Proteomics. Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Limitations: Examples

Size: px
Start display at page:

Download "Proteomics. Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Limitations: Examples"

Transcription

1 Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and formats protein immobilization fabrication Examples

2 Diagnostics: Areas of Application for Proteomics detection of antigens and antibodies in blood samples profiling of sera to discover new disease markers environment and food monitoring Protein expression profiling: organ and disease specific arrays Library screening: isolation of individual members from display libraries for further expression or manipulation selection of antibodies and protein scaffolds from phage or ribosome display libraries for use in capture arrays Protein functional analysis: ligand-binding properties of receptors enzyme activities protein-protein interactions antibody cross reactivity and specificity, epitope mapping Antibody Arrays Screening protein-protein interactions Studying protein posttranslational modifications Examining protein expression patterns Antibody Arrays The layout design of the BD Clontech Ab Microarray 380. The BD Clontech Ab Microarray 380 (#K1847-1) contains 378 monoclonal antibodies arrayed in a 32 x 24 grid. Each antibody is printed in duplicate. Dark gray dots at the corners represent Cy3/Cy5-labeled bovine serum albumin (BSA) spots, which serve as orientation markers. The open circles correspond to unlabeled BSA spots, which serve as negative controls. For complete descriptions of the proteins profiled by the Ab Microarray 380, visit bdbiosciences.com

3 Protein Activity Arrays Panomics Transcription Factor Arrays: A set of biotin-labeled DNA binding oligonucleotides (TranSignal probe mix) is preincubated with any nuclear extract of interest to allow the formation of protein/dna (or TF/DNA) complexes; The protein/dna complexes are separated from the free probes; The probes in the complexes are then extracted and hybridized to the TranSignal Array. Signals can be detected using either x-ray film or chemiluminescent imaging. All reagents for HRPbased chemiluminescent detection are included. Source: Panomics, Inc. Protein Activity Arrays Gel Shift Assay Protein Array Source: Panomics, Inc. Limitations, Challenges and Bottlenecks Protein production: cell-based expression systems for recombinant proteins purification from natural sources production in vitro by cell-free translation systems synthetic methods for peptides Immobilization surfaces and array formats: Common physical supports include glass slides, silicon, microwells, nitrocellulose or PVDF membranes, microbeads Protein immobilization should be: reproducible applicable to proteins of different properties (size, charge, ) amenable to high throughput and automation, and compatible with retention of fully functional protein activity such that maintains correct protein orientation Array fabrication: robotic contact printing ink-jetting piezoelectric spotting photolithography

4 2D Gel Electrophoresis + Mass Spectrometry 2D Gel Electrophoresis Protein Resolution Bandara & Kennedy (2002) 2D Gel Electrophoresis Protein Resolution Courtesy of Bio-Rad Courtesy of Bio-Rad Courtesy of Fermentas

5 2D Gel Electrophoresis Image Analysis Courtesy of Decodon Courtesy of Alphainnotech Bandara & Kennedy (2002) 2D Gel Electrophoresis Mass Spectrometry Source: UNC Proteomics Core Facility

6 Image courtesy of University of Arizona Proteomics Core SEQUEST is a program that uses raw peptide MS/MS data (off TSQ-7000 or LCQ) to identify unknown proteins. It works by searching protein and nucleotide databases (in FASTA format) on the web for peptides that match the molecular weight of the unknown peptides produced by digestion of your protein(s) of interest. Theoretical MS/MS spectra are then generated and a score is given to each one. The top 500 scored theoretical peptides are retained and a cross correlation analysis is then performed between the un-interpreted MS/MS spectra (real MS/MS spectra) of unknown peptides with each of the retained theoretical MS/MS spectra. Highly correlated spectra result in identification of the peptide sequences and multiple peptide identification and thus determine the protein and organism of origin corresponding to the unknown protein sample. Isotope Coded Affinity Tag (ICAT) Analysis Bandara & Kennedy (2002)

7 Perticoin et al., Toxicologic Pathology, 32(Suppl. 1): , 2004 SELDI Analysis Representative raw spectra and gel-view (grey-scale) of serum from a normal donor, and from patients with either BPH (benign prostate hyperplasia) or prostate cancer (PCA) using the IMAC3-Cu chip chemistry From: Courtesy CIPHERGEN The upregulated 11.9 kda biomarker from the TMPD-treated rats was searched via Tagldent (SWISS-PROT), yielding a tentative identity as parvalbumin-alpha. This candidate was subsequently purified, peptide mapped and searched to confirm the identity. Parvalbumin is involved in muscle homeostasis.

8 Limitations, Challenges and Bottlenecks Resolution: number of proteins that can be separated/distinguished (500,000?!?) pi resolution mass resolution (gels and mass spectrometry) Amount of the protein in the sample: too little to be seen on a 2D gel? too little to be extracted and digested? Protein solubility Database searching and peptide identification Bandara & Kennedy (2002) Schneider LV, Hall MP. Drug Discov Today :

9 Two-dimensional electrophoretic analysis of rat liver total proteins. The proteins were separated on a ph 3 10 nonlinear IPG strip (left), or ph 4-7 IPG strip (right), followed by a 10% SDS polyacrylamide gel. The gel was stained with Coomassie blue. The spots were analyzed by MALDI-MS. The proteins identified are designated with the accession numbers of the corresponding database. From Fountoulakis & Suter (2002) Two-dimensional electrophoretic analysis of rat liver cytosolic proteins. The proteins were separated on a ph 3 10 nonlinear IPG strip (left), or ph 5 6 IPG strip (right), followed by a 10% SDS polyacrylamide gel. The spots were analyzed by MALDI-MS. The proteins identified are designated with the accession numbers of the corresponding database. From Fountoulakis & Suter (2002) Summary of the 2-D gel electrophoresis data In total, 273 different gene products were identified from all gels: 65 gene products were only detected in the gels carrying total 52 in the gels carrying cytosolic remaining proteins were found in both samples 45 proteins out of the 62 found in the gels carrying total protein samples were detected in the broad ph range 3 10 gel, 11 in the narrow ph range and nine in both types of gels 52 proteins only detected in the gels carrying the cytosolic fraction, except for 6 which were found in the broad ph range 3 10 gel, were found in one of the narrow ph range gels only (narrow ph range strips helped to detect 46 proteins not found in the broad range gels) Protein distribution was based on the protein identification by mass spectrometry and may not be complete due to: spot loss during automatic excision peptide loss mainly from weak spots spot overlapping small protein size About 5000 spots were excised from 13 2-D gels, 5 carrying total and 8 carrying cytosolic proteins. The analysis resulted in the identification of about 3000 proteins, which were the products of 273 different genes From Fountoulakis & Suter (2002)

10 Summary of the 2-D gel electrophoresis data From Fountoulakis & Suter (2002) Animals: Male Wistar rats (10 12 weeks, bw: 225±8 g) Treatment: Bromobenzene (i.p., 5.0 mmol/kg bw) dissolved in corn oil (40% v/v) Duration of treatment: 24 hrs The bromobenzene dose was hepatotoxic, and this was confirmed by the finding of a nearly complete glutathione depletion at 24 hr after bromobenzene administration. The low level of oxidised (GSSG) relative to reduced glutathione (GSH) indicates that the depletion is primarily due to conjugation and to a much lesser extent due to oxidation of glutathione. The bromobenzene administration resulted in on average 7% decrease in body weight after 24 hr. From: Heijne et al. (2003)

11 Gene Expression Profiling Liver samples, total RNA (50 µg/array experiment) cdna microarrays (3000 genes) Reference sample: pooled RNA from liver (~50% w/w), kidneys, lungs, brain, thymus, testes, spleen, heart, and muscle of untreated Wistar rats Duplicated microarray/sample 2-Fold cutoff (p<0.01) relative to the vehicle control: 32 genes were found to be significantly upregulated and 17 were repressed following bromobenzene treatment 1.5-Fold cutoff (p<0.01) relative to the vehicle control: 63 genes were found to be significantly upregulated and 35 genes were repressed following bromobenzene treatment Functional groups: Drug metabolism Glutathione metabolism Oxidative stress Acute phase response Protein synthesis Protein degradation Others From: Heijne et al. (2003) Glutathione metabolism: Oxidative stress: From: Heijne et al. (2003) Acute phase response: From: Heijne et al. (2003) 11

12 Protein Expression Profiling 3 two-dimensional gels were prepared from each sample A reference protein pattern contained 1124 protein spots 24 proteins were differentially expressed (BB or Corn oil) From: Heijne et al. (2003)

Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples

Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and

More information

Advances in analytical biochemistry and systems biology: Proteomics

Advances in analytical biochemistry and systems biology: Proteomics Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current

More information

DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS. September, 2011

DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS. September, 2011 DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS September, 2011 1 CAPRION PROTEOMICS Leading proteomics-based service provider - Biomarker and target discovery

More information

2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM

2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM 2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc www.kendricklabs.com Talk Outline Significance Method description

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Electrophoresis and transfer

Electrophoresis and transfer Electrophoresis and transfer Electrophoresis Cation = positively charged ion, it moves toward the cathode (-) Anion = negatively charged ion, it moves toward the anode (+) Amphoteric substance = can have

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

Microarray Industry Products

Microarray Industry Products Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase

More information

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein

More information

Towards unbiased biomarker discovery

Towards unbiased biomarker discovery Towards unbiased biomarker discovery High-throughput molecular profiling technologies are routinely applied for biomarker discovery to make the drug discovery process more efficient and enable personalised

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Lecture 8: Affinity Chromatography-III

Lecture 8: Affinity Chromatography-III Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

BCH 462. Western Blot

BCH 462. Western Blot BCH 462 Western Blot Blotting Immunoassay: A test that uses antibody and antigen complexes [immuno-complexes] as a means of generating measurable results. Antigens [Ag]: A substance that when introduced

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes

More information

Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis

Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis 2D gel electrophoresis remains a dominant technique in proteomics. Obtaining high quality gels requires careful and tedious

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology

More information

Blot: a spot or stain, especially of ink on paper.

Blot: a spot or stain, especially of ink on paper. Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf

More information

Protein Microarrays?

Protein Microarrays? Protein Microarrays? Protein Chemistry/Proteomics Unit and the Neuroscience Program,Biomedicum Helsinki E-Mail: marc.baumann@helsinki.fi (http://research.med.helsinki.fi/corefacilities/proteinchem) What

More information

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc. The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration

More information

ProteoMiner Protein Enrichment Technology

ProteoMiner Protein Enrichment Technology Sample Preparation ProteoMiner Protein Enrichment Technology Digging Deeper in the Proteome Detect More Proteins With ProteoMiner Technology Than With Immunodepletion ProteoMiner Technology vs. an Agilent

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

KPL LumiGLO Reserve Chemiluminescent Substrate

KPL LumiGLO Reserve Chemiluminescent Substrate DESCRIPTION KPL LumiGLO Reserve contains a luminol-based chemiluminescent substrate designed for use with peroxidase-labeled (HRP) reporter molecules. KPL LumiGLO Reserve offers improvements in the way

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

Tech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count

Tech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from

More information

special offers from your protein biology resource

special offers from your protein biology resource special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research

More information

TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics

TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics INTRODUCTION The development of renewable capture reagents

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Genome Biology and Biotechnology

Genome Biology and Biotechnology Genome Biology and Biotechnology 10. The proteome Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course

More information

Optimization of 2D Gel Transblotting for Host Cell Protein Analysis

Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Jon Johansen, Matt Hoelter & Nancy Kendrick* Kendrick Labs Inc, Madison, WI www.kendricklabs.com Talk Outline Biologic drugs, recombinant

More information

Proteomics. Proteomics is the study of all proteins within organism. Challenges

Proteomics. Proteomics is the study of all proteins within organism. Challenges Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog

More information

Amersham * ECL * Gel horizontal electrophoresis system

Amersham * ECL * Gel horizontal electrophoresis system GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis)

KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) SignaLOCK HRP ChemiWestern Kit (Film) Catalog No. 54-53-00 SignaLOCK HRP ChemiWestern Kit (Imager) Catalog No. 54-54-00 SignaLOCK AP ChemiWestern

More information

Exam MOL3007 Functional Genomics

Exam MOL3007 Functional Genomics Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting

More information

Quiz Submissions Quiz 4

Quiz Submissions Quiz 4 Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Optiblot. Western Blot Reagents and Troubleshooting Tips. Discover more at abcam.com/optiblot

Optiblot. Western Blot Reagents and Troubleshooting Tips. Discover more at abcam.com/optiblot 432_12_GM Optiblot booklet02_layout 1 28/08/2012 15:14 Page 1 Optiblot Western Blot Reagents and Troubleshooting Tips High quality protein electrophoresis and western blot reagents Our Optiblot range of

More information

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

Intracellular receptors specify complex patterns of gene expression that are cell and gene

Intracellular receptors specify complex patterns of gene expression that are cell and gene SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For

More information

Azure Biosystems Western Blotting Workflow

Azure Biosystems Western Blotting Workflow Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for

More information

Chapter 10 Analytical Biotechnology and the Human Genome

Chapter 10 Analytical Biotechnology and the Human Genome Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based

More information

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing

More information

Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium

Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium Ulrika Meyer a, Hanna Wlad a, Sven Blokland b, Frank J.M. Detmers b and Henrik Ihre a a GE Healthcare Bio-Sciences

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Module I: Introduction

Module I: Introduction Module I: Introduction 20.109 Lecture 1 3 February, 2011 Introduction to: Module Overview Fundamental concepts and techniques in molecular biology Appreciating nucleic acids (RNA in particular) as more

More information

Purification of Lactate Dehydrogenase

Purification of Lactate Dehydrogenase Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase

More information

Optiblot ECL Ultra Detect Kit (1.2pg 2ng)

Optiblot ECL Ultra Detect Kit (1.2pg 2ng) ab133409 Optiblot ECL Ultra Detect Kit (1.2pg 2ng) Instructions for Use For enhanced chemiluminescent Western blotting. This product is for research use only and is not intended for diagnostic use. 1 Table

More information

Supplementary Figure 1. Utilization of publicly available antibodies in different applications.

Supplementary Figure 1. Utilization of publicly available antibodies in different applications. Supplementary Figure 1 Utilization of publicly available antibodies in different applications. The fraction of publicly available antibodies toward human protein targets is shown with data for the following

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography

More information

Make Your Immunology Research Easy. Kun YIN Associate Director of Marketing Division, GenScript

Make Your Immunology Research Easy. Kun YIN Associate Director of Marketing Division, GenScript Make Your Immunology Research Easy Kun YIN Associate Director of Marketing Division, GenScript GenScript Overview Branch Office Amsterdam, Netherlands Branch Office Tokyo, Japan Headquarter, New Jersey,

More information

Exam 2 BIO200, Winter 2012

Exam 2 BIO200, Winter 2012 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide

More information

TECHNIQUES USED IN GENETIC ENGINEERING 1

TECHNIQUES USED IN GENETIC ENGINEERING 1 TECHNIQUES USED IN GENETIC ENGINEERING 1 ELECTROFORESIS BLOTTING Uses of DNA Profiling DNA profiling is used to solve crimes and medical problems Crime The DNA profile of each individual is highly specific.

More information

Investigation of a Mammalian Cellular Model for Differential Protein Expression Analysis Using 1D PAGE and Cleavable ICAT Reagents

Investigation of a Mammalian Cellular Model for Differential Protein Expression Analysis Using 1D PAGE and Cleavable ICAT Reagents pplication Note 1D PGE and Cleavable ICT Reagents Investigation of a Mammalian Cellular Model for Differential Protein Expression nalysis Using 1D PGE and Cleavable ICT Reagents Overview The use of two-dimensional

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

including, but not limited to:

including, but not limited to: *This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not

More information

Application of Biacore Technology

Application of Biacore Technology Principles and typical results Application of Biacore Technology Common types of Biacore analyses Specificity analysis Is my molecule of interest specific for its target? Multiple binding analysis In which

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

Western Blotting Detection Reagents

Western Blotting Detection Reagents Electrophoresis Western Blotting Detection Reagents Maximize Western Blot Detection Solutions for Any Blotting Application Choose the Best Approach for Your Needs When it comes to western blot detection,

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

ELISPOT and FLUOROSPOT kits

ELISPOT and FLUOROSPOT kits ELISPOT and FLUOROSPOT kits Interleukins Interferons Granzymes and perforins TNF superfamily ligands and receptors Apoptosis markers And many more... ELISPOT and FLUOROSPOT: a cell-based assay to assess

More information

SPHERO TM Coated Particles

SPHERO TM Coated Particles SPHERO TM Coated Particles Manufactured by either passive adsorption or covalent coupling depending upon the intended application Stable for several years under proper storage condition Available in a

More information

Rat IGF-1 ELISA Kit (rigf-1-elisa)

Rat IGF-1 ELISA Kit (rigf-1-elisa) Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar

More information

Top down proteomics approaches: (a) to monitor protein purification; (b) to resolve PTM isoforms and protein complexes

Top down proteomics approaches: (a) to monitor protein purification; (b) to resolve PTM isoforms and protein complexes Top down proteomics approaches: (a) to monitor protein purification; (b) to resolve PTM isoforms and protein complexes Jan 11, 2013 BMG744 Helen Kim Department of Pharmacology and Toxicology Targeted Metabolomics

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

6. GENE EXPRESSION ANALYSIS MICROARRAYS

6. GENE EXPRESSION ANALYSIS MICROARRAYS 6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

WakoPureChemical. No WakoPURE system Quick-CBB PLUS Silver Stain MS Kit Negative Gel Stain MS Kit Matrix for MALDI-TOFMS BAMBANKER

WakoPureChemical. No WakoPURE system Quick-CBB PLUS Silver Stain MS Kit Negative Gel Stain MS Kit Matrix for MALDI-TOFMS BAMBANKER WakoPureChemical W P roduct U pdate Protein Research Cell Culture Silver Stain MS Kit Negative Gel Stain MS Kit Matrix for MALDI-TOFMS BAMBANKER No.0 004 Index Protein Research. in vitro Protein-Synthesizing

More information

SUMOstar Gene Fusion Technology

SUMOstar Gene Fusion Technology Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes? 2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics

More information

Antibody Services from GenScript

Antibody Services from GenScript Services from GenScript www.genscript.com GenScript USA Inc. 860 Centennial Ave., Piscataway, NJ 08854 USA Toll-Free: 1-877-436-7274 Fax: 1-732-210-0262 1-732-855-5878 Academic Services Pharmaceutical

More information

Mouse Factor XII Total ELISA Kit

Mouse Factor XII Total ELISA Kit Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII

More information

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400

More information

Strep-tag detection in Western blots

Strep-tag detection in Western blots Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important

More information

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects

More information

Expression Array System

Expression Array System Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The

More information

Practical Applications of Immunology (Chapter 18) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Eastern Campus

Practical Applications of Immunology (Chapter 18) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Eastern Campus Practical Applications of Immunology (Chapter 18) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Eastern Campus Primary Source for figures and content: Tortora, G.J. Microbiology

More information