STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
|
|
- Lindsey Parsons
- 6 years ago
- Views:
Transcription
1 STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from The GeneChip high-density oligonucleotide arrays are fabricated by using in-situ synthesis of short oligonucleotide sequences on a small glass chip using light directed synthesis. This technique allows for the precise construction of a highly ordered matrix of DNA oligomers on the chip. In the GeneChip system a known gene or potentially expressed sequence is represented on the chip by unique oligomeric probes, each 25 bases in length. The group of probes corresponding to a given gene or small group of highly similar genes is known as the probe set and generally spans a region of about 600 bases, known as the target sequence. Many copies of each oligomer are synthesized in discrete features (or cells) on the GeneChip array. In addition, for each oligomer on the array there is a matched oligomer, synthesized in an adjacent cell that is identical with the exception of a mismatched base at the central position (i.e. base 13). These are designated Perfect Match (PM) and Mismatch (MM) probes, respectively. The MM probes serves as a control for non-specific hybridization.
2 Appendix (optional) Assay Overview The GeneChip arrays are scanned and the images processed using Affymetrix software, Microarray Suite (MAS 5.0). For more information on the GeneChip expression assay, please see
3 Data Overview Affymetrix GeneChip experiments are managed with the Affymetrix Microarray Suite (MAS 5.0) software. The MAS software interfaces with equipment to run a probe array experiment and is also used to generate preliminary analysis data from an experiment. Below we cover the basics of files generated by MAS 5.0 and also explain some of the most widely used variables generated by MAS. MAS File Types There are five file types that MAS 5.0 generates during the process of a GeneChip Array experiment. They are as follows: Experiment File *.EXP: This file contains the parameters of the experiment such as Probe Array Type, Experiment Name, Equipment parameters, Sample Description, and others. This file is not used for analysis, but is required to open other MAS files for the designated chip experiment. Image Data File *.DAT: This file is the image file generated by the scanner from the Probe Array after processing on the Fluidics Station. This file can be viewed in MAS 5.0 or exported as a *.TIFF image. This file is used in MAS 5.0 to generate the *.CEL file (see below). Cell Intensity File *.CEL: The cell file contains the processed cell intensities from the primary image in the *.DAT file. The cell file can be viewed in MAS 5.0, but cannot be exported. The cell file is used by MAS 5.0 to generate the *.CHP file, which contains the numerical data from the *.DAT, and *.CEL files. Probe Array Results File *.CHP: The chip file is the output file from the MAS expression analysis of the Probe Array. The chip file contains the data that will be used for statistical analysis and data mining analysis. Report File *.RPT: The report file is generated from the chip file. This expression report summarizes information about expression analysis settings and probe set hybridization intensity data. MAS Analysis Metrics Signal: a measure of the abundance of transcript Detection: the call that indicates whether the transcript is detected (P present), undetected ( A, absent), or at the limit of detection (M, marginal). Detection p-value: p-value that indicates the significance of the detection call. Signal Log Ratio: the change in expression level of a transcript between a baseline and an experiment array. This change is expressed as the log2 ratio. A log2 ratio of 1 is equal to a fold change of 2. Change: the call that indicates the change in the transcript level between a baseline and experiment (increase (I), marginal increase (MI), no change (NC), marginal decrease (MD), decrease (D)). Change p-value: p-value that indicates the significance of the change call. Each probe set on a GeneChip array has a unigue name known as the Probe set ID. Probe set ID's have different extensions that denote important information about how the probe set was designed.. The nomenclature for the probe set extensions are below.
4 Probe Set Extension Nomenclature All probe sets have one of the following two extensions: _at : anti-sense target (most probe sets on the array) _st : sense target (only some control probes are in sense orientation on the array) A few probe sets are designated as follows: _i : reduced number of pairs in the probe set. Some probe sets represent more than one gene or EST: _s_at : designates probe sets that share common probes among multiple transcripts from different genes. _a_at : designates probe sets that recognize multiple alternative transcripts from the same gene (on HG-U133 these probe sets have an "_s" suffix). _x_at : designates probe sets where it was not possible to select either a unique probe set or a probe set with identical probes among multiple transcripts. Rules for cross-hybridization were dropped. Therefore, these probe sets may cross-hybridize in an unpredictable manner with other sequences. _g_at : similar genes, also unique probe sets elswhere on the array. _f_at : similarity rules dropped, probe set will recognize more than one gene. _i_at : designates sequences for which there are fewer than the required numbers of unique probes specified in the design. _b_at : all probe selection rules were ignored. Withdrawn from GenBank. _l_at : sequence represented by more than 20 probe pairs. _r_ : designates sequences for which it was not possible to pick a full set of unique probes using Affymetrix probe selection rules. Probes were picked after dropping some of the selection rules. Most of the descriptions for the probe set ID extensions above were taken from the Affymetrix GeneChip Expression Analysis Data Analysis Fundamentals. Glossary of Analysis Terms Target: Fragmented, biotinylated anti-sense crna prepared from mrna to be analyzed. Target molecules are hybridized to the probe array and the levels of hybridization are measured with the GeneArray scanner after the array is stained with streptavidin-phycoerythrin (SAPE). Probe: Single-stranded DNA oligonucleotide synthesized directly on the surface of the GeneChip array using photolithography and combinatorial chemistry. The 25 base oligonucleotide is designed to be complementary to a specific gene transcript. Probe Cell: Single square-shaped feature on an array containing probes with a unique sequence. The size can vary depending on the array type, typically 20 µm or 18 µm. Each probe cell contains millions of probe molecules. Perfect Match (PM): Probes that are designed to be complementary to a reference sequence. Mismatch (MM): Probes that are designed to be complementary to a reference sequence except for a homomeric mismatch at the central position (e.g., 13th position of 25 base probe. A->T or G->C). Mismatch probes serve as a control for cross-hybridization. Probe Pair: Two probe cells, a PM and its corresponding MM. On the probe array, a probe pair is arranged with
5 a PM cell directly above a MM cell. Probe set: A set of probes designed to detect one transcript. A probe set usually consists of probe pairs. For example, an 11 probe pair set is made up of 11 PM probes and 11 MM probes for a total of 22 probe cells. Newer array designs from Affymetrix, e.g., HG-U133, contain probe sets with 11 probe pairs. Older designs have average probe set numbers of 16 or 20 probe pairs. Target Sequence: The portion of a transcript reference sequence that is interrogated by a probe set on the array. The target sequence extends from the first base of the most 5 probe to the last base of the most 3 probe. Absolute Analysis: This is an analysis of a single GeneChip array using Affymetrix Microarray Suite software. The software applies an algorithm developed by Affymetrix to determine the expression level for each gene represented on the array. Analysis Metrics: Probe set performance descriptors calculated by the software from measured probe cell intensities. Analysis metrics are used to determine biologically meaningful results, such as the presence or absence of gene transcripts. Analysis Parameters: Variables with user-defined values used in the expression analysis (default values in the software are empirically determined at Affymetrix). *More extensive glossaries can be found in Statistical Algorithms Reference Guide and Data Analysis Fundamentals, available on the Affymetrix website (
Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
Preprocessing Affymetrix GeneChip Data Credit for some of today s materials: Ben Bolstad, Leslie Cope, Laurent Gautier, Terry Speed and Zhijin Wu Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationProbe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.
Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies. References Summaries of Affymetrix Genechip Probe Level Data,
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationTechnical Note. Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip Scanner Introduction
GeneChip AutoLoader AFFYMETRIX PRODUCT FAMILY > > Technical Note Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip ner 3000 Designed for use with the GeneChip ner 3000, the GeneChip
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationPredicting Microarray Signals by Physical Modeling. Josh Deutsch. University of California. Santa Cruz
Predicting Microarray Signals by Physical Modeling Josh Deutsch University of California Santa Cruz Predicting Microarray Signals by Physical Modeling p.1/39 Collaborators Shoudan Liang NASA Ames Onuttom
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationData Sheet. GeneChip Human Genome U133 Arrays
GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array
More informationBioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationSPH 247 Statistical Analysis of Laboratory Data
SPH 247 Statistical Analysis of Laboratory Data April 14, 2015 SPH 247 Statistical Analysis of Laboratory Data 1 Basic Design of Expression Arrays For each gene that is a target for the array, we have
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationIntroduction to microarrays. Overview The analysis process Limitations Extensions (NGS)
Introduction to microarrays Overview The analysis process Limitations Extensions (NGS) Outline An overview (a review) of microarrays Experiments with microarrays The data analysis process Microarray limitations
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationOriginal summary generated in 2003 Updated in 2007
AFFYMETRIX ARABIDOPSIS GENOME ARRAY DESIGN, ANNOTATION, AND ANALYSIS Original summary generated in 2003 Updated in 2007 Brandon Le Javier Wagmaister Anhthu Bui Arabidopsis Array Annotation 1 TABLE OF CONTENTS
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationDNA Microarray Data Analysis and Mining: Affymetrix Software Package and In-House Complementary Packages
University of New Orleans ScholarWorks@UNO University of New Orleans Theses and Dissertations Dissertations and Theses 12-19-2003 DNA Microarray Data Analysis and Mining: Affymetrix Software Package and
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationHumboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationAFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs:
Date: AFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs: Note: This protocol is slightly modified from the general protocol for the biotin-labeled cdna generated
More informationGeneChip Eukaryotic Small Sample Target Labeling Assay Version II *
GENE EXPRESSION MONITORING TECHNICAL NOTE GeneChip Eukaryotic Small Sample Target Labeling Assay Version II * Introduction There is an overwhelming and continuing demand for a well characterized protocol
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationGene Signal Estimates from Exon Arrays
Gene Signal Estimates from Exon Arrays I. Introduction: With exon arrays like the GeneChip Human Exon 1.0 ST Array, researchers can examine the transcriptional profile of an entire gene (Figure 1). Being
More informationWhat does PLIER really do?
What does PLIER really do? Terry M. Therneau Karla V. Ballman Technical Report #75 November 2005 Copyright 2005 Mayo Foundation 1 Abstract Motivation: Our goal was to understand why the PLIER algorithm
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationDescription of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data
Description of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data Tobias Guennel October 22, 2008 Contents 1 Introduction 2 2 What s new in this version 3 3 Preparing data for use
More informationAnalyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek
Analyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek This example data set consists of 20 selected HapMap samples, representing 10 females and 10 males, drawn from a mixed ethnic population of
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationFrequently Asked Questions
Frequently Asked Questions CytoScan Assay and CytoScan 750K Array Equipment requirements 1. What is the CytoScan Assay? The CytoScan Assay, along with the CytoScan 750K Arrays, the GeneChip Command Console
More informationParameter Estimation for the Exponential-Normal Convolution Model
Parameter Estimation for the Exponential-Normal Convolution Model Monnie McGee & Zhongxue Chen cgee@smu.edu, zhongxue@smu.edu. Department of Statistical Science Southern Methodist University ENAR Spring
More informationOptimized in situ construction of oligomers on an array surface
ã 2002 Oxford University Press Optimized in situ construction of oligomers on an array surface Andrew C. Tolonen*, Dinu F. Albeanu 1, Julia F. Corbett 2, Heather Handley, Charlotte Henson 3 and Pratap
More informationUse of DNA microarrays, wherein the expression levels of
Modeling of DNA microarray data by using physical properties of hybridization G. A. Held*, G. Grinstein, and Y. Tu IBM Thomas J. Watson Research Center, Yorktown Heights, NY 10598 Communicated by Charles
More informationDNA Microarray Experiments: Biological and Technological Aspects
DNA Microarray Experiments: Biological and Technological Aspects Danh V. Nguyen 1, A. Bulak Arpat 2, Naisyin Wang 1, and Raymond J. Carroll 1 1 Department of Statistics, Texas A&M University, College Station,
More informationChromosome Analysis Suite 3.0 (ChAS 3.0)
Chromosome Analysis Suite 3.0 (ChAS 3.0) FAQs related to CytoScan Cytogenetics Suite 1. What is required for processing and viewing CytoScan array CEL files? CytoScan array CEL files are processed and
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationCS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer
CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer T. M. Murali January 31, 2006 Innovative Application of Hierarchical Clustering A module map showing conditional
More informationADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA
ADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA Veera Baladandayuthapani & Kim-Anh Do University of Texas M.D. Anderson Cancer Center Houston, Texas, USA veera@mdanderson.org Course Website: http://odin.mdacc.tmc.edu/
More informationAgilent Genomic Workbench 7.0
Agilent Genomic Workbench 7.0 Product Overview Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means (including electronic
More informationAnalysis of a Tiling Regulation Study in Partek Genomics Suite 6.6
Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6 The example data set used in this tutorial consists of 6 technical replicates from the same human cell line, 3 are SP1 treated, and 3
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationIdentifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering
More informationCalculation of Spot Reliability Evaluation Scores (SRED) for DNA Microarray Data
Protocol Calculation of Spot Reliability Evaluation Scores (SRED) for DNA Microarray Data Kazuro Shimokawa, Rimantas Kodzius, Yonehiro Matsumura, and Yoshihide Hayashizaki This protocol was adapted from
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationMicroarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6
Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationSpotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003
Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted
More informationClass Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1
This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationIntelligent DNA Chips: Logical Operation of Gene Expression Profiles on DNA Computers
Genome Informatics 11: 33 42 (2000) 33 Intelligent DNA Chips: Logical Operation of Gene Expression Profiles on DNA Computers Yasubumi Sakakibara 1 Akira Suyama 2 yasu@j.dendai.ac.jp suyama@dna.c.u-tokyo.ac.jp
More informationUniversity of Groningen
University of Groningen Evaluation of an Affymetrix High-density Oligonucleotide Microarray Platform as a Measurement System van den Heuvel, Edwin; Geeven, Geert; Bauerschmidt, Susanne; Polman, Jan E.M.
More informationExploration and Analysis of DNA Microarray Data
Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate
More informationImproving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
More informationHuman SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationCancer Detection and Prevention 27 (2003)
Cancer Detection and Prevention 27 (2003) 405 411 Direct comparison of microarray gene expression profiles between non-amplification and a modified cdna amplification procedure applicable for needle biopsy
More informationMentor: Dr. Bino John
MAT Shiksha Mantri Mentor: Dr. Bino John Model-based Analysis y of Tiling-arrays g y for ChIP-chip X. Shirley Liu et al., PNAS (2006) vol. 103 no. 33 12457 12462 Tiling Arrays Subtype of microarray chips
More informationUniversal Gene Expression Analysis with Combinatorial Arrays
229 Chapter 8 Universal Gene Expression Analysis with Combinatorial Arrays 8.1 Introduction The ability of DNA microarrays to simultaneously measure thousands of binding interactions has led to their rapid
More informationGeneChip TM WT Terminal Labeling and Hybridization User Manual
GeneChip TM WT Terminal Labeling and Hybridization User Manual for use with the Ambion TM WT Expression Kit User Manual For Research Use Only. Not for use in diagnostic procedures. Information in this
More informationBABELOMICS: Microarray Data Analysis
BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà mmarba@cipf.es Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain) DNA Microarrays
More informationDNA CHIPS- Technology and Utility
DNA CHIPS- Technology and Utility Yanal Alkuddsi Ph.D Student Dept. of Genetics and Plant Breeding University of Agricultural Sciences Dharwad, Karnataka, India, 580005 1.INTRODUCTION CONTENT 2.MICROARRAYS:
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/313/5795/1929/dc1 Supporting Online Material for The Connectivity Map: Using Gene-Expression Signatures to Connect Small Molecules, Genes, and Disease Justin Lamb, *
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationPhilippe Hupé 1,2. The R User Conference 2009 Rennes
A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech
More informationIntroduction to Molecular Biology
Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve
More informationDNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007
DNA Microarrays Introduction Part 2 Todd Lowe BME/BIO 210 April 11, 2007 Reading Assigned For Friday, please read two papers and be prepared to discuss in detail: Comprehensive Identification of Cell Cycle-related
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationNew Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data
Application Note GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T GATCCTTC T G AAC GGAAC T AATTTC AA G AATCTGATCCTTG AACTACCTTCCAAGGTG New Stringent Two-Color Gene Expression Workflow Enables More
More informationEstimating Cell Cycle Phase Distribution of Yeast from Time Series Gene Expression Data
2011 International Conference on Information and Electronics Engineering IPCSIT vol.6 (2011) (2011) IACSIT Press, Singapore Estimating Cell Cycle Phase Distribution of Yeast from Time Series Gene Expression
More informationRelative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)
The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification
More informationQuality Measures for CytoChip Microarrays
Quality Measures for CytoChip Microarrays How to evaluate CytoChip Oligo data quality in BlueFuse Multi software. Data quality is one of the most important aspects of any microarray experiment. This technical
More informationMODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationHigh-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours
High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As
More informationAnalysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs15.html Gene Expression q Process of transcription
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationincluding, but not limited to:
*This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not
More informationFeature Selection of Gene Expression Data for Cancer Classification: A Review
Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression
More informationARTICLES. Direct multiplexed measurement of gene expression with color-coded probe pairs
Direct multiplexed measurement of gene expression with color-coded probe pairs Gary K Geiss, Roger E umgarner 2, rian irditt, Timothy Dahl, Naeem Dowidar, Dwayne L Dunaway, H Perry Fell, Sean Ferree, Renee
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More information