Balanced Scorecard
The Call Center Balanced Scorecard Your Overall Measure of Call Center Performance! MetricNet Best Practices Series Some Common Call Center KPIs Cost Cost per Contact Cost per Minute of Handle Time Quality
Hyun Woo Chris Lee, Ph.D.
Hyun Woo Chris Lee, Ph.D. EDUCATION School of Civil and Construction Engineering Oregon State University hw.chris.lee@oregonstate.edu http://web.engr.oregonstate.edu/~leehyun/ 541.737.8539 office UNIVERSITY
COURSE LISTING. Courses Listed. with Customer Relationship Management (CRM) SAP CRM. 15 December 2017 (12:23 GMT)
with Customer Relationship Management (CRM) SAP CRM Courses Listed SAPCRM - Overview of the SAP CRM Solution CR100 - CRM Customizing Fundamentals CR500 - CRM Middleware CR580 - SAP CRM User Interface TCRM10
The Enterprise Project
The Enterprise Project Reporting & Analytics Environment Requirements Gathering September 2017 Requirements Collection BOT Executives Metrics Visioning Sessions, Existing Metrics & Strategic Direction
The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.
Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif
Faculty Development. Measures of Success and How to Attain Them
Measures of Success and How to Attain Them Kathy Griendling, PhD Professor of Medicine Vice Chair for Research and Faculty Development Assistant Dean for Faculty Development Why measure success? To fulfill
Molecular Pathology: The Molecular Basis of Human Disease William B. Coleman, Gregory J. Tsongalis
Molecular Pathology: The Molecular Basis of Human Disease William B. Coleman, Gregory J. Tsongalis 0080922198, 9780080922195 2009 Molecular Pathology: The Molecular Basis of Human Disease 664 pages Academic
Modification Site Localization Scoring Integrated into a Search Engine
Modification Site Localization Scoring Integrated into a Search Engine Peter R. Baker 1, Jonathan C. Trinidad 1, Katalin F. Medzihradszky 1, Alma L. Burlingame 1 and Robert J. Chalkley 1 1 Mass Spectrometry
Daniel Villanova Pamplin Hall Virginia Tech (828)
Daniel Villanova August 2017 2057 Pamplin Hall danielv4@vt.edu Virginia Tech (828) 964-6813 danielvillanova.com Education Ph.D. B.S.B.A. Marketing, Virginia Tech Minor: Statistics Advisor: Rajesh Bagchi
Current state of proteomics standardization and (C-)HPP data quality guidelines
9/6/2016 3 Department of Pharmacy Analytical Biochemistry Current state of proteomics standardization and (C-)HPP data quality guidelines DTL focus meeting on data integration, standards and fair principles
Teaching Occupational Health and Safety in Engineering Schools Best Practices, Support, and Opportunities. Graeme Norval Vic Pakalnis Tony Pasteris
Teaching Occupational Health and Safety in Engineering Schools Best Practices, Support, and Opportunities Graeme Norval Vic Pakalnis Tony Pasteris Background Injuries due to Workplace Accidents cost the
COURSE LISTING. Courses Listed. with SAP Ariba SAP Ariba Procurement. 4 February 2018 (03:51 GMT)
with SAP Ariba SAP Ariba Procurement Courses Listed AR510 - SAP Ariba Procurement: Buying AR510E - Ariba Procurement: Requisitioning to Receiving AR520 - SAP Ariba: Managing Contract Compliance AR520E
Elise Chandon Ince July 2017
Elise Chandon Ince July 2017 Office Address Department of Marketing Office: (803)-777-4784 1014 Greene Street Moore School of Business Columbia, SC 29208 Email: elise.ince@moore.sc.edu Education Ph.D.
New Specialty Crops for California
New Specialty Crops for California Mark Gaskell, Farm Advisor UC Cooperative Extension - Santa Maria UC Statewide Small Farm Program California Offers A Special Mix Diverse growing environments Large,
International Training Course on. Molecular biological techniques for research in agriculture and biomedical sciences
International Training Course on Molecular biological techniques for research in agriculture and biomedical sciences Jointly Organized by Government of India & Colombo Plan Secretariat O3 February 03 March,
CURRICULUM VITAE. 4. Sutley, E.J., J.W. van de Lindt, and L. Peek, (2016). Community-Level Framework for Seismic
CURRICULUM VITAE Elaina J. Sutley, Ph.D. Assistant Professor Department of Civil, Architectural, and Environmental Engineering University of Kansas, Lawrence, KS 66045 E-mail: enjsutley@ku.edu Website:
Challenges in Seoul Metropolitan for restoring urban water cycle
Challenges in Seoul Metropolitan for restoring urban water cycle Reeho Kim*, Seung Won Lee, Jung-hun Lee Daehee Lee, Muhammad Shafique Korea Institute of Civil Engineering and Building Technology 1 Table
Sheng (Monica) Wang. The Ohio State University Major Human Resource Management/Organizational Behavior Minor Quantitative Psychology
Sheng (Monica) Wang Department of Management, Entrepreneurship & Technology Lee Business School University of Nevada, Las Vegas 4505 Maryland Pkwy Box 456009 Las Vegas, NV 89154-6009 Phone: (702) 895-5394
CURRICURUM VITAE DAE HUN CHUNG, PH.D.
CURRICURUM VITAE DAE HUN CHUNG, PH.D. Principal Researcher 152 Gajeong-ro, Yuseong-gu, DaeJeonsi, Republic of Korea Korea Institute of Energy Research Tel: 42-860-3343 Email: cdh@kier.re.kr Website: http://kier.re.kr
CISC 436/636 Computational Biology &Bioinformatics (Fall 2016) Lecture 1
CISC 436/636 Computational Biology &Bioinformatics (Fall 2016) Lecture 1 Course Overview Li Liao Computer and Information Sciences University of Delaware Administrative stuff Webpage: http://www.cis.udel.edu/~lliao/cis636f16
Protein De novo Sequencing
Protein De novo Sequencing by Rong Wang A thesis presented to the University of Waterloo in fulfillment of the thesis requirement for the degree of Master of Mathematics in Computer Science Waterloo, Ontario,
Virtual Storage. Mark O Malley University College Dublin. Grid + Storage Workshop
Virtual Storage Multi-energy systems Mark O Malley mark.omalley@ucd.ie University College Dublin Grid + Storage Workshop Royal Academy of Engineers, London, March 15 th 2016 Outline Energy System Integration
Updated: July 1, 2014
James R. Van Scotter II Department of Marketing, Strategy, & International Business College of Business Administration University of Colorado Colorado Springs Dwire Hall Room 105 1420 Austin Bluffs Pkwy.
ZHOU, CAIZHI EDUCATION RESEARCH INTERESTS EXPERIENCE
ZHOU, CAIZHI Couch Assistant Professor of Materials Science & Engineering Department of Materials Science and Engineering Missouri University of Science and Technology B37 McNutt Hall, Rolla, MO 65409-0340
COURSE LISTING. Courses Listed. Training for Applications with Integration in SAP Business One. 27 November 2017 (07:09 GMT) Advanced
Training for Applications with Integration in SAP Business One Courses Listed Advanced TB1000 - SAP Business One - Logistics TB1100 - SAP Business One - Accounting TB1200 - SAP Business One - Implementation
QIAGEN Sample & Assay Technologies From Discovery to Patient
QIAGEN From Discovery to Patient New York, February 14 QIAGEN 2008 Analyst & Investor Day Peer Schatz, CEO -7- Forward Looking Statements Safe Harbor Statement: Certain of the statements contained in this
Microbiology and Molecular Genetics
University of California, Irvine 2017-2018 1 Microbiology and Molecular Genetics Rozanne M. Sandri-Goldin, Department Chair Klemens J. Hertel, Department Vice Chair Klemens J. Hertel, Departmental Graduate
RNA Secondary Structure Prediction
RNA Secondary Structure Prediction Outline 1) Introduction: RNA structure basics 2) Dynamic programming for RNA secondary structure prediction The Central Dogma of Molecular Biology DNA CCTGAGCCAACTATTGATGAA
Fabio Vandin. Education. Professional Appointments. Publications. Journals
Education Fabio Vandin Department of Computer Science, and Center for Computational Molecular Biology Brown University 115 Waterman St., 4th Floor, Providence, RI 02912 USA Mobile: +1-401-286-1402, Fax:
The Service Desk Balanced Scorecard
The Service Desk Balanced Scorecard Your Overall Measure of Service Desk Performance MetricNet Best Practices Series Your Speaker: Jeff Rumburg Co Founder and Managing Partner, MetricNet, LLC Winner of
Bioinformatics (Globex, Summer 2015) Lecture 1
Bioinformatics (Globex, Summer 2015) Lecture 1 Course Overview Li Liao Computer and Information Sciences University of Delaware Dela-where? 2 Administrative stuff Syllabus and tentative schedule Workload
Ph.D. in Marketing (and Digital Marketing), Cardiff Metropolitan University, UK
YLLKA AZEMI Indiana University Northwest School of Business and Economics, 3400 Broadway, Gary, IN 46408 (219) 980-6878; yazemi@iu.edu linkedin.com/in/yllka-azemi/ SUMMARY Teaching experience in numerous
The Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of:
4 Postdoctoral Fellow positions in microbiology, molecular biology and ecology The Institute of Microbiology of the Czech Academy of Sciences, Prague, Czech Republic The Institute of Microbiology of the
Tingting Yan. Associate Professor (with tenure) Department of Marketing & Supply Chain Management 317 Prentis Building
Tingting Yan Associate Professor (with tenure) Department of Marketing & Supply Chain Management 317 Prentis Building School of Business Administration 5201 Cass Avenue, Wayne State University Detroit,
Proteomics and Metabolomics Division NEWSLETTER
American Association for Clinical Chemistry Proteomics and Metabolomics Division NEWSLETTER Vol 8, No 1 December 2013 Message from the Chair: New beginnings, new frontiers Stephen R. Master, MD, Ph.D.,
The room was more than 3/4 full with greater than 150 people in attendance.
Summary The room was more than 3/4 full with greater than 150 people in attendance. The questions were well distributed across all four panelists. All the Panelists were very interactive and were able
Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006
Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006 Faculty Information: Dr. Nitya Jacob, Office: Room 104, Pierce Hall; Phone: 770-784-8346 Office Hours: T 9:30-10:30
EDUCATION Ph.D. Sustainability September 2007 May 2011
DR. ANNICK ANCTIL PH.D. ASSISTANT PROFESSOR CIVIL & ENVIRONMENTAL ENGINEERING ANCTILAN@MSU.EDU 1449 ENGINEERING RESEARCH CENTER - A132 EAST LANSING MI 48824 UNITED STATES EXPERTISE Life- cycle assessment
BIOLOGY. Bachelor of Science, Biology (BIO) minimum 120 hours
Biology BIOLOGY Majors: Bachelor of Science, Biology (p. ) Bachelor of Science, Environmental Biology (p. ) Minor: Biology (p. ) The Bachelor of Science program in biology is designed to prepare a student
Home address: No.255, Bina dead-end lane, Motahari street, Esfahan, Iran. Postal Code: Telephone No.:
Curriculum vitae: Name: Yahya Khazaie Nationality: Iranian Birth date: 04/30/1975 Birth place: Tehran, Iran Sex: Male Marital status: Married with one kid Name of Spouse: Afagh Nili Name of Daughter: Samin
Postdoctoral Research Associate, College of Business, University of Illinois, Urbana-Champaign
Daisung Jang Gies College of Business University of Illinois, Urbana-Champaign South Sixth Street Champaign, IL USA Phone: Email: daisung@illinois.edu l: http://www.daisungjang.com Current Position -current
Agilent University Course Catalog Edition Thailand
Agilent University Course Catalog 2018 Edition Thailand The value of lifetime learning Investments in continuous education improve laboratory staff productivity by uplifting knowledge and skills necessary
S. SELCUK ERENGUC Professor of Information Systems and Operations Management The University of Florida
S. SELCUK ERENGUC Professor of Information Systems and Operations Management The University of Florida EDUCATIONAL BACKGROUND B.B.A., American University of Beirut, June 1971 M.B.A., American University
Is the grass greener on the other side.? Academia to Industry Stephen B. Helliwell
Is the grass greener on the other side.? Academia to Industry Stephen B. Helliwell Senior Investigator, Novartis Institutes for BioMedical Research Is the grass greener? http://eatrio.net/2013/04/portuguese-idioms-joao-sem-braco.html
Spring Forecast Based Operations, Folsom Dam, California
Spring Forecast Based Operations, Folsom Dam, California Paul E. Pugner, P.E. Chief, Water Management Section Sacramento District U.S. Army 1325 J Street, Room 1126 Sacramento, CA 95814-2922 Tel: (916)
Thermo Scientific Proteomics & Metabolomics Seminar Tour
Proteomics & Seminar Tour Ignite your workflows with our with Cutting Edge LC-MS Technology Stop by to learn the latest advances in mass spectrometry workflows, technologies launched at 2012 ASMS and talk
Open Data Open Access to Scientific Data
Open Data Open Access to Scientific Data The perspective of a researcher Prof. Dr. Tom Coenye Tom.Coenye@UGent.be Open Data Shared Data Not necessarily the same! Data deposition (open/shared) Data available
Benjamin John Davis. Assistant Professor The Cooper Union for the Advancement of Science and Art (New York, NY)
Benjamin John Davis Associate Professor of Chemical Engineering The Cooper Union for the Advancement of Science and Art 41 Cooper Square New York, New York 10003 Telephone: (212) 353-4374 Cell: (310) 666-9459
Examination Assignments
Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN
Applied Blue Biotechnology Master
Applied Blue Biotechnology Master 1/8 Applied Blue Biotechnology Master Field : Sciences, Technologies, Santé Initial training Continuing training Block/release program 60 ECTS credits 2 semesters Course
We drum out your future!
BONUS: Once you ve qualified and registered as a Tourist Guide we ll place your details on our website for Tour Operators to find you! Mahala! Gratis! For Free! FULL WEEK TRAINING DATES CULTURE 2018 Course
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
! "#$$%& MY BLOG 2014
!"#%& 2014 =/*55&- 789:/4; RESOLUNTIONS!"# 20(5< SMART GOAL: GOAL: GOAL: GOAL: Often people set resolutions and don t look at them again after the month of January. One way to make sure that you are actively
LTQ Orbitrap XL Hybrid FT Mass Spectrometer Unrivaled Performance and Flexibility
m a s s s p e c t r o m e t r y LTQ Orbitrap XL Hybrid FT Mass Spectrometer Unrivaled Performance and Flexibility Part of Thermo Fisher Scientific LTQ Orbitrap XL OFFERING OUTSTANDING MASS ACCURACY, RESOLVING
The Brave New World of Measurement and Stability Periods
April 2016 CUPA NJ The Brave New World of Measurement and Stability Periods Elizabeth Patterson Managing Consultant NFP does not provide legal, tax or accounting consultation or advice. NFP has provided
Training Schedule January 2017 to February 2018
Schedule uary to February 2018 As training schedules are subject to change, please confirm dates with ENJO Consultants. ODETDP Level 5 National Certificate SAQA Qualification 5033 National Certificate:
How to view Results with Scaffold. Proteomics Shared Resource
How to view Results with Scaffold Proteomics Shared Resource Starting out Download Scaffold from http://www.proteomes oftware.com/proteom e_software_prod_sca ffold_download.html Follow installation instructions