Color Figures for: DNA Microarray Experiments: Biological and Technological Aspects
|
|
|
- Trevor Nickolas Hutchinson
- 6 years ago
- Views:
Transcription
1 Color Figures for: DNA Microarray Experiments: Biological and Technological Aspects Danh V. Nguyen 1, A. Bulak Arpat 2, Naisyin Wang 1, and Raymond J. Carroll 1 1 Department of Statistics, Texas A&M University, College Station, TX , U.S.A. 2 Graduate Group in Genetics, University of California, Davis, CA 95616, U.S.A. dnguyen@stat.tamu.edu 1
2 5 3 AAAAAAA T TT T TT T Add oligo(dt) primers (to start synthesis) and enzyme reverse transcriptase (to catalyze first strand ). oligo(dt) primer poly(a) tail (1 st strand) AAAAAAA T TT T TT T Add NaOH to degrade. (1 st strand) strand degraded T T T T T T T Add enzyme DNA polymerase I to synthesize second strand. doublestranded T T T T T T T Figure 1: 2
3 Experimental Cell Reference Cell Typical isolated from experimental & reference cell pools GCAAUAA UG AAAAA 3 CAGAUAU CA AAAAA poly(a) tail Add dntps with labelled nucleotides Cy5-dUTPs (denoted U ) or Cy 3-dUTPs (denoted U ) to solution containing total. 25% of datp, dctp, & dgtp 15% of dttp, 10% of du TP (Cy5-dUTP) oligo(dt) (initiate synthesis) reverse transcriptase (enzyme to synthesize 1 st strand ) 25% of datp, dctp, & dgtp 15% of dttp, 10% of du TP (Cy3-dUTP) experimental s (e.g. from cancer cells) reference s (e.g. from normal cells) Typical Cy-labelled 1 st strand during RT reaction. labelled CGU TU U AC TTTTT oligo(dt) labelled GU CTATA.GU TTTTT Resulting Cy5-labelled experimental s and Cy3-labelled s ( degraded). experimental s (Cy5-dUTP labelled s) reference s (Cy3-dUPT labelled s Figure 2: 3
4 Experimental Cell Reference Cell Typical isolated from experimental & reference cell pools GCAAUAA UG AAAAA 3 poly(a) tail CAGAUAU CA AAAAA Add identical dntps with (modified) amino-allyldutps nucleotides (denoted by U*) to both experimental and reference m solution (* denotes NH 3 ). 25% of datp, dctp, & dgtp 15% of dttp, 10% of du*tp (amino-allyl dutp) oligo(dt) (initiate synthesis) reverse transcriptase (enzyme to synthesize 1 st strand ) Typical 1 st strand synthesized during RT reaction with amino-allyldutp incorporated. (i) Resulting unlabelled experimental and reference s with incorporated amino-allyl-dutp ( degraded). Cy5 (R) or Cy3 (G) dyes are then added after synthesis. experimental s (e.g. from cancer cells) unlabelled CGU*TU*U* AC TTTTT (i) experimental s (Cy5-dUTP labelled s) oligo(dt) (ii) Add Cy5 dye ( ) reference s (e.g. from normal cells) unlabelled GU*CTATA.GU* TTTTT Add Cy3 dye ( ) reference s (Cy3-dUPT labelled s (ii) Typical labelled after adding dye to solutions. CGU* TU* U* AC TTTTT labelled oligo(dt) GU* CTATA.GU* TTTTT unlabelled Figure 3: 4
5 Experimental Cell Reference Cell Typical isolated from experimental 3 & reference cell pools. 5 5 GCAAUAA UG AAAAA 3 Poly(A) tail CAGAUAU CA AAAAA Add equal amounts of unmodified & unlabelled dntps and oligo(dt) with capture sequences (denoted by and ). 25% of datp, dctp, dttp, & dgtp oligo(dt) primer w/ capture sequence: TTTTT reverse transcriptase (enzyme to synthesize 1 st strand ) oligo(dt) primer w/ capture sequence: TTTTT experimental s (e.g. from cancer cells) reference s (e.g. from normal cells) Typical 1 st strand synthesized. CGTTATT AC TTTTT GTCTATA.GT TTTTT oligo(dt) w/ capture sequence oligo(dt) w/ capture sequence Mix experimental and reference (unlabelled) s together and hybridize to microarray. mixed experimental & reference s hybridize mixed solution onto microarray Incubate array w/ Cy5 and Cy3 labelled dendrimer after washing off unbound s (approx. 250 dye molecules per dendrimer). dendrimers contain sequences complement to corresponding capture sequences (approx. 250 dye molecules per dendrimer) Incubate microarray w/ dendrimers wash off unbound Dendrimers & scan microarray Figure 4: 5
6 emission filter mirror PMT detector detector lens pinhole excitation laser beam beam splitter objective lens dye microarray glass substrate emitted fluorescenceis spherical Figure 5: 6
7 Figure 6: 7
8 Figure 7: 8
DNA Microarray Experiments: Biological and Technological Aspects
DNA Microarray Experiments: Biological and Technological Aspects Danh V. Nguyen 1, A. Bulak Arpat 2, Naisyin Wang 1, and Raymond J. Carroll 1 1 Department of Statistics, Texas A&M University, College Station,
Amino-allyl Dye Coupling Protocol
Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.
Microarray protocol Emmanuela Marchi PhD Dept. Pharmacology UFIR - Comparative nutritional systems biology Focus Team Post-doc emanuela.marchi@unifi.it 16 April 2009 When citing this SOP you should acknowledge
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled
Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03
Standard Operating Procedure PAGE: 1 of 8 SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 AUTHOR: Jeremy Hasseman PRIMARY REVIEWERS: Renee Gaspard, Bryan Frank 1. PURPOSE This protocol describes
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Recombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents
DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment
Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity
Student Worksheet Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity LSM 6.3-7 In 1977, Frederick Sanger developed a method by which the nucleotide sequence of a DNA fragment could be
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
Please purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months
www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT
B r1 US M
References: 1. Van Gelder, R.N. et al. (1990) Proc Natl Acad Sci USA 87: 1663-1667 2. Cox and Singer (2004) Biotechniques 36 (1): 114 3. Cox, et al. (2004) Analytical Biochemistry 331(2): 243-254 4. Ståhlberg
First Strand cdna Synthesis Kit (#K1611 for 10 reactions)
3 First Strand cdna Synthesis Kit (#K1611 for 10 reactions) Kit is designed for preparation of full-length fi rst strand cdna from RNA templates. The fi rst strand cdna synthesis kit relies on a cloned
Chapter 3. Enzyme manipulation of DNA and RNA
Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA
Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
Genetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
Sequencing the Human Genome
The Biotechnology 339 EDVO-Kit # Sequencing the Human Genome Experiment Objective: In this experiment, DNA sequences obtained from automated sequencers will be submitted to Data bank searches using the
Session 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
Learning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
Instruction Manual cdna Synthesis System
Instruction Manual cdna Synthesis System CAT. NO. 18267-013 Table of Contents 1. Notices to Customer........................................1 1.1 Important Information.............................................1
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Cat. # For Research Use. BcaBEST Labeling Kit. Product Manual. v201701da
Cat. # 6046 For Research Use BcaBEST Labeling Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Principles... 4 V. Protocol... 5 VI. Effect of Template
CHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
Instructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix Standard PCR MasterMix contains all reagents required for routine high throughput PCR amplifications
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
Rotor-Gene Multiplex Handbook
Second Edition July 2011 Rotor-Gene Multiplex Handbook Rotor-Gene Multiplex PCR Kit Rotor-Gene Multiplex RT-PCR Kit For fast multiplex real-time PCR, two-step RT-PCR, and one-step RT-PCR using sequence-specific
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
DNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
PROTOCOL. MessageAmp II-Bacteria Kit
PROTOCOL MessageAmp II-Bacteria Kit For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
PureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
RNA/cDNA Quality Assay User Manual
.Clontech Laboratories, Inc. RNA/cDNA Quality Assay User Manual (PR0X3688) Cat. No. 636841 Published 1/19/2011 Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA
PrimeScript 1st strand cdna Synthesis Kit
Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...
Polymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
Different types of PCR and principles of Real Time PCR. Prof. Dr. Hamdy M. El-Aref Assiut University, Faculty of Agriculture Genetics Department
Different types of PC and principles of eal Time PC. Prof. Dr. Hamdy M. El-Aref Assiut University, Faculty of Agriculture Genetics Department I N T O D U C T I O N PC Cycle (round) I N T O D U C T I O
Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature
Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons
PROTOCOL. Amino Allyl MessageAmp II arna Amplification Kit
PROTOCOL Amino Allyl MessageAmp II arna Amplification Kit For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without
LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research
LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing
BCMB Chapters 34 & 35 DNA Replication and Repair
BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair
The Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
Exam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
AccuPower PCR PreMix 73. AccuPower Taq PCR PreMix 77. AccuPower PCR PreMix (with UDG) 79. AccuPower HotStart PCR PreMix 81
PCR PreMix 73 AccuPower Taq PCR PreMix 77 AccuPower PCR PreMix (with UDG) 79 AccuPower HotStart PCR PreMix 81 AccuPower PyroHotStart Taq PCR PreMix 84 AccuPower HotStart PCR PreMix (with UDG) 87 AccuPower
TaKaRa Taq HS PCR Kit, UNG plus
Cat. # R013S/A For Research Use TaKaRa Taq HS PCR Kit, UNG plus Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 4 IV. Materials Required but not Provided... 4 V.
DNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
Feature Selection of Gene Expression Data for Cancer Classification: A Review
Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression
PRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
DNA metabolism. DNA Replication DNA Repair DNA Recombination
DNA metabolism DNA Replication DNA Repair DNA Recombination Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Central Dogma or Flow of genetic information
MCB 102 University of California, Berkeley July 28-30, Problem Set 6
MCB 102 University of California, Berkeley July 28-30, 2009 Isabelle Philipp Handout Problem Set 6 The answer key will be posted by Tuesday July 28. Try to solve the problem sets always first without the
P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
DNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
DNA CHIPS- Technology and Utility
DNA CHIPS- Technology and Utility Yanal Alkuddsi Ph.D Student Dept. of Genetics and Plant Breeding University of Agricultural Sciences Dharwad, Karnataka, India, 580005 1.INTRODUCTION CONTENT 2.MICROARRAYS:
Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
American Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I
Technical Instructions for Spotting Microarrays
Technical Instructions for Spotting Microarrays PRODUCT is a special low fluorescence glass slide in the standard size of 75.6 mm x 25.0 mm x 1.0 mm. The aldehyde surface coating allows efficient covalent
Microarray Protocols Version 1 December 21, 2007
Microarray Protocols Version 1 December 21, 2007 Table of Contents: Genomic DNA Labelling 2 Post-Processing of Oligo Arrays on Epoxy and Amine Coated Slides 4 RNA Extraction 5 cdna Labelling 8 RNA Isolation
Score winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
Assessment of RNA Quality by Semi-Quantitative RT-PCR of Multiple Regions of a Long Ubiquitous mrna
Assessment of RNA Quality by Semi-Quantitative RT-PCR of Multiple Regions of a Long Ubiquitous mrna BioTechniques 28:524-531 (March 2000) Galvin H. Swift, Michael J. Peyton and Raymond J. MacDonald University
TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY
Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic
Copy Kit. Version G Copy Kit. cdna Synthesis System. Catalog no. L
Copy Kit Version G 022002 25-0013 Copy Kit cdna Synthesis System Catalog no. L1311-03 www.invitrogen.com tech_service@invitrogen.com ii Table of Contents Table of Contents...iii Kit Contents and Storage...
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
Premix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
What is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
Pre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
MOLECULAR DIAGNOSTIC TECHNIQUES
MOLECULAR DIAGNOSTIC TECHNIQUES NON-AMPLIFIED NUCLEIC ACID PROBES... 2 SIGNAL AMPLIFICATION TECHNIQUES... 2 bdna... 2 Hybrid Capture Assays... 3 TARGET AMPLIFICATION TECHNIQUES... 4 PCR... 4 RT-PCR...
DNA and Its Role in Heredity. DNA and Its Role in Heredity. A. DNA: The Genetic Material. A. DNA: The Genetic Material.
DNA and Its Role in Heredity A. DNA: The Genetic Material Lecture Series 8 DNA and Its Role in Heredity B. The Structure of DNA C. DNA E. DNA Proofreading and Repair F. Practical Applications of DNA A.
Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution.
Short questions 1 point per question. Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Answer: Water is sucked out of the cells by osmosis (this reduces
RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O
www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
Fig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
Microarray Protocols (October, 2000) Developed by the DeRisi Lab, UCSF. Modified by the Kapur Lab, U of MN
Microarray Protocols (October, 2000) Developed by the DeRisi Lab, UCSF Modified by the Kapur Lab, U of MN Introduction Microarray technology has been developing rapidly over the last several years. The
Amplification: MyiQ and iq5 Real-Time PCR Systems. MyiQ and iq 5 Real-Time PCR Detection Systems
Amplification: MyiQ and iq5 Real-Time PCR Systems MyiQ and iq 5 Real-Time PCR Detection Systems Genomic Research Solutions From Bio-Rad Bio-Rad is well known for making advanced genomic technologies accessible
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated