FL cell isolation and sorting
|
|
- Lenard Robinson
- 6 years ago
- Views:
Transcription
1 FL cell isolation and sorting Mononuclear cells obtained from FL were blocked with an anti-cd16/32 (93) antibody (BioLegend), followed by predepletion of differentiated hematopoietic cells with automacs TM (Miltenyi Biotec) using the peridinin-chlorophyll-protein complexcyanine 5.5 (PerCP-Cy5.5)-conjugated lineage markers rat anti-cd4 (RM4-5), anti- CD8 (53-6.7), anti-b220 (RA3-6B2), anti-gr-1 (RB6-8C5), and anti-ter119 (Ter-119) antibodies (BD Biosciences), as well as goat anti-rat IgG microbeads (Miltenyi Biotec). Lineage cells were further stained with biotinylated anti-epcr (RMEPCR1560) (Stemcell Technologies), fluorescein isothiocyanate (FITC)-conjugated anti-c-kit (2B8), and phycoerythrin (PE)-conjugated anti-sca-1 (D7) (BD Biosciences) antibodies, followed by incubation with APC-conjugated streptavidin (BD Biosciences). Finally, propidium iodide (Invitrogen) was added to discriminate dead cells. A BD FACSVantage TM system and the FACSDiva TM software (BD Biosciences) were used to perform flow cytometry analysis and cell sorting. Immunohistochemistry Embryos were fixed in 2% paraformaldehyde in phosphate buffer solution (PBS) for 5 h at 4ºC and washed in PBS overnight. After 30% sucrose infusion, embryos were embedded in OCT compound (Sakura Finetek Japan) and frozen. Frozen embryos were sectioned at a thickness of 12 µm and transferred onto a silanized glass slide (Dako). Sections were then washed in PBS and endogenous peroxidase was quenched with 0.3% H 2 O 2 in PBS for 30 min, followed by blocking with 1% bovine serum albumin in PBS. Endogenous biotin was blocked using the Avidin/Biotin Blocking Kit (Invitrogen). Sections were incubated overnight at 4ºC in PBS with selected primary antibodies: biotinylated rat anti-epcr (Stemcell Technologies), rabbit anti-mouse lymphatic vessel endothelial receptor 1 (LYVE-1) (103-PA50AG, ReliaTech), goat anti-mouse LYVE-1 (AF2125, R&D Systems), goat anti-mouse c-kit (AF1356, R&D Systems), rabbit antimouse alpha laminin (L9393, Sigma Aldrich), rabbit anti-human fibronectin (A0245, Dako), rabbit anti-mouse matrix metalloproteinase 9 (MMP-9) (AB19047, Millipore), goat anti-mouse TM (AF3894, R&D Systems), rat anti-human APC (HyCult Biotech), and/or hamster anti-mouse delta-like 1 homolog (DLK-1) (kindly provided by Kyowa Hakko Kirin). After washing, biotinylated rat anti-epcr staining was amplified using the TSA Biotin System (PerkinElmer Life And Analytical Sciences). Sections were then stained with secondary antibodies: Alexa Fluor 488-conjugated streptavidin, goat anti-rabbit IgG, or donkey anti-rabbit IgG (Invitrogen); Cy3-conjugated goat anti- Armenian hamster IgG, donkey anti-rabbit IgG, or donkey anti-goat IgG (Jackson ImmunoResearch Laboratories); Alexa Fluor 633-conjugated streptavidin (Invitrogen); or Cy5-conjugated donkey anti-goat IgG (Jackson ImmunoResearch Laboratories) for 1 h at room temperature. Nuclei were stained with TOTO-3 or 4',6-diamidino-2- phenylindole (DAPI) (Invitrogen). For costaining with lineage markers, sections were stained overnight first with anti-epcr and goat anti-mouse Sca-1 (AF1226, R&D Systems) antibodies, followed by first secondary antibody staining with Cy3-conjugated donkey anti-rat IgG (Jackson ImmunoResearch Laboratories) and Cy5-conjugated donkey anti-goat IgG. Subsequently, they were stained with second primary antibodies hamster anti-mouse DLK-1 and rabbit anti-mouse Lyve-1. Finally, second secondary antibodies FITC-conjugated goat anti-armenian hamster IgG (Jackson
2 ImmunoResearch Laboratories) and DyLight 405-conjugated goat anti-rabbit IgG (Thermo Scientific) were used for labeling along with lineage staining using FITCconjugated rat anti-cd4, anti-cd8, anti-b220, anti-gr-1, anti-ter-119, anti-cd41 (MWReg30, BD), and Armenian hamster anti-cd48 (HM48-1, BioLegend) antibodies. Cell cycle analysis For cell cycle analysis using flow cytometry, pregnant mice were injected intraperitoneally with 5-Bromo-2-deoxyuridine (BrdU) (5 mg each, Sigma Aldrich) 2 h prior to being sacrificed. FLs were dissected and differentiated hematopoietic cells were depleted as described in Methods. After lineage cell depletion and surface-marker staining, cells were fixed and permeabilized using the BrdU Flow Kit (BD Bioscience). DNA was cleaved with a 1 h treatment of 0.3 mg/ml DNase (Sigma Aldrich) at 37ºC and incorporated BrdU was stained subsequently with an anti-brdu antibody. Nucleic acids were stained with Hoechst trihydrochloride trihydrate (Invitrogen). Additionally, Ki67 analysis was performed to assess G0 phase fraction. After lineage cell depletion and surface marker staining, cells were fixed and permeabilized using the Cytofix/Cytoperm Kit (BD Bioscience), followed by staining with an Alexa Fluor 488-conjugated anti-ki67 antibody (BD Bioscience). RNA was digested with 50 µg/ml RNase A for 20 min in a water bath at 37ºC.
3 Table S1. List of mrnas investigated by high-throughput qrt PCR analysis Gene ID Assay ID Gene ID Assay ID Gene ID Assay ID Gene ID Assay ID Alcam Mm _m1 cdh4 Mm _m1 Flt1 Mm _m1 Notch2 Mm _m1 Angpt1 Mm _m1 cdh5 Mm _m1 Flt3 Mm _m1 Pbx1 Mm _m1 Aurka Mm _m1 cdh6 Mm _m1 Flt4 Mm _m1 Pcdh7 Mm _m1 Bax Mm _m1 cdh7 Mm _m1 Gata1 Mm _m1 Pdgfa Mm _m1 Bbc3 Mm _m1 cdk2 Mm _m1 Gata2 Mm _m1 Ppp1r13b Mm _m1 Bcl2 Mm _m1 cdk4 Mm _s1 Gata6 Mm _m1 Procr Mm _m1 Bmi1 Mm _gH cdk6 Mm _m1 Gfi1 Mm _m1 Psg1-1 Mm _m1 Bmp2 Mm _m1 Cdkn1a Mm _m1 Hoxb4 Mm _m1 Ptgs2 Mm _m1 Bmp4 Mm _m1 Cdkn1b Mm _g1 Icam1 Mm _m1 Runx1 Mm _m1 Bmp6 Mm _m1 Cdkn1c Mm _g1 Itga4 Mm _m1 Sall4 Mm _m1 Ccnd1 Mm _s1 Cdkn2a Mm _m1 Itga9 Mm _m1 Slamf1 Mm _m1 Ccnd2 Mm _m1 Cdkn2b Mm _m1 Itgal Mm _m1 Sox17 Mm _m1 Ccnd3 Mm _m1 Cdkn2c Mm _m1 Itgb1 Mm _m1 Sox2 Mm _s1 Ccne1 Mm _m1 cdx2 Mm _m1 Itgb2 Mm _m1 Tal1 Mm _m1 Ccne2 Mm _m1 Csf3r Mm _m1 Kdr Mm _m1 Tcf3 Mm _m1 Ccng2 Mm _m1 ctnna1 Mm _m1 Kit Mm _m1 Tek Mm _m1 Cd44 Mm _m1 ctnnb1 Mm _m1 Mapk1 Mm _m1 Tert Mm _m1 Cdh1 Mm _g1 Ctnnd1 Mm _m1 Mapk3 Mm _g1 Trp53 Mm _g1 Cdh11 Mm _m1 Cxcr4 Mm _m1 Mcam Mm _m1 Vcam1 Mm _m1 Cdh12 Mm _m1 Ecat1 Mm _g1 Mpl Mm _m1 Vegfa Mm _m1 cdh15 Mm _m1 Eng Mm _m1 Myc Mm _m1 Wnt5a Mm _m1 cdh2 Mm _m1 Etv6 Mm _m1 NfkB Mm _m1 Wnt5b Mm _m1 cdh3 Mm _m1 Evi1 Mm _m1 Notch1 Mm _m1
4 Figure S1 (A D) Tcf3, Itga4, Itga9, and Gfi1 were screened based on their significantly different expression levels between LSK/EPCR + and EPCR cells or on the significant changes observed for these genes in EPCR + cells during 2-day short culture. Dark gray bars, LSK/EPCR + cells. Light gray bars, LSK/EPCR cells. Error bars represent means ± SD (n = 2). P < 0.1, *P < 0.05.
5 A Tcf3 B Itga4 C D Itga9 * Gfi1
Supplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
More informationThe following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700
Flow cytometry analysis and cell sorting The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700 anti-cd5. (), APC-Cy7 anti-epcam (G.; Biolegend, San Diego, CA), PE-Cy7 anti-cd31
More informationIn vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *
In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,
More informationMayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:
More informationBD Pharmingen. Apoptosis, DNA Damage and Cell Proliferation Kit. Technical Data Sheet. Product Information. Description
Technical Data Sheet Apoptosis, DNA Damage and Cell Proliferation Kit Product Information Material Number: Size: Component: Description: 562253 50 Tests 51-9007685AK Apoptosis, DNA Damage and Cell Proliferation
More informationSupporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
More informationELISPOT and FLUOROSPOT kits
ELISPOT and FLUOROSPOT kits Interleukins Interferons Granzymes and perforins TNF superfamily ligands and receptors Apoptosis markers And many more... ELISPOT and FLUOROSPOT: a cell-based assay to assess
More informationEdU Flow Cytometry Kit. User Manual
User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg
More informationReal-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationFlow Cytometry Support Reagents
Excite and inspire Flow Cytometry Support Reagents Introduction Miltenyi Biotec is a leading supplier of flow cytometry products, offering one of the broadest ranges of antibodies, kits, assays, and support
More informationA Bridging Immunogenicity Assay Using SPARCL TM Technology
A Bridging Immunogenicity Assay Using SPARCL TM Technology Wenhua F. Xie Lumigen Inc., a Beckman Coulter Company INTRODUCTION Evaluating the immune response in patients is an important aspect associated
More informationCombined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections)
Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) A. Digoxigenin-UTP labeling of crna antisense probe Refer to laboratory protocol and
More information1. Paraffin section slides can be stored at room temperature for a long time.
Immunohistochemistry (IHC) Protocols Immunohistochemistry (IHC) Protocol of Paraffin Section 1. Fix dissected tissues with 10% formalin for no less than 48 hours at room temperature. Inadequately fixation
More informationQdot Conjugates Protocol Handbook
Qdot Conjugates Protocol Handbook PN 90-0153, Rev 1.2 Table of Contents Immunocytochemistry with Qdot Conjugates in Cultured Cells 2 Immunolabeling Formalin-fixed Paraffin Embedded Tissue Sections.8 Immunolabeling
More informationCorning PureCoat rlaminin-521 (Human) for Expansion and Differentiation of Human Neural Stem Cells
PureCoat rlaminin-521 (Human) for Expansion and Differentiation of Human Neural Stem Cells Application Note Audrey Bergeron 1, Hilary Sherman 1, Pilar Pardo 1, Hannah Gitschier 1, Himabindu Nandivada 2,
More informationPURPOSE: To delineate the subsets of human lymphocytes based on the expression profiles of different phenotypic markers by FACS analysis
LABORATORY PROCEDURE: IMMUNOPHENOTYPING: Lymphocyte Staining for FACS Analysis Date: April 29 2014 Authors: Jennifer Hossler PURPOSE: To delineate the subsets of human lymphocytes based on the expression
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationab BrdU Immunohistochemistry Kit
ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationMagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.
Page 1 of 2 MagniSort Mouse Hematopoietic Lineage Depletion Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse bone marrow cells were unsorted (top row) or sorted with the MagniSort
More informationSupporting Information
Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS,
More informationCF Dyes Next Generation Fluorescent Dyes Secondary antibody
CF Dyes Next Generation Fluorescent Dyes Secondary antibody OZYME 10 AVENUE AMPÈRE - CS 30268-78053 ST QUENTIN EN YVELINES CEDEX Tél. : 01 34 60 24 24 - Fax : 01 34 60 92 12 - www.ozyme.fr/info CF Dyes
More informationThe best and brightest
Labeling and Detection The best and brightest Alexa Fluor 488 dye Labeling and Detection A superior alternative to FITC Brighter conjugate fluorescence Unequalled photostability Perfect spectral match
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit
ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationEnumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry
Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Kristie M. Grebe and Terry A. Potter* (Published 10 September
More informationRespiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
More informationBrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells
K-ASSAY BrdU IHC Kit For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells Cat. No. KT-077 For Research Use Only. Not for Use in
More informationRegulatory B Cell Isolation Kit mouse
For further information refer to our website www.miltenyibiotec.com For technical questions, please contact your local subsidiary or distributor. Technical Support Team, Germany: E-mail: macstec@miltenyibiotec.de
More informationSupplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
More informationFlow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
More informationSupplemental Information. Tissue Mechanics Orchestrate Wnt-Dependent. Human Embryonic Stem Cell Differentiation
Cell Stem Cell, Volume 19 Supplemental Information Tissue Mechanics Orchestrate Wnt-Dependent Human Embryonic Stem Cell Differentiation Laralynne Przybyla, Johnathon N. Lakins, and Valerie M. Weaver Supplemental
More informationPSC 4-Marker Immunocytochemistry Kit PSC (OCT4, SSEA4) Immunocytochemistry Kit PSC (SOX2, TRA-1-60) Immunocytochemistry Kit
PSC 4-Marker Immunocytochemistry Kit PSC (OCT4, SSEA4) Immunocytochemistry Kit PSC (SOX2, TRA-1-60) Immunocytochemistry Kit Catalog no. A24881, A25526, A25525 Table 1 Contents and storage Kit component
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationCycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
More informationProtocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation
Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation In vitro neurological research presents many challenges due to the difficulty in establishing high-yield neuronal
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationLife Sciences Reporting Summary
Life Sciences Reporting Summary Corresponding author(s): George Q. Daley Initial submission Revised version Final submission Nature Research wishes to improve the reproducibility of the work that we publish.
More informationSUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases
SUPPLEMENTARY INFORMATION Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases Ruchi Bansal 1, Shigeki Nakagawa 2, Saleh Yazdani 1, Joop van Baarlen 3, Anu Venkatesh
More informationab Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit
ab64264 - Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use
More informationSUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit
SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles
More informationBD Biosciences Stem Cell Research Reagents Product List
BD Biosciences Stem Cell Research Reagents Product List For Research Use Only. Not for use in diagnostic or therapeutic procedures. Table of Contents Stem Cell Research Reagents Human Stem Cell Markers
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationImmunohistochemistry with APAAPstaining Authors
v Immunohistochemistry with APAAPstaining Authors S. Raffegerst Date 30-10-2007 Background Version 1.0 The immunohistochemistry method allows the identification of cells with expression of specific surface
More informationHuman Pluripotent Stem Cell Functional Identification Kit
Human Pluripotent Stem Cell Functional Identification Kit Catalog Number SC027B Reagents for the identification of human pluripotent stem cells by in vitro functional differentiation. This package insert
More informationInitial genotyping of all new litters was performed by Transnetyx (Memphis,
SUPPLEMENTAL INFORMATION MURILLO ET AL. SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse Genotyping Initial genotyping of all new litters was performed by Transnetyx (Memphis, USA). Assessment of LoxPpα recombination
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationEndoglin Is Essential for the Maintenance of Self-Renewal and Chemoresistance
Stem Cell Reports, Volume 9 Supplemental Information Endoglin Is Essential for the Maintenance of Self-Renewal and Chemoresistance in Renal Cancer Stem Cells Junhui Hu, Wei Guan, Peijun Liu, Jin Dai, Kun
More informationH3K27me3 Does Not Orchestrate the Expression of Lineage-Specific
Stem Cell Reports, Volume 7 Supplemental Information H3K27me3 Does Not Orchestrate the Expression of Lineage-Specific Markers in hesc-derived Hepatocytes In Vitro Jolien Vanhove, Mariaelena Pistoni, Marc
More informationManufactured by. Zyagen Barnes Canyon Road San Diego, CA 92121, USA
Alkaline Phosphatase Immunohistochemistry Detection kits For detection of mouse, rabbit, goat, rat, sheep, chicken, guinea pig, and human primary antibodies Size: 500 Tests Catalog #: AK-011, Mouse Kit
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationab Hypoxic Response Human Flow Cytometry Kit
ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting
More informationTo construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV-
Supplemental Methods: Plasmid Construction To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV- E6-AP, we used MMTVkBpA expression vector obtained from Dr. Sophia Tsai, Baylor
More informationDevelopment of new method to enrich human ipsc-derived renal progenitors using cell
Supplementary information Development of new method to enrich human ipsc-derived renal progenitors using cell surface markers Azusa Hoshina 1, Tatsuya Kawamoto 2, Shin-Ichi Sueta 1, Shin-Ichi Mae 1, Toshikazu
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationReprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells
Stem Cell Reports, Volume 8 Supplemental Information Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells with Elevated Osteogenic Potency by Defined Transcription Factors Yinxiang Wang, Ming-Hoi
More informationby Alexander Y. Rudensky (Sloan-Kettering Institute, New York). LSL-TβRI CA (TGFβR-
Materials and Methods Mice. Tgfbr2 fl/fl CD4-Cre (TGFβR-KO) mice were previously reported (3). Cre negative littermates were used as wild-type controls. DN-TGFβRII (TGFβR-DN) mice were provided by Ronald
More informationTitle. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information
Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc
More informationWhole Mount IHC Protocol
Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.
More informationPeter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre
Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,
More informationImmunohistochemistry. How does it look like? When do we need IHC? When do we need IHC? In clinic: In research:
Introduction How does it look like? Immunohistochemistry Smooth muscle actin Parvalbumin Distrophyn Sandrine Bichet Head of Molecular Histology Platform Signal versus background 06.03.2012 IHC basics Introduction
More informationProduct Datasheet. Acetylcholinesterase/ACHE Antibody (HR2) NB Unit Size: 200uL. Store at -20C. Avoid freeze-thaw cycles.
Product Datasheet Acetylcholinesterase/ACHE Antibody (HR2) NB300-528 Unit Size: 200uL Store at -20C. Avoid freeze-thaw cycles. Publications: 1 Protocols, Publications, Related Products, Reviews, Research
More informationLAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7
LAMININ For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7 TABLE OF CONTENTS BACKGROUND AND PRINCIPLE... 4 REAGENTS AND EQUIPMENT PROVIDED...
More informationAnti-BrdU (B44) Monoclonal Antibodies Detecting Cell Proliferation and Activation
Monoclonal Antibodies Detecting Cell Proliferation and Activation Anti-BrdU (B44) Form Catalog number Pure 347580 FITC 347583 Product availability varies by region. Contact BD Biosciences Customer Support
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationin-situ PCR Presented for: Presented by: Date:
in-situ PCR Presented for: Presented by: Date: 2 in situ Hybridization - Definition in situ PCR is a method in which the polymerase chain reaction actually takes place in the cell on a slide, and the product
More informationa Beckman Coulter Life Sciences: White Paper
a Beckman Coulter Life Sciences: White Paper Flow Cytometric Analysis of Endothelial Progenitor Cells Authors: Affiliation: Dorota Sadowicz, Vasilis Toxavidis, John Tigges Beth Israel Deaconess Medical
More informationSecondary Reagents. Secondary Reagents. biolegend.com 551
Anti-Hamster IgG (Armenian)................. 552 Anti-Hamster IgG (Syrian)...................... 552 Anti-Human Ig light chain κ................... 552 Anti-Human Ig light chain λ................... 552
More informationScaffolding for human pluripotent stem cell lineage specification
University of Arkansas, Fayetteville ScholarWorks@UARK Biological and Agricultural Engineering Undergraduate Honors Theses Biological and Agricultural Engineering 5-2013 Scaffolding for human pluripotent
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationTSA Signal Amplification (TSA) Systems. See the difference with TSA the ultimate technology for unparalleled detection sensitivity
Signal Amplification () Systems See the difference with the ultimate technology for unparalleled detection sensitivity or unparalled sensitivity, technology Increase your immunohistochemistry and in situ
More informationab TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni)
ab183287 TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni) Instructions for Use For the detection of Rabbit and Mouse Primary antibodies on Human tissue or cell samples. This product is
More informationHEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified
Additional methods: HEK293A and C7 cell cultures HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified Eagle s medium (DMEM) with GlutaMAX I (Invitrogen, Cergy Pontoise, France),
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationFigure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
More informationSupplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
More informationAnti-Piscirickettsia salmonis monoclonal antibody. Product no: P05
Anti-Piscirickettsia salmonis monoclonal antibody Product no: P05 Product Description The monoclonal antibody (Mab) against Piscirickettsia salmonis is specific for this bacterium. The specificity of the
More informationPurification Kits. Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET
 Montage Antibody Purification Kits Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET Available with immobilized Protein A or Protein G Easy-to-use Antibody
More informationGENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,
GENESDEV/2007/089581 Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 2 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 3 Elkabetz et al., GENESDEV/2007/089581
More informationUpdated April 27, PRODUCT INSERT
Updated April 27, 2009 1 PRODUCT INSERT Hypoxyprobe, Inc. 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Gemini Kit Kit Contents: Solid pimonidazole HCl (Hypoxyprobe -1)
More informationIsolation and Analysis of Pluripotent, Neural, and Hematopoietic Stem Cells
Isolation and Analysis of Pluripotent, Neural, and Hematopoietic Stem Cells Christian Carson BD Biosciences R&D Scientist Stem Cell 23-10679-00 Overview Introduction Challenges in stem cell research Antibody
More informationAutomated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis
A p p l i c a t i o n N o t e Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Asha Sinha
More informationFLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range
FLUORESCENT PEPTIDES Peptides and amino acids labeled with and Tide Quencher TM We offer peptides and amino acids tagged with fluorescent dyes. They meet highest demands in fluorescence intensity and photo-stability,
More informationProduct Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris
Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationMaterials and Methods Materials Required for Fixing, Embedding and Sectioning. OCT embedding matrix (Thermo Scientific, LAMB/OCT)
Page 1 Introduction Tissue freezing and sectioning is a rapid method of generating tissue samples (cryosections) for histological analysis, and obviates the need for wax embedding. The method is popular
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationAPPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications. Physical and Fluorescence Properties
APPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications Fluorescent nanodiamonds (FNDs) offer a unique alternative to currently existing fluorescent biomarkers. With exceptional photo
More information