RNA: Transcription and Triplet Code

Size: px
Start display at page:

Download "RNA: Transcription and Triplet Code"

Transcription

1 RNA: Transcription and Triplet Code

2 There are Five Kinds of RNA, All of Which are Templated from DNA. The first type of RNA is trna. The "t" stands for "transfer". This RNA is the RNA that transfers amino acids to the growing peptide as it is elongating on the ribosome. It is single-stranded (SS) and found in the cytosol of the cell. trna makes up about 15% of all RNA's.

3 There are at least 20 different kinds of trna's as there are at least 20 different amino acids. trna has a cloverleaf shape:

4 1. Bases 1-7 are paired with bases to form a double stranded (DS) region in the trna that makes it stable/stronger. This region extends through bases The whole "arm" is known as the acceptor stem. Note that the 3' -OH is the site of attachment of the amino acid under the direction/catalysis of aminoacyl-trna synthetase. 2. Bases are paired with bases in the DHU loop (on left in graphic). The "H" stands for dihydrouridine (DHU). 3. Bases are paired with bases to form the anticodon loop of the trna (bottom of graphic). Bases 34, 35 and 36 make up the triplet that is the anti-codon. 4. Although not DS, bases make up the "extra arm" of trna. 5. Bases pair up with bases in the T C loop. is pronounced "sigh" and looks like a three-pronged pitchfork; it represents the presence of pseudo-uridine in this loop. 6. The arms or stems of the loops seem to be primarily GU pairs, a rather odd combination, as we typically think about G and C pairing and A and U pairing. 7. The amino acid acceptor end ALWAYS ends with XCCA, where X is any nucleotide, so that A is always attached to the binding/transferable amino acid.

5 That folds to a more compact "L" shape:

6 The region of the trna that bonds with the mrna is called the anti-codon. Typically, the trna's are identified by which amino acid they transfer, e.g., alanyl trna would be represented as "trna Ala ". As with ALL RNA's, the concentration of adenine is not equal to the concentration of uracil ([A] [U]), nor are the concentrations of guanine and cytosine equal ([G] [C]). This is due to the fact that RNA is single stranded (SS).

7 The second type of RNA is "rrna" or ribosomal RNA. It, too is SS. It is found in the ribosomes in the cell. rrna makes up about 80% of the RNA's in the cell. It is the most stable of the RNA's and is synthesized only when the cell needs more ribosomes. The code for the rrna is found in nuclear DNA.

8 Third Type of RNA Messenger RNA (mrna) is also SS. It is synthesized in the nucleus, is sent to the cytosol of the cell and binds with ribosomes. It makes up less than 5% of the RNA's as it doesn't "survive" long enough to make up much of the RNA's. It has a half-life (t ½ ) of 4-24 hours. mrna is around only long enough to drive the synthesis of its specific protein, then it is recycled. mrna is synthesized from a single gene unlike t and rrna. mrna may range from 70 nucleotides in length up to nucleotides in length. The 3' terminus carries a poly-a "tail" that consists of adenosine residues that are added after mrna is synthesized.

9 Fourth Kind of RNA The mitochondrion makes some of its own RNA, as well, called mitorna. It is SS and found in, believe it or not, the mitochondrion. mitorna may be t OR rrna-type. It is utilized in the synthesis of mitochondrial protein. Remember, though, that the mitochondrion requires nuclear-coded proteins to function, as well.

10 Fifth Type of RNA The fifth type of RNA is called small nuclear RNA or snrna (called "snurps"). It is found in the nucleus of the cell. Some snurps are involved in/with RNA processing. It consists of and interacts with ribonucleoprotein. They are typically named with a "U" followed by a number., e.g., "1", then completed with RNA: U1RNA, U2RNA, U3RNA, ad nauseum.

11 A Generic Gene Schematic on An SS Piece of DNA Each gene contains units called exons (these contain coding information that takes up a very small space in the gene) and introns (contains non-coding information; they are not well understood and they take up a lot of space in the gene). Hence, not all of the DNA in a single gene is required for the synthesis of a protein.

12 Enhancers - 1 This is a gene-specific sequence of DNA, nucleotides long and may be repeated a number of times. Enhancers are located 100 base pairs (bp's) to thousands of bp's (kbp's) up OR downstream of the DNA sequence that will be read or transcribe. Enhancers are conditional, i.e., not every thing "turns them on". Enhancers are also known as recognition sites. Since enhancers are DNA-coded, they are called "cis" acting. Factors that bind to enhancers are called "trans" acting.

13 Enhancers - 2 Three other regions are observable: a sequence of GC's, a region of CAAT and a TATA region. All three of these regions are called promoter sites. These are promoters for RNA Pol II (Slide coming). The region between bases downstream of the transcription start site (more coming on this later; written as ) is called the GC box. This is observed only every now and again, i.e., this is rare. Between -40 and -75 is a region of four nucleotides, CAAT, called the cat box. This is observed a bit more frequently than the GC box.

14 Enhancers & Start Box The promoter site almost always present is the TATA region between the start site (S) and -30. This latter region is called the Hogness box and is about 25 bp up from the transcription start site. Data indicates that the TATA box, as it's also called, is the "code" for the first base to be transcribed.

15 Enhancers increase transcription more than 100- fold. The properties of a good enhancer are as follows: 1. They must not possess promoting activity. 2. They can be 1 kbp up OR down from the promoter. 3. Some work only in 1 kind of cell, 1 kind of tissue and/or 1 kind of cell type. 4. Some work where ever they "desire". 5. They may be spliced into other regions of DNA. 6. Their removal slows transcription to one-hundredth the activity that it was. 7. They may be cut out and inserted backwards into the same spot without loss of genetic activity. This latter characteristic says that the enhancers are read front-toback OR back-to-front for full activity.

16 In order for transcription to continue, the DNA must be unwound. Once the DNA is unwound and opened up, RNA Pol II may begin reading this SS strand of DNA

17 RNA Polymerases (RNA Pol) An ASIDE RNA Pol I RNA Pol II RNA Pol III --in nucleolus --for small rrna synthesis --requires transcription factors to bind to its promoters (opens up chromatin to less organized DNA for transcription ; remember that histones reduce the availability of DNA to DNA'ses making the DNA more stable and less prone to breakage; RNA Pol knocks out this property to perpetuate transcription) --synthesizes all mrna does not bind to promoters, but around transcription start site --reaches ahead to locate the transcription start site --in nucleus --in nucleolus and cytosol --for tiny rrna and trna synthesis --promoters for III are downstream from the transcription start site and within the region being transcribed --reaches behind to locate the transcription start site

18 This strand that is opened up for transcription is called the template strand, the noncoding strand or the nonsense strand. It is so called because the RNA that will be synthesized is complimentary to this DNA strand. The NONIDENTICAL strand of DNA is complimentary to the template strand and is identical to the transcript non obstante T to U variations and is called the coding or SENSE strand. As opposed to replication, RNA Pol's require no primer or primase to initiate transcription.

19 A Simplified Version of Transcription Followed by Post- Transcriptional Modification The 5' region of the immature transcript contains the untranslated leader (UT) that contains NO amino acid information. The 3' region contains the untranslated region (U) that, likewise, codes for no amino acid information (the UT and U regions MAY provide the structure that the ribosome uses to bind the mrna - do NOT confuse UT and U regions with the snurps: See Below). The bottom line in this process is to remove the non-coding introns and splice the coding exons together to bring them into closer proximity for ribosomal-reading.

20 The first step in post-transcriptional modification is to isolate the introns. Once they are isolated, they are spliced out.

21 This process is catalyzed by the RNA, itself. When RNA acts as an enzyme, it is called a ribozyme. This is one of several examples/exceptions of enzymes that do not fit the traditional definition of enzymes, i.e., they must be proteins; RNA breaks this "rule". Once the exons are spliced together, the introns are removed (30-50% of the primary transcript).

22 The third processing, the addition of the poly-a tail, is directed by poly-a polymerase - no DNA template is required for this step. The mature RNA is now readable.

23 How, then, does all of this splicing occur? Splicing requires the primary transcript (also known as hnrna: heterogeneous nuclear RNA), snurps (U1, U2, U4, U5, U6) and an unknown amount of proteins (perhaps they are used as scaffolding, for binding or for both). When all of these are present, they make up a spliceosome.

24 The ends of exons seem to be AGG from 5' to 3'. Inside the intron is a sequence of pyrimidines (Py) and purines (Pu) with any nucleotide (N) and adenosine. The sequence is PyNPyPyPuAPy, again, from 5' to 3'. This sequence is called a consensus sequence, a conserved sequence that seems to act as the identifying feature of the splice site. Sometimes this consensus sequence is called a branch site (B). The primary transcript reacts with U1. U1 binds to the 5' end of the intron.

25 U2 binds to the branch site (B) and also directs U1 to bind to B, as well as to the 5' end of the intron. U1 and U2 rearrange so that U1-U2 spans the intron, i.e., the U2 end binds to the 3' end of the intron.

26 U4, U5 and U6 then bind together (not unlike complement 1 proteins q, r, s, that initiate the classical complement cascade) to form a catalytically active complex that causes U4 to be released with the formation of a U1 U2 U5 U6 complex that causes the formation of a "lariat" between the 5' region of the partially "clipped" transcript and the 3' region of the transcript.

27 Once the lariat (derived from the intron) is removed, the snurps catalyze the rearrangement of the exons, butting them up against one another. As the ends of the exons are annealed, the snurps are released, the lariat is metabolized and the nucleotides are recycled. This process is called the "lariat hypothesis". Another form of the "lariat splicing mechanism" has to do with a very unusual 5' to 2' lariat formation.

28 FINALLY! The termination of transcription is brought about by polyadenylation (poly-a). This is a sequence of A's about 200 bp's long. While there is no DNA template for poly A, there is a signal sequence in mrna that "triggers" poly A addition. An RNA endonuclease cleaves the poly-a recognition site and poly-a is added. The AAUAAA sequence is a required base sequence for enzymatic activity. At this point, the hnrna is matured and is ready to be "read" by ribosomes. mrna processing also includes capping and methylating: these processes may protect RNA from RNA'ses OR may be recognition sites for ribosomes OR may be a transport sequence to get the mrna out of the nucleus.

29 Although gene regulation is complex and not fully understood, there are some initial regulations of transcription about which we do have some knowledge. Transcription may be positively regulated 1) hormonally at the level of the DNA; with RNA Pol and with proteins necessary for Pol interaction. This probably does not occur in man; 2) hormonally at the level of the DNA that causes conformational changes of DNA so RNA Pol may bind to it; 3) hormonally where the hormone binds to the transcriptional factor that has to bind to DNA site before RNA Pol may bind; 4) camp is even involved: it increases tyrosine aminotransferase, PEPCK and prolactin syntheses.

30 Conversely, transcription may be negatively regulated 1) hormonally where the hormone acts as an inducer that turns off repressors and/or 2) hormonally where the hormone binds to the DNA to cause a conformational change of chromatin to make the DNA susceptible to RNA Pol.

31 Once the mrna has been synthesized and matured in the nucleus, it is ready for transport through the nuclear envelope into the cytosol to bind to ribosomes. trna, then, transports the necessary amino acids to the mrna-ribosomal complex to continue the process of protein synthesis (translation). How is it that the two RNA's code for the amino acids?

32 The genetic code is based upon triplets, i.e., a set of three nucleotides in sequence that code for a single amino acid. Each triplet in mrna is read from 5' to 3'; this triplet in mrna is called the codon. Each triplet in trna is called the anti-codon and is read complimentarily to the codon.

33 Listed below in the table is an incomplete list of codons for some of the amino acids: Triplet Code (Codon with Amino Acid -- NOT Inclusive) UAA = Stop CAC = His CUA = Leu AAG = Lys UAC = Tyr CGA = Arg AAC = Asn AGA = Arg UGG = Trp GAA = Glu AGC = Ser UGC = Cys GAU = Asp GGG = Gly ACA = Thr CAA = Gln AUA = Ile GCA = Ala CCC = Pro UUU = Phe AUG = Met (Start) GUG = Val

34 Note that, in some instances, the difference between amino acids is one (1) nucleotide in the triplet, e.g., mrna sequence: AUG-CAC-AGA-CCC-UGC-UAA amino acid sequence: (Start) Met-His-Arg-Pro-Cys-Stop If you alter this sequence by placing an "A" after 9 bases, the new sequence is: mrna sequence: AUG-CAC-AGA-ACC-CUG-CUA-A New amino acid sequence: (Start) Met-His-Arg-Thr-Leu-Leu-----

35 One shift, one base change alters the whole protein after the insertion of the "A". We'll discuss this more in the near future. In the mean time, the process of using the mrna to synthesize proteins is called translation and that's the next chapter.

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template

More information

Biomolecules: lecture 6

Biomolecules: lecture 6 Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized

More information

Biomolecules: lecture 6

Biomolecules: lecture 6 Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism

Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow

More information

A Zero-Knowledge Based Introduction to Biology

A Zero-Knowledge Based Introduction to Biology A Zero-Knowledge Based Introduction to Biology Konstantinos (Gus) Katsiapis 25 Sep 2009 Thanks to Cory McLean and George Asimenos Cells: Building Blocks of Life cell, membrane, cytoplasm, nucleus, mitochondrion

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

From Gene to Protein. How Genes Work

From Gene to Protein. How Genes Work From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.

Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2. 1. Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.This subunit is composed of what 3 parts? 3.What molecules make

More information

7.016 Problem Set 3. 1 st Pedigree

7.016 Problem Set 3. 1 st Pedigree 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all generations

More information

Level 2 Biology, 2017

Level 2 Biology, 2017 91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with

More information

From Gene to Protein. How Genes Work (Ch. 17)

From Gene to Protein. How Genes Work (Ch. 17) From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Protein Synthesis. Application Based Questions

Protein Synthesis. Application Based Questions Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

ANCIENT BACTERIA? 250 million years later, scientists revive life forms

ANCIENT BACTERIA? 250 million years later, scientists revive life forms ANCIENT BACTERIA? 250 million years later, scientists revive life forms Thursday, October 19, 2000 U.S. researchers say they have revived bacteria that have been dormant for more then 250 million years,

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

Transcription steps. Transcription steps. Eukaryote RNA processing

Transcription steps. Transcription steps. Eukaryote RNA processing Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria

More information

From RNA To Protein

From RNA To Protein From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution

More information

Ch. 10 From DNA to Protein. AP Biology

Ch. 10 From DNA to Protein. AP Biology Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene

More information

Genes and Proteins. Objectives

Genes and Proteins. Objectives Genes and Proteins Lecture 15 Objectives At the end of this series of lectures, you should be able to: Define terms. Explain the central dogma of molecular biology. Describe the locations, reactants, and

More information

Bioinformatics CSM17 Week 6: DNA, RNA and Proteins

Bioinformatics CSM17 Week 6: DNA, RNA and Proteins Bioinformatics CSM17 Week 6: DNA, RNA and Proteins Transcription (reading the DNA template) Translation (RNA -> protein) Protein Structure Transcription - reading the data enzyme - transcriptase gene opens

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS Nucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RNA (ribonucleic

More information

Lecture 19A. DNA computing

Lecture 19A. DNA computing Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

The combination of a phosphate, sugar and a base forms a compound called a nucleotide.

The combination of a phosphate, sugar and a base forms a compound called a nucleotide. History Rosalin Franklin: Female scientist (x-ray crystallographer) who took the picture of DNA James Watson and Francis Crick: Solved the structure of DNA from information obtained by other scientist.

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK?

PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? Learning Outcomes All: Will be able to describe simple steps in protein synthesis: Transcription and Translation and be able to distinguish between them.

More information

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

iclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3

iclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3 Bio 111 Handout for Molecular Biology 4 This handout contains: Today s iclicker Questions Information on Exam 3 Solutions Fall 2008 Exam 3 iclicker Question #28A - before lecture Which of the following

More information

CONVERGENT EVOLUTION. Def n acquisition of some biological trait but different lineages

CONVERGENT EVOLUTION. Def n acquisition of some biological trait but different lineages CONVERGENT EVOLUTION Def n acquisition of some biological trait but different lineages Living Rock cactus Baseball plant THE QUESTION From common ancestor or independent acquisition? By Lineage By Convergence

More information

GENETICS - CLUTCH CH.10 TRANSCRIPTION.

GENETICS - CLUTCH CH.10 TRANSCRIPTION. !! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle

More information

From Gene to Protein. Chapter 17

From Gene to Protein. Chapter 17 From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

PROTEIN SYNTHESIS Study Guide

PROTEIN SYNTHESIS Study Guide PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl

1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription

More information

NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl

NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

Unit 1. DNA and the Genome

Unit 1. DNA and the Genome Unit 1 DNA and the Genome Gene Expression Key Area 3 Vocabulary 1: Transcription Translation Phenotype RNA (mrna, trna, rrna) Codon Anticodon Ribosome RNA polymerase RNA splicing Introns Extrons Gene Expression

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid

More information

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria

More information

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below). Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Chemistry 121 Winter 17

Chemistry 121 Winter 17 Chemistry 121 Winter 17 Introduction to Organic Chemistry and Biochemistry Instructor Dr. Upali Siriwardane (Ph.D. Ohio State) E-mail: upali@latech.edu Office: 311 Carson Taylor Hall ; Phone: 318-257-4941;

More information

Chapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko

Chapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko Chapter 10 The Structure and Function of DNA PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Fishy Amino Acid Codon. UUU Phe UCU Ser UAU Tyr UGU Cys. UUC Phe UCC Ser UAC Tyr UGC Cys. UUA Leu UCA Ser UAA Stop UGA Stop

Fishy Amino Acid Codon. UUU Phe UCU Ser UAU Tyr UGU Cys. UUC Phe UCC Ser UAC Tyr UGC Cys. UUA Leu UCA Ser UAA Stop UGA Stop Fishy Code Slips Fish 1 GGTTATAGAGGTACTACC Fish 2 GGCTTCAGAGGTACTACC Fish 3 CATAGCAGAGGTACTACC Fish 4 GGTTATTCTGTCTTATTG Fish 5 GGCTTCTCTGTCTTATTG Fish 6 CATAGCGCTGCAACTACC Fishy Amino Acid Codon UUU Phe

More information

Chapter 17. From Gene to Protein. AP Biology

Chapter 17. From Gene to Protein. AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

Chapter 13 From Genes to Proteins

Chapter 13 From Genes to Proteins Chapter 13 From Genes to Proteins True/False Indicate whether the sentence or statement is true(a) or false(b). 1. RNA nucleotides contain the sugar ribose. 2. Only DNA molecules contain the nitrogen base

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

How life. constructs itself.

How life. constructs itself. How life constructs itself Life constructs itself using few simple rules of information processing. On the one hand, there is a set of rules determining how such basic chemical reactions as transcription,

More information

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones? EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) to allow RNA polymerase continuous access

Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) to allow RNA polymerase continuous access Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) 1 This print-out should have 34 questions. Multiple-choice questions may continue on the next column or page find all choices

More information

Chapter 11. Transcription. The biochemistry and molecular biology department of CMU

Chapter 11. Transcription. The biochemistry and molecular biology department of CMU Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

Chapters 31-32: Ribonucleic Acid (RNA)

Chapters 31-32: Ribonucleic Acid (RNA) Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

Protein Synthesis ~Biology AP~

Protein Synthesis ~Biology AP~ Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Human Gene,cs 06: Gene Expression. Diversity of cell types. How do cells become different? 9/19/11. neuron

Human Gene,cs 06: Gene Expression. Diversity of cell types. How do cells become different? 9/19/11. neuron Human Gene,cs 06: Gene Expression 20110920 Diversity of cell types neuron How do cells become different? A. Each type of cell has different DNA in its nucleus B. Each cell has different genes C. Each type

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Q. No. 1. How can RNA be distinguished from DNA?

Q. No. 1. How can RNA be distinguished from DNA? Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

From Gene to Protein

From Gene to Protein Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information