BIOLOGY. Gene Expression. Gene to Protein. Protein Synthesis Overview. The process in which the information coded in DNA is used to make proteins
|
|
- Robert Norris
- 6 years ago
- Views:
Transcription
1 17 CAMPBLL BIOLOGY TNTH DITION Reece Urry Cain Wasserman Minorsky Jackson Gene to Protein Gene xpression The process in which the information coded in is used to make proteins A gene is the part of the molecule that codes for a specific protein Lecture Presentation by Dr Burns NVC Biol 120 Gene expression, the process by which directs protein synthesis, includes two stages: transcription and translation Copyright 2014 Pearson 2009 ducation, Pearson ducation, Inc. Inc. Figure 17.1 Protein Synthesis Overview Remember back to the lecture on the cell we briefly went through the steps of protein synthesis 1
2 What structure assembles the polypeptide chains? 1. Nucleus 2. Rough ndoplasmic reticulum 3. Ribosomes 4. Lysosomes Nucleus 25% 25% 25% 25% Rough ndoplasmic... Ribosomes Lysosomes The Nature of Genes The central dogma of molecular biology states that information flows in one direction: RNA protein Transcription is the flow of information from to RNA. Translation is the flow of information from RNA to protein. 1.Transcription: unwinds and nucleotides form base pairs to produce a single strand of 2. leaves nucleus 3. Translation: docks with ribosomes. trna brings amino acids to the ribosome to be assembled into polypeptide RNA During the transcription: part of is copied to make is only a single strand remember that is two strands. RNA has same handrail structure with the phosphates covalently bound to the sugars. The sugars are bound covalently to bases 2
3 Differences between RNA and 1. RNA is single stranded, is double stranded 2. The sugar is different = ribose 3. RNA has four bases, but one base is different from : CGAU, the U is uracil During transcription uracil is paired with adenine Types of RNA There are different types of RNA: Messenger RNA () single strand, carries information for making a protein from the nucleus to the cytosol Transfer RNA (trna) single strand, folds back on itself. ach trna carries one specific amino acid and brings it to the ribosome Ribosomal RNA (rrna) globular structure, forms the catalytic part of ribosomes. Catalyzes the formation of the peptide bonds between amino acids Types of RNA volution of the Genetic Code There are different types of RNA: small nuclear RNA (snrna) are involved in processing pre-, involved in splicing signal recognition particle (SRP) is composed of protein and RNA and involved in directing ribosome to the RR micro-rna (mirna) are very small and their role is not clear yet, control gene expression, protect cells from viral attack The genetic code is nearly universal, shared by the simplest bacteria to the most complex animals Genes can be transcribed and translated after being transplanted from one species to another Figure 17.6 Figure 17.4 template strand A C C A A A C C G A G T molecule T G G T T T G G C T C A TRANSCRIPTION U G G U U U G G C U C A Codon TRANSLATION Gene 1 Gene 2 (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene Protein Trp Phe Gly Amino acid Ser Gene 3 3
4 Molecular Components of Transcription Coding strand Transcription RNA synthesis is catalyzed by RNA polymerase, which pries the strands apart and hooks together the RNA nucleotides (complementary copy of template strand) Polypeptide Codon 1 Codon 2 Codon 3 Codon 4 Codon 5 Codon 6 Translation Template strand The RNA is complementary to the template strand RNA synthesis follows the same base-pairing rules as, except that uracil substitutes for thymine Transcription The sequence where RNA polymerase attaches is called the promoter The stretch of that is transcribed is called a transcription unit Transcription RNA polymerase act in a similar manner as polymerase Build the RNA molecule from 5 end of the RNA to the 3 end Nucleotides are added to build the complementary RNA strand, use the hydrolysis of phosphates to provide the energy to build the new strand RNA is antiparallel to Transcription Figure Promoter Transcription unit Start point RNA polymerase Upstream Template strand: 3 -A-C-C-A-5 Coding strand: 5 -T-G-G-T-3 RNA 5 -U-G-G-U-3 Downstream 4
5 Figure Promoter Transcription unit Figure Promoter Transcription unit Start point RNA polymerase 1 Initiation Start point RNA polymerase 1 Initiation Unwound Coding (Nontemplate) strand of Template strand of RNA transcript Unwound Rewound RNA transcript Coding (Nontemplate) strand of Template strand of RNA transcript 2 longation Figure Promoter Transcription unit Start point RNA polymerase 1 Initiation Unwound Rewound RNA transcript Nontemplate strand of Template strand of RNA transcript 2 longation 3 Termination Completed RNA transcript Direction of transcription ( downstream ) Which strand is copied to make RNA? 1. Coding 2. Template 50% 50% Animation: Transcription Right-click slide / select Play 1 2 Copyright 2009 Pearson ducation, Inc. 5
6 Transcription scription/index.htm Transcription RNA polymerase binds to a promoter region of the = initiation stage The RNA polymerase acts to bind nucleotides bound together to form the complementary RNA strand = elongation stage The RNA polymerase continues to add nucleotides until it comes to a stop signal, a set of three nucleotides on the that signals the end = termination stage Copyright 2009 Pearson ducation, Inc. RNA Polymerase Binding and Initiation of Transcription Promoters signal the transcriptional start point and usually extend several dozen nucleotide pairs upstream of the start point Transcription factors mediate the binding of RNA polymerase and the initiation of transcription The completed assembly of transcription factors and RNA polymerase II bound to a promoter is called a transcription initiation complex A promoter called a TATA box is crucial in forming the initiation complex in eukaryotes Figure 17.8 TA A T TATA box Transcription factors RNA polymerase II T A A A A A T T T T Promoter 1 A eukaryotic promoter Start point Nontemplate strand 2 Several transcription factors bind to 3 Transcription initiation complex forms Template strand Transcription factors RNA transcript Transcription initiation complex longation of the RNA Strand Figure 17.9 Nontemplate strand of RNA nucleotides As RNA polymerase moves along the, it untwists the double helix, 10 to 20 bases at a time RNA polymerase C A T C C A A end Transcription progresses at a rate of 40 nucleotides per second in eukaryotes C A U C C A T A G G T T Nucleotides are added to the end of the growing RNA molecule Direction of transcription Template strand of Newly made RNA 6
7 If the sequence was 3 -ATCG-5 then the complementary sequence would be: TAGC TACG UAGC UAGC-3 25% 25% 25% 25% Termination of Transcription The mechanisms of termination are different in bacteria and eukaryotes In bacteria, the polymerase stops transcription at the end of the terminator and the can be translated without further modification In eukaryotes, RNA polymerase II transcribes the polyadenylation signal sequence; the RNA transcript is released nucleotides past this polyadenylation sequence Figure Protein synthesis in Prokaryotes In bacteria the transcription and translation steps are coupled G P P P Cap UTR Protein-coding segment Start codon codon Polyadenylation signal AAUAAA UTR AAA AAA Poly-A tail Remember that there is no nucleus so the does not leave the nucleus to go to the cytosol to bind with the ribosomes The bacterial is not modified after it is transcribed, it is used immediately after transcription Figure 17.3 ukaryotic cells modify RNA after transcription TRANSCRIPTION TRANSLATION (a) Bacterial cell Polypeptide Ribosome TRANSCRIPTION RNA PROCSSING TRANSLATION (b) ukaryotic cell Pre- Ribosome Polypeptide Nuclear envelope nzymes in the eukaryotic nucleus modify pre (RNA processing) before the genetic messages are dispatched to the cytoplasm During RNA processing, both ends of the primary transcript are usually altered Also, usually some interior parts of the molecule are cut out, and the other parts spliced together 7
8 Post transcriptional modifications of ach end of a pre- molecule is modified in a particular way The end receives a modified nucleotide cap The end gets a poly-a tail These modifications share several functions They seem to facilitate the export of to the cytoplasm They protect from hydrolytic enzymes They help ribosomes attach to the end Figure Post transcriptional modification - RNA Splicing G P P P Cap UTR Protein-coding segment Start codon codon Polyadenylation signal AAUAAA UTR AAA AAA Poly-A tail The contains regions that do not code for amino acids that are found between coding regions Areas of the gene that are noncoding = introns Coding areas of the gene = exons RNA splicing removes introns and joins exons, creating an molecule with a continuous coding sequence Figure Pre- Codon numbers xon Intron xon Cap Intron Introns cut out and exons spliced together xon Poly-A tail Cap UTR Coding segment Poly-A tail UTR 8
9 The Functional and volutionary Importance of Introns Fig Some introns contain sequences that may regulate gene expression Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during splicing This is called alternative RNA splicing Consequently, the number of different proteins an organism can produce is much greater than its number of genes RNA splicing In some cases, RNA splicing is carried out by spliceosomes Spliceosomes consist of a variety of proteins and small nuclear RNA (snrna) 9
10 Ribozymes Ribozymes are catalytic RNA molecules that function as enzymes and can splice RNA The discovery of ribozymes rendered obsolete the belief that all biological catalysts were proteins modifications aprocessing/index.htm Translation is the RNA-directed synthesis of a polypeptide: a closer look Genetic information flows from to protein through the process of translation Copyright 2009 Pearson ducation, Inc. Translation Codons slation/index.htm Three bases code for one amino acid The three bases together are called a codon So when CCU are next to each other as a codon then that will be read as proline 10
11 First base ( end of codon) Third base ( end of codon) Figure 17.5 Second base U C A G UUU UCU UAU UGU U Phe Tyr Cys UUC U UCC Ser UAC UGC C UUA UCA Leu UAA UGA A UUG UCG UAG UGG Trp G CUU CUC C CUA CUG CCU CCC Leu CCA CCG CAU CAC Pro CAA CAG CGU His CGC CGA Gln CGG U C Arg A G AUU ACU AAU AGU Asn AUC A Ile ACC AAC Thr AGC AUA ACA AAA AGA Lys AUG Met or start ACG AAG AGG U Ser C A Arg G GUU GUC G GUA GUG Val GCU GCC GCA GCG GAU GAC Ala GAA GAG GGU Asp GGC GGA Glu GGG U C Gly A G Molecular Components of Translation A cell translates an message into protein with the help of transfer RNA (trna) trnas transfer amino acids to the growing polypeptide in a ribosome trna codes for which amino acids go in what order, also copied to make trna trna (transfer RNA) brings the amino acids to the ribosomes One side of trna attaches to an amino acid, the other side will attach to the trna Figure ach trna is covalently bound to an amino acid trna molecules have an anticodon region = complementary to the region Polypeptide Ribosome Amino acids trna with amino acid attached trna C G Anticodon U G G U U U G G C Codons 11
12 The Structure and Function of Transfer RNA Molecules of trna are not identical ach carries a specific amino acid on one end ach has an anticodon on the other end; the anticodon base-pairs with a complementary codon on BioFlix: Protein Synthesis The Structure and Function of Transfer RNA A trna molecule consists of a single RNA strand that is only about 80 nucleotides long Figure Amino acid attachment site Amino acid attachment site Hydrogen bonds Hydrogen bonds Anticodon (a) Two-dimensional structure Anticodon (b) Three-dimensional structure A A G Anticodon (c) Symbol used in this book The Structure and Function of Transfer RNA Because of hydrogen bonds, trna actually twists and folds into a three-dimensional molecule trna is roughly L-shaped Translation Accurate translation requires two steps First: a correct match between a trna and an amino acid, done by the enzyme aminoacyltrna synthetase Second: a correct match between the trna anticodon and an codon 12
13 Translation Figure Aminoacyl-tRNA synthetase (enzyme) Amino acid Flexible pairing at the third base of a codon is called wobble and allows some trnas to bind to more than one codon P P P Adenosine ATP Figure Aminoacyl-tRNA synthetase (enzyme) Figure Aminoacyl-tRNA synthetase (enzyme) Amino acid Amino acid P Adenosine P Adenosine P P P Adenosine ATP P P i P i P i P P P Adenosine ATP P P i P i P i trna Aminoacyl-tRNA synthetase trna Amino acid P Adenosine AMP Computer model Figure Aminoacyl-tRNA synthetase (enzyme) Ribosomes Amino acid P P P Adenosine ATP P Adenosine P P i P i P i trna Aminoacyl-tRNA synthetase Ribosomes facilitate specific coupling of trna anticodons with codons in protein synthesis trna P Adenosine Amino acid The two ribosomal subunits (large and small) are made of proteins and ribosomal RNA (rrna) AMP Computer model Aminoacyl trna ( charged trna ) 13
14 Ribosomes Bacterial and eukaryotic ribosomes are somewhat similar but have significant differences Some antibiotic drugs specifically target bacterial ribosomes without harming eukaryotic ribosomes Figure 17.17a trna molecules Growing polypeptide P A xit tunnel Large subunit Small subunit (a) Computer model of functioning ribosome Figure 17.17b Figure 17.17c P site (Peptidyl-tRNA binding site) site (xit site) xit tunnel A site (AminoacyltRNA binding site) Amino end Growing polypeptide Next amino acid to be added to polypeptide chain P A Large subunit trna binding site Small subunit Codons (b) Schematic model showing binding sites (c) Schematic model with and trna Ribosomes Building a Polypeptide A ribosome has three binding sites for trna The P site holds the trna that carries the growing polypeptide chain The A site holds the trna that carries the next amino acid to be added to the chain The site is the exit site, where discharged trnas leave the ribosome The three stages of translation Initiation longation Termination All three stages require protein factors that aid in the translation process 14
15 Ribosome Association and Initiation of Translation The initiation stage of translation brings together, a trna with the first amino acid, and the two ribosomal subunits Ribosome Association and Initiation of Translation First, a small ribosomal subunit binds with and a special initiator trna (carrying the amino acid methionine) Then the small subunit moves along the until it reaches the start codon (AUG) Proteins called initiation factors bring in the large subunit that completes the translation initiation complex Figure longation of the Polypeptide Chain Initiator trna Start codon binding site U A C A U G GTP Small ribosomal subunit P i GDP P site A Large ribosomal subunit Translation initiation complex During the elongation stage, amino acids are added one by one to the preceding amino acid at the C-terminus of the growing chain ach addition involves proteins called elongation factors and occurs in three steps: codon recognition, peptide bond formation, and translocation Translation proceeds along the in a 5 to 3 direction Figure Amino end of polypeptide Figure Amino end of polypeptide P site A site P site A site GTP GDP P i P A 15
16 Figure Amino end of polypeptide Figure Amino end of polypeptide P site A site GTP Ribosome ready for next aminoacyl trna P site A site GTP GDP P i GDP P i P A P A P A GDP P i GTP P A P A Protein Synthesis Fig Protein synthesis proceeds from the N- terminus to the C-terminus of the protein. The ribosomes "read" the in the 5' to 3' direction. /MBWeb/mb2/part1/translate.htm Factory-Reveals-Secrets.html Created by Dr. Joachim Frank 16
17 Termination of Translation Termination occurs when a stop codon in the reaches the A site of the ribosome The A site accepts a protein called a release factor The release factor causes the addition of a water molecule instead of an amino acid This reaction releases the polypeptide, and the translation assembly then comes apart Animation: Translation Right-click slide / select Play Figure Figure Release factor Release factor Free polypeptide 2 GTP codon (UAG, UAA, or UGA) codon (UAG, UAA, or UGA) 2 GDP 2 P i Figure Initiation Release factor codon (UAG, UAA, or UGA) Free polypeptide 2 GTP 2 GDP 2 P i 1. The binds with the small subunit of the ribosome 2. The beginning of the coding region of is AUG 3. The trna with the anticodon UAC has methionine attached to it. 4. The trna with met attached binds to the P site of the ribosomes. 5. This requires energy in the form of GTP 6. Large subunit joins the small subunit 17
18 longation This is the stage where amino acids are added to the growing polypeptide chain 7. A trna with the next amino acid comes into the A site, requires GTP for energy 8. The amino acids are bound by a peptide bond 9. The bond is between the carboxyl end of the P site amino acid and the amino side of the A amino acid longation 10. The now ribosome moves so the free trna is at the site and the trna with the polypeptide chain moves is at the P site = translocation 11. This requires GTP 12. The free trna exits the ribosome Termination 13. The end of the coding region will have a stop codon that signals the end of the polypeptide chain 14. No trna binds to this codon, instead a release factor binds, requires GTP for energy What molecules are produced in transcription? 1. Amino acids 2. Proteins 3. RNA 4. 25% 25% 25% 25% 15. The polypeptide chain is released Amino acids Proteins RNA Polyribosomes Figure Growing polypeptides Completed polypeptide A number of ribosomes can translate a single simultaneously, forming a polyribosome (or polysome) Incoming ribosomal subunits (a) Start of ( end) nd of ( end) Polyribosomes enable a cell to make many copies of a polypeptide very quickly Ribosomes (b) 0.1 m 18
19 Completing and Targeting the Functional Protein Often translation is not sufficient to make a functional protein Polypeptide chains are modified after translation or targeted to specific sites in the cell Protein Folding and Post-Translational Modifications During and after synthesis, a polypeptide chain spontaneously coils and folds into its threedimensional shape Proteins may also require post-translational modifications before doing their job Some polypeptides are activated by enzymes that cleave them Other polypeptides come together to form the subunits of a protein Post-translational Modifications Folding, either spontaneously or with the aid of chaperone proteins Proteolysis some polypeptide chains are cut into smaller chains Glycosylation sugars are added to some proteins, some of these sugar chains are important to address the protein Phosphorylation Protein Kinases phosphorylate proteins to activate them Methionine is often removed Targeting Polypeptides to Specific Locations Two populations of ribosomes are evident in cells: free ribsomes (in the cytosol) and bound ribosomes (attached to the R) Free ribosomes mostly synthesize proteins that function in the cytosol Bound ribosomes make proteins of the endomembrane system and proteins that are secreted from the cell Ribosomes are identical and can switch from free to bound Targeting Polypeptides to Specific Locations Polypeptide synthesis always begins in the cytosol Synthesis finishes in the cytosol unless the polypeptide signals the ribosome to attach to the R Polypeptides destined for the R or for secretion are marked by a signal peptide Targeting Polypeptide Chains Polypeptide chains that need to be brought into the RR will start (after MT) with a short sequence of amino acids = signal sequence signal recognition particles (SRPs), in the cytoplasm recognize this sequence during translation and bind to the amino acid sequence. 19
20 Targeting Polypeptides to Specific Locations A signal-recognition particle (SRP) binds to the signal peptide The SRP brings the signal peptide and its ribosome to the R Signal recognition particle (SRP) is composed of protein and RNA Targeting Polypeptide Chains The signal sequence and SRP complex binds to a receptor on the RR membrane The complex docks with the RR As the polypeptide chain is built, the chain is brought into the RR Once inside the RR the polypeptide chain can be folded, modified Then the protein is transported via a vesicle to the Golgi Figure Mutations of one or a few nucleotides can affect protein structure and function 1 SRP R LUMN Ribosome Signal peptide 2 SRP receptor protein Translocation complex 3 4 Signal peptide removed 5 R membrane Protein 6 CYTOSOL Mutations are changes in the genetic material of a cell or virus Point mutations are chemical changes in just one base pair of a gene The change of a single nucleotide in a template strand can lead to the production of an abnormal protein Figure Types of Small-Scale Mutations Wild-type hemoglobin Wild-type hemoglobin C T T G A A G A A Sickle-cell hemoglobin Mutant hemoglobin C A T G T A G U A Point mutations within a gene can be divided into two general categories Nucleotide-pair substitutions One or more nucleotide-pair insertions or deletions Normal hemoglobin Glu Sickle-cell hemoglobin Val 20
21 Substitutions A nucleotide-pair substitution replaces one nucleotide and its partner with another pair of nucleotides Silent mutations have no effect on the amino acid produced by a codon because of redundancy in the genetic code Missense mutations still code for an amino acid, but not the correct amino acid Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein Figure Wild type template strand T A C T T C A A A C C G A T T A T G A A G T T T G G C T A A A U G A A G U U U G G C U A A Protein Met Lys Phe Gly Amino end Carboxyl end (a) Nucleotide-pair substitution (b) Nucleotide-pair insertion or deletion A instead of G xtra A T A C T T C A A A C C A A T T T A C A T T C A A A C C G A T T A T G A A G T T T G G T T A A A T G T A A G T T T G G C T A A U instead of C xtra U A U G A A G U U U G G U U A A A U G U A A G U U U G G C U A A Met Lys Phe Gly Met Silent (no effect on amino acid sequence) Frameshift causing immediate nonsense (1 nucleotide-pair insertion) T instead of C A missing T A C T T C A A A T C G A T T T A C T T C A A C C G A T T T A T G A A G T T T A G C T A A A T G A A G T T G G C T A A A A instead of G U missing A U G A A G U U U A G C U A A A U G A A G U U G G C U A A Met Lys Phe Ser Met Lys Leu Ala Missense Frameshift causing extensive missense (1 nucleotide-pair deletion) A instead of T T T C missing T A C A T C A A A C C G A T T T A C A A A C C G A T T A T G T A G T T T G G C T A A A T G T T T G G C T A A U instead of A A A G missing A U G U A G U U U G G C U A A A U G U U U G G C U A A U A A Met Met Phe Gly Nonsense No frameshift, but one amino acid missing (3 nucleotide-pair deletion) Figure 17.24a Figure 17.24b Wild type template strand A Protein Amino end T A C T T C A A A C C G A T T A T G A A G T T T G G C T A A U G A A G U U U G G C U A A Met Lys Phe Gly (a) Nucleotide-pair substitution: silent Met Lys Phe Gly A instead of G T A C T T C A A A C C A A T T A T G A A G T T T G G T T A A U instead of C A U G A A G U U U G G U U A A Carboxyl end Wild type template strand A Protein Amino end T A C T T C A A A C C G A T T A T G A A G T T T G G C T A A U G A A G U U U G G C U A A Met Lys Phe Gly (a) Nucleotide-pair substitution: missense T instead of C T A C T T C A A A T C G A T T A T G A A G T T T A G C T A A A instead of G A U G A A G U U U A G C U A A Met Lys Phe Ser Carboxyl end Figure 17.24c Wild type template strand A Protein Amino end T A C T T C A A A C C G A T T A T G A A G T T T G G C T A A U G A A G U U U G G C U A A Met Lys Phe Gly (a) Nucleotide-pair substitution: nonsense A instead of T T A C A T C A A A C C G A T T A T G T A G T T T G G C T A A U instead of A A U G U A G U U U G G C U A A Met T instead of C Carboxyl end Insertions and Deletions Insertions and deletions are additions or losses of nucleotide pairs in a gene These mutations have a disastrous effect on the resulting protein more often than substitutions do Insertion or deletion of nucleotides may alter the reading frame, producing a frameshift mutation 21
22 Figure 17.24d Wild type template strand A Protein Amino end T A C T T C A A A C C G A T T A T G A A G T T T G G C T A A U G A A G U U U G G C U A A Met Lys Phe Gly (b) Nucleotide-pair insertion or deletion: frameshift causing immediate nonsense xtra A T A C A T T C A A A C G G A T T A T G T A A G T T T G G C T A A xtra U A U G U A A G U U U G G C U A A Met 1 nucleotide-pair insertion Carboxyl end Figure 17.24e Wild type template strand A Protein Amino end T A C T T C A A A C C G A T T A T G A A G T T T G G C T A A U G A A G U U U G G C U A A Met Lys Phe Gly (b) Nucleotide-pair insertion or deletion: frameshift causing extensive missense A missing T A C T T C A A C C G A T T A T G A A G T T G G C T A A U missing A U G A A G U U G G C U A A Met Lys Leu Ala 1 nucleotide-pair deletion Carboxyl end Figure 17.24f Wild type template strand A Protein Amino end T A C T T C A A A C C G A T T A T G A A G T T T G G C T A A U G A A G U U U G G C U A A Met Lys Phe Gly Carboxyl end (b) Nucleotide-pair insertion or deletion: no frameshift, but one amino acid missing T T C missing T A C A A A C C G A T T A T G T T T G G C T A A A A A G missing U G U U U G G C U A A Met Phe Gly 3 nucleotide-pair deletion Mutagens Spontaneous mutations can occur during replication, recombination, or repair Mutagens are physical or chemical agents that can cause mutations to the While gene expression differs among the domains of life, the concept of a gene is universal Archaea are prokaryotes, but share many features of gene expression with eukaryotes Comparing Gene xpression in Bacteria, Archaea, and ukarya Bacteria and eukarya differ in their RNA polymerases, termination of transcription, and ribosomes; archaea tend to resemble eukarya in these respects Bacteria and archaea can simultaneously transcribe and translate the same gene In eukarya, transcription and translation are separated by the nuclear envelope 22
23 Figure RNA polymerase Polyribosome Polypeptide (amino end) RNA polymerase Polyribosome Direction of transcription Ribosome ( end) 0.25 m If the sequence is: AUGCCCAAGUAA then the amino acid sequence would be: 1. Start-Pro-Lys 2. Met-Pro-Lys 3. Met-Pro-Lys- 4. Start-Pro-Lys- Start-Pro-Lys 25% 25% 25% 25% Met-Pro-Lys Met-Pro-Lys- Start-Pro-Lys- Which of the following processes occur in the nucleus? 1. replication transcription, and translation 2. replication and transcription 3. replication only 4. Transcription only replication trans... 25% 25% 25% 25% replication and t... replication only Transcription only Which molecule is produced during translation? 1. Amino acids 2. Proteins 3. RNA 4. 25% 25% 25% 25% Copyright 2009 Pearson ducation, Inc. Important concepts Know the vocabulary for this lecture Know what monomers are bound together to make a protein and what kind of bonds hold them together Differences between and RNA Know the types of RNA, their role and where they work in the cell Be able to determine the complementary sequence from a sequence. Important concepts Steps of transcription and translation, know which direction is built and which direction it is read Be able to read the to make a protein, given the table of codons. Know how the peptide bond is formed Know the role of RNA polymerase Know the three stages of transcription (initiation, elongation, and termination stage Know the structure of ribosomes what it is made of, how many subunits, what are the binding sites, which part of the ribosome is the catalytic region 23
24 Important concepts Know the steps of translation, what powers translation (know which steps need the energy) Know how the processes are different in prokaryotes Know the post-transcriptional and posttranslational modifications to eukaryotic and proteins Know how polypeptide chains are brought into the RR Know the types of mutations discussed in lecture, be able to recognize examples of each 24
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationProtein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationProtein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationJust one nucleotide! Exploring the effects of random single nucleotide mutations
Dr. Beatriz Gonzalez In-Class Worksheet Name: Learning Objectives: Just one nucleotide! Exploring the effects of random single nucleotide mutations Given a coding DNA sequence, determine the mrna Based
More informationUNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR
UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR RNA, as previously mentioned, is an acronym for ribonucleic acid. There are many forms
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationHonors packet Instructions
Honors packet Instructions The following are guidelines in order for you to receive FULL credit for this bio packet: 1. Read and take notes on the packet in full 2. Answer the multiple choice questions
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationBIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
More information1. Overview of Gene Expression
Chapter 17: From Gene to 1. Overview of Gene Expression 2. Transcription 3. The Genetic Code 4. Translation 5. Mutations 1. Overview of Gene Expression Chapter Reading pp. 334-337 How are Genes related
More informationUNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS
UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS Nucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RNA (ribonucleic
More informationFolding simulation: self-organization of 4-helix bundle protein. yellow = helical turns
Folding simulation: self-organization of 4-helix bundle protein yellow = helical turns Protein structure Protein: heteropolymer chain made of amino acid residues R + H 3 N - C - COO - H φ ψ Chain of amino
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationBasic Biology. Gina Cannarozzi. 28th October Basic Biology. Gina. Introduction DNA. Proteins. Central Dogma.
Cannarozzi 28th October 2005 Class Overview RNA Protein Genomics Transcriptomics Proteomics Genome wide Genome Comparison Microarrays Orthology: Families comparison and Sequencing of Transcription factor
More informationSection A: The Connection Between Genes and Proteins
CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are
More informationPROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic
More informationDescribe the features of a gene which enable it to code for a particular protein.
1. Answers should be written in continuous prose. Credit will be given for biological accuracy, the organisation and presentation of the information and the way in which the answer is expressed. Cancer
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationDNA Begins the Process
Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationFlow of Genetic Information
Flow of Genetic Information Transcription and Translation Links to the Next Generation Standards Scientific and Engineering Practices: Asking Questions (for science) and Defining Problems (for engineering)
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationCodon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationGENETICS and the DNA code NOTES
GENETICS and the DNA code NOTES BACKGROUND DNA is the hereditary material of most organisms. It is an organic compound made of two strands, twisted around one another to form a double helix. Each strand
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationINTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE
The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE
More informationGene Expression: From Gene to Protein
hapter 17 ene Expression: From ene to Protein Dr. Wendy Sera Houston ommunity ollege Biology 1406 The Flow of enetic Information The information content of genes is in the specific sequences of nucleotides
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationFROM MOLECULES TO LIFE
Chapter 7 (Strickberger) FROM MOLECULES TO LIFE Organisms depended on processes that transformed materials available outside of the cell into metabolic products necessary for cellular life. These processes
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationRNA: Transcription and Triplet Code
RNA: Transcription and Triplet Code There are Five Kinds of RNA, All of Which are Templated from DNA. The first type of RNA is trna. The "t" stands for "transfer". This RNA is the RNA that transfers amino
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationDaily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos
Daily Agenda Warm Up: Review Translation Notes Protein Synthesis Practice Redos 1. What is DNA Replication? 2. Where does DNA Replication take place? 3. Replicate this strand of DNA into complimentary
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationProtein Synthesis. Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy
Protein Synthesis Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy STRUCTURE OF RNA RNA, adenine forms a base pair with
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationComparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationLecture #18 10/17/01 Dr. Wormington
Lecture #18 10/17/01 Dr. Wormington DNA Replication The Story So Far Semiconservative Hydrolysis of 5' dntp 3' HO N 4 pn 3 pn 2 pn 1 p5'... + PP i 2P i Provides Energy for Phosphodiester Bond Formation
More informationIf stretched out, the DNA in chromosome 1 is roughly long.
Introduction to Molecular Genetics (http://chemwiki.ucdavis.edu/wikitexts/sacramento_city_college/scc%3a_chem_309_(bennett)/chapters/17% 3A_ucleic_Acids) (http://www.nature.com/scitable/topicpage/ribosomes-transcription-and-translation-14120660)
More informationAP2013-DNAPacket-II. Use the list of choices below for the following questions:
Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationUNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationGene Expression REVIEW Packet
Name Pd. # Gene Expression REVIEW Packet 1. Fill-in-the-blank General Summary Transcription & the Big picture Like, ribonucleic acid (RNA) is a acid a molecule made of nucleotides linked together. RNA
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 1 The Nature of Genes Early ideas to explain how genes work came from studying human diseases Archibald Garrod 1902 Recognized that alkaptonuria (black urine disease)
More information6. Which nucleotide part(s) make up the rungs of the DNA ladder? Sugar Phosphate Base
DNA Unit Review Worksheet KEY Directions: Correct your worksheet using a non blue or black pen so your corrections can be clearly seen. DNA Basics 1. Label EVERY sugar (S), phosphate (P), and nitrogen
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationDo you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering
DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural
More information2. Examine the objects inside the box labeled #2. What is this called? nucleotide
Name Date: Period: Biology: DNA Review Packet Read each question and fill in the proper answer. 1. Label EVERY sugar (S), phosphate (P), and nitrogen base (A, T, C, G) in the diagram below. #2 2. Examine
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationRNA and Protein Synthesis
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
More informationProtein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationDNA, RNA, protein synthesis. Sections , , and
DNA, RNA, protein synthesis Sections 14.1 14.5, 15.1 15.5, and 16.4 16.6 05-09-16 Today s class Extra-credit essay Activity on mitosis, meiosis, and inheritance Lecture and activities on the lecture Extra-credit
More informationBIOL591: Introduction to Bioinformatics Comparative genomes to look for genes responsible for pathogenesis
BIOL591: Introduction to Bioinformatics Comparative genomes to look for genes responsible for pathogenesis Reading: (1) Scenario 2: (Course web site) Read this first! (2) Perna, N. T., G. Plunkett, 3rd,
More informationTRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationIMAGE HIDING IN DNA SEQUENCE USING ARITHMETIC ENCODING Prof. Samir Kumar Bandyopadhyay 1* and Mr. Suman Chakraborty
Volume 2, No. 4, April 2011 Journal of Global Research in Computer Science RESEARCH PAPER Available Online at www.jgrcs.info IMAGE HIDING IN DNA SEQUENCE USING ARITHMETIC ENCODING Prof. Samir Kumar Bandyopadhyay
More informationFour different segments of a DNA molecule are represented below.
Four different segments of a DNA molecule are represented below. There is an error in the DNA in which molecule? A. segment 1 only B. segment 3 only C. segment 2 and 3 D. segment 2 and 4 Explain the basic
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More informationFundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.
Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving
More informationStudent Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationDNA Structure and Protein synthesis
DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationDNA REPLICATION REVIEW
Biology Ms. Ye DNA REPLICATION REVIEW 1. Number the steps of DNA replication the correct order (1, 2, 3): Name Date Block Daughter strands are formed using complementary base pairing DNA unwinds The DNA
More informationChem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary
More informationTHE GENETIC CODE Figure 1: The genetic code showing the codons and their respective amino acids
THE GENETIC CODE As DNA is a genetic material, it carries genetic information from cell to cell and from generation to generation. There are only four bases in DNA and twenty amino acids in protein, so
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More information