AEM Accepts, published online ahead of print on 18 April 2008 Appl. Environ. Microbiol. doi: /aem

Transcription

1 AEM Accepts, published online ahead of print on 18 April 2008 Appl. Environ. Microbiol. doi: /aem Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Chitin hydrolysis by Listeria spp. including L. monocytogenes J.J. Leisner *, M.H. Larsen, R.L. Jørgensen, L. Brøndsted, L.E. Thomsen, and H. Ingmer Department of Veterinary Pathobiology, Faculty of Life Sciences, University of Copenhagen, Copenhagen, Denmark Running title: Chitin hydrolysis by Listeria Keywords: Listeria, chitinase, natural environment, invertebrates, hydrolytic activity * Corresponding author: J.J. Leisner Department of Veterinary Pathobiology, Faculty of Life Sciences, University of Copenhagen, Grønnegårdsvej 15, 1870 Frederiksberg C., Denmark jjl@life.ku.dk Telephone: Fax:

2 ABSTRACT Listeria spp., including the food borne pathogen Listeria monocytogenes are ubiquitous micro organisms in the environment and thus are difficult to exclude from food processing plants. The factors that contribute to their multiplication and survival in nature are not well understood but the ability to catabolize various carbohydrates is likely to be very important. One major source of carbon and nitrogen in nature is chitin, an insoluble linear β-1,4-linked polymer of N- acetylglucosamine (GlcNAc). Chitin is found in cell walls of fungi and certain algae, in the cuticles of arthropods and in shells and radulae of molluscs. In the present study we demonstrate that Listeria monocytogenes and other Listeria spp. are able to hydrolyze α-chitin. The chitinolytic activity is repressed by presence of glucose in the media suggesting that chitinolytic activity is subjected to catabolite repression. Activity is also regulated by temperature and is higher at 30 o C compared to 37 o C. In L. monocytogenes EGD chitin hydrolysis depends on genes encoding two chitinases, lmo0105 (chib) and lmo1883 (chia) but not on a gene, lmo2467, encoding a putative chitin binding protein. The chib and chia genes are phylogenetically related to various well characterized chitinases. The potential biological implications of chitinolytic activity of Listeria are discussed.

3 INTRODUCTION Listeria spp., including Listeria monocytogenes are ubiquitous micro organisms in the environment including soil, vegetation, sewage, fresh and low salinity water (30) and thus are difficult to exclude from food processing plants. L. monocytogenes subtypes differ in their associations with different environments (26, 31) which may be related to differences in the ability to survive in nature, though so far these mechanisms are not well understood (30). However, with respect to energy-yielding substrates the ability to catabolize various carbohydrates must play an important role. As an example, the predominance of the xylose fermenting Listeria ivanovii opposed to other listerial species in a sawmill has been interpreted in terms of availability of xylose, a wood breakdown product (5). In the present study we have focused on the ability of Listeria spp. to hydrolyse chitin, the second most common carbohydrate in the environment and a major source of carbon and nitrogen (3, 10). Chitin is an insoluble linear β-1,4-linked polymer of N-acetylglucosamine (GlcNAc) and it is a component in e.g. cell walls of fungi and certain algae, in the cuticles of arthropods, in the peritrophic membranes of annelids and some arthropods as well as in shells and radulae of molluscs (3, 10). Chitinolytic bacteria are ubiquitous in the aqueous environment and their ability to degrade chitin are important for their interactions with zooplankton (22). For terrestrial bacteria, chitin hydrolysis may be important if arthropods are host organisms (8). This activity may also play a role as an antagonistic tool towards fungi as shown for various bacteria including Firmicutes (42). In addition, it is possible that chitin, present in sediments and soil, serve as a convenient substrate for saprophytic bacteria as a result of arthropod decomposition (10). Presently, we show for the first time that various Listeria spp. are chitinolytic and in L. monocytogenes EGD we have identified two genes lmo0105 and lmo1883 now designated chib and chia that are required for chitinolytic activity.

4 MATERIALS AND METHODS Examination of chitinase and cellulase activities. Listeria cultures were inoculated on a basic chitin medium (BCM) agar lawn containing g l -1 tryptone 10.0, yeast extract 5.0, NaCl 10.0, agar 15.0, α-chitin 2.5 (Sigma C9752, from crab-shell) and with phosphate buffer, ph 6.9, incubated under aerobic or under microaerophilic conditions at 10, 30 or 37 o C and scored for hydrolytic ability (clearing zones) for up to 22 d. The effect of added glucose was tested by use of buffered BCM with 0.5% glucose and Tryptone Soy Agar (TSA; Oxoid CMO131) with added 2.5 g l -1 chitin and with or without 0.4% glucose for a selection of species and strains during incubation at 30 and 37 o C. Tests were performed as at least three independent replicas. Identification and phylogenetic analyses of genes encoding putative chitinases and chitin- binding proteins in Listeria spp. We used an authorative on-line resource describing the classification of known glycosyl hydrolases and carbohydrate binding proteins to identify chitinases and chitin-binding proteins in published genome sequences of Listeria spp. ( The chitinase genes lmo0105 (AL591973) and lmo1883 (AL591981) and a gene encoding a chitin-binding protein lmo2467 (AL591983) from the genome sequenced L. monocytogenes EGD-e strain (9) were used as probes to search for similar sequences using the microbial resource Blast at National Center for Biotechnology Information (ncbi; A selection of up to sequences most similar to the EGD-e genes were selected for further phylogenetic analyses in addition to sequences representative of other bacterial or eukaryotic groups and, finally, sequences representing bacteria with well characterized chitinolytic systems including Bacillus circulans WL-12 (38, 39, 40), Vibro cholerae 01 biovar eltor str. N16961 (12, 19) and Vibrio harveyi BB7 (34). Protein

5 domain predictions including determination of the glycosyl hydrolase family 18 (glyco_18) domain were obtained from ncbi as well as from Signal peptide predictions were performed using SignalP 3.0 from Center for Biological Sequence Analysis, BioCentrum-DTU, Technical University of Denmark ( Glyco_18 domains of sequences selected from BLAST searches were aligned to the glyco_18 domains of lmo0105 (aa ) and lmo1883 (aa ). Alternatively the entire sequences were aligned to the entire sequences of lmo0105, lmo1883 and lmo2467. Phylogenetic trees were constructed by the neighbour-joining method using the Clustal X (1.81, (36)) and the MEGA version 4 (35) software packages with default settings. Presence of lmo0105 and lmo1883 related sequences in L. monocytogenes F2365 were examined by PCR and use of the following primers: Lmo0105-fo: 5 ttacggtgattggtcga 3, Lmo0105-re: 5 ccacgccttgtttatcca 3, Lmo1883-fo: 5 cttttggcaataggtgga 3, Lmo1883-re: 5 catccacattggctggta 3. Construction of deletion mutants To examine the effect of the genes annotated as catalysing chitin degradation (lmo0105, lmo1883) or adherence (lmo2467) on the chitinolytic phenotype, mutants of L. monocytogenes EGD with deletions in one of each gene were constructed in addition to a double mutant lacking both presumed chitinase genes. In-frame deletions in the coding region of lmo0105, lmo1883 and lmo2467 were constructed by the gene splicing of overlap extension method (11). Primers were designed to amplify two fragments, one comprising the 5 end of the gene and upstream sequences (primers lmoxx-a and lmoxx-b) and the other comprising the 3 end of the gene and downstream sequences (primers lmoxx-c and lmoxx-d)(table 2). The fragments were joined to create PCR fragments containing 2226 bp, 1011 bp and 1392 bp in-frame deletions of the lmo0105, lmo1883

6 and lmo2467 genes, respectively. These PCR products were cloned into pcr2.1-topo (Invitrogen) and thereafter cloned into the BamHI and XbaI restriction endonuclease sites of the temperaturesensitive shuttle vector paul-a (4). Subsequent electroporation and double crossover were performed as described previously (18). The lmo0105, lmo1883 double mutant were constructed in the lmo0105 deletion strain by electroporation and double crossover with paul-a with the lmo1883 deletion PCR fragment. The mutated alleles were sequenced to verify the presence of inframe deletions of 2226 bp, 1011 bp and 1392 bp in the coding region of the lmo0105, lmo1883 and lmo2467 genes, respectively, of the mutants. Growth of L. monocytogenes EGD and mutant strains Aliquots of five ml of BCM without chitin but with added 0.2% glucose or 0.2% GlcNAc and BHI broths were used as media to compare growth responses of cultures inoculated at an initial OD of 0.1 and incubated either as static or shaken cultures at 30 o C. Growth was measured at OD 600. RESULTS Screening of chitinase and cellulase activities among Listeria spp. We investigated the presence of chitinase activity among 28 strains of all six Listeria spp. using a plate assay based on chitin containing agar plates. We found chitinolytic activity for all three genome sequenced strains L. innocua Clip 11262, L. monocytogenes EGD and L. welshimeri LMG T, delayed activity for strains of Listeria ivanovii and Listeria seeligeri but no activity for Listeria grayi (Table 1, Fig. 4). Indeed, the ability to hydrolyze chitin is common for a wide range of L. monocytogenes strains with NCTC 7973 and F2365 as the lone exceptions (Table 1). Homologues of lmo105 and lmo1883 are found in the genome of L. monocytognes F2365 and presence of these genes in our strain of F2365 was shown by PCR (data not shown).

7 lmo0105 and lm01883 encode L. monocytogenes EGD chitinases. The majority of bacterial chitinases belong to glycosyl family 18 hydrolases and two members of this family (lmo0105 and lmo1883 in L. monocytogenes EGD) are found for all listed genome sequenced isolates of L. innocua (Clip 11262), L. monocytogenes (e.g. 4b H7858, HPB2262, FSL N1-017, 10403S, 1/2a F6854, FSL N3-165, F6900, J0161, J2818, EGD-e and F2365) and L. welshimeri (LMG T ). In addition, all sequenced isolates carry one gene annotated as a carbohydrate binding family 33 module (e.g lmo2467 in L. monocytogenes EGD-e) possibly involved in chitin binding. In all cases these genes are not organized in an operon but located far apart on the genome. The lmo0105 gene encodes a 756 aa protein with a 24 aa signal peptide and include a 398 aa N-terminal glycosyl hydrolase family 18 domain and a 41 aa family 5 carbohydrate-binding module. The lmo1883 gene encodes a 352 aa protein with a 283 aa glycosyl hydrolase family 18 domain and with a 29 aa signal peptide but contain no carbohydrate-binding module. The lmo2467 gene encodes a 476 aa protein with a 29 aa signal peptide that includes four domains, three of which is characterized as chitin- or chitin/cellulose binding domains and the fourth encodes a sequence homologous to fibronectin type III domains. In order to study the contribution of the individual genes lmo0105, lmo1883 and lmo2467 to the chitinolytic activity of L. monocytogenes we inactivated these genes by introducing in-frame deletions and compared the chitinolytic activity of the resulting mutants with the wild type. Interestingly, the chitinolytic activity was completely abolished in the strain lacking lmo0105 ( lmo0105) and it was partially reduced in the lmo1883 strain. In contrast, deletion of lmo2467 had no effect on the ability to hydrolyse chitin (Fig. 1). As expected, no chitinolytic activity was observed in a mutant strain where both lmo0105 and lmo1883 had been deleted. The differences in chitinolytic activities revealed by EGD wild type and mutant strains were not due to differences in

8 growth rates as all strains showed similar growth in BHI and in BCM without chitin but supplemented with 0.2% glucose or 0.2% GlcNAc (results not shown). Thus, both lmo0105 and lmo1883 are necessary for the wild-type chitinolytic phenotype and therefore we designate lmo0105 as chib and lmo1883 for chia. Phylogenetic analyses of ChiB, ChiA and putative chitin-binding proteins in Listeria spp. The gene products of chib (lmo0105), chia(lmo1883) and lmo2467 of L. monocytogenes EGD-e are closely related to homologous proteins in other Listeria species and strains of L. monocytogenes (Fig. 2 and 3 and results not shown) but their phylogenetic relation to similar proteins in other bacterial genera are very different. The sequence of the putative catalytic region embedded in the glycohydrolase 18 family domain (glyco_18 domain, aa ) of chib(lmo0105) is similar to group III as outlined by Svitil and Kirchman (34) that include firmicute chitinases. In agreement with this result, the ChiB glyco_18 domain is related to a well characterized chitinase produced by Clostridium paraputrificium (25) and a hypothetical protein encoded by the related Eubacterium ventriosum followed by a lower degree of similarities to a large group of gene products annotated as chitinases in other Clostridium spp. albeit without strong bootstrap support (Fig. 2). More distantly related glyco_18 domain sequences annotated as chitinases were also found for various Bacillus spp. including the well-characterized chitinase A-1 produced by Bacillus circulans WL-12 (38, 39) and various Vibrio spp. and Shewanella spp. (Fig. 2). A phylogenetic analysis of the entire L. monocytogenes ChiB (lmo0105 gene product) gave essential the same result (results not shown). Opposed to ChiB, the sequence of the putative catalytic region encoded by chia (lmo1883) is similar to group IV as outlined by Svitil and Kirchman (34). The glyco_18 domain (aa ) of L. monocytogenes ChiA comprises most of the sequence of this protein and is related to the glyco_18 domain of Enterococcus faecalis V583 EF0361 gene product. More distantly related

9 glyco_18 domain gene products are encoded by Serratia marcescens, Lactococcus lactis, Pseudomonas spp., Vibrio spp. including the well characterized Chi A chitinase produced by Vibrio harveyi (34) and other bacterial genera (Fig. 3). The entire lmo2467 sequence is related to genes annotated as chitin-binding proteins encoded by various lactic acid bacteria (LAB) including Enterococcus faecalis V583, Enterococcus faecium DO, Lactobacillus sakei subsp. sakei 23K and Lactobacillus plantarum WCFS1 and more remotely related to genes encoded by a variety of other bacteria (results not shown). Effect of temperature, glucose and growth medium on chitin hydrolysis by Listeria. With the aim of determining how environmental conditions affect the chitinolytic activity of Listeria ssp. we examined chitinase activity at various temperatures and in the presences of glucose. We observed chitin hydrolysis at 10 o C, 30 o C and 37 o C (Table 1) but the activity was in general diminished at 37 o C and was very low at this temperature for strains L. monocytogenes 4239 and LO28 as well as L. ivanovii Div-B1 and absent for L. seeligeri LMG (Table 1, Fig. 4 and data not shown). Also at 10 o C the activity was reduced, but at this temperature growth was also reduced (results not shown). The effect of glucose on chitinolytic activity was examined for six strains: L. innocua Clip 11262, L. monocytogenes 4446, Scott A and EGD, L. seeligeri LMG and L. welshimeri LMG T. Addition of 0.4 % glucose to TSA chitin agar plates reduced the clearing zones of all examined strains, although the level of reduction varied between strains (Fig. 4). Addition of 0.5 % glucose to BCM gave similar results (results not shown). DISCUSSION This study demonstrates that many species of Listeria possess chitinolytic activity and that the chitinase encoded by lmo0105 in L. monocytogenes EGD is necessary for chitinolytic activity

10 whereas the chitinase encoded by lmo1883 is required for maximum activity. Consequently lmo0105 was designated chib and lmo1883 was designated chia. The chitinolytic ability was shown to be common for a wide range of Listeria species and strains. Generally, Listeria spp. hydrolyzed chitin at 10, 30 and 37 o C although the activity was reduced at 10 and 37 o C. Furthermore, addition of glucose to chitin agar plates reduced in overall the size of the clearing zones suggesting that the chitinase activity is subjected to catabolite repression mediated by easily fermentable carbohydrates and regulated by temperature. Only L. grayi LMG16491 and two L. monocytogenes strains (NCTC 7973 and F2365) could not hydrolyse chitin (Table 1). While L. monocytogenes NCTC 7973 is anomalous regarding the effect of carbohydrates on virulence gene expression (24), L. monocytogenes F2365 is known to carry several mutations (27). When examining the genome sequence for L. monocytogenes F2365 in more detail we found that ChiB in this strain harbours two conserved and one non-conserved amino acid substitutions, while the F2365 ChiA exhibited four non-conserved substitutions comparatively to the L. monocytogenes EGD-e strain. None of the substitutions are located in the conserved sequences of the putative catalytic regions of these proteins. The F2365 homologue to the lmo2467 gene product shows a larger number of substitutions including 14 conserved and 19 non-conserved; however, this protein was shown in this study not to be necessary for chitinase activity by the EGD strain. The promoter regions of F 2365 chib and chia do not show any divergence in sequences with EGD-e. PCR using primer sequences for lmo0105 and lmo1883 revealed the presence of fragments with predicted sizes, showing that sequences encoding chib and chia indeed appear to be present in the L. monocytogenes F2365 strain included in this study. Taken together, these results indicate the lack of chitinolytic activity of the F2365 strain is not due to the mutations in coding and upstream sequences of the two chitinase genes but probably is a result of changes in regulatory genes located elsewhere in the genome. In support of this notion,

11 a specific ATP-dependant HPr kinase/phosphorylase, which is stimulated by intermediates of the glycolytic pathway, represses expression of both lmo0105 and lmo1883 (23) and a number of genes, including ccpa, sigb and MogR affects the expression of lmo1883 (15, 23, 32). Using bioinformatic tools we investigated the putative functional domains of ChiB and ChiA. The group III ChiB (Lmo0105) chitinase of L. monocytogenes EGD-e contains both a catalytic Glyco_18 domain and a chitin-binding family 5 module. The central role of the ChiB chitinase for enzymatic activity towards native chitin found in our study resembles the results obtained for the related C. paraputrificium ChiB and B. circulans WL-12 A-1 chitinases (Fig. 2)(25, 38). Both of these enzymes contain a carbohydrate domain that is important for activity towards native chitin but not processed chitin such as colloidal chitin. It is intriguing that the group IV ChiA (Lmo1883) chitinase only contains a catalytic Glyco_18 domain and not a chitin-binding domain, which may explain the limited chitinolytic activity of the mutant strain that expresses only ChiA and not the ChiB chitinase (Fig. 1). In agreement with the group III C. paraputrifium and B. circulans chitinases, the group IV chitinase A (Fig. 3) produced by V. harveyi BB7 does not hydrolyze colloidal chitin as well if the putative chitin-binding domain was deleted (34). It is well known that chitinolytic systems in e.g. Alteromonas sp. strain O-7, B. circulans WL-12, Vibrio furnissii and Vibrio cholerae all produce multiple chitinases which differ in substrate specificities and subsequently have different roles in the chitin catabolic cascade (12, 16, 19, 28, 38). Additional studies including determination of the activity of purified enzymes are necessary to further investigate the catalytic specificities encoded by chib (lmo0105) and chia (lmo1883). Another interesting question to explore is whether ChiA is cell associated because this may offer an alternative explanation on the limited chitinolytic activity by the mutant that expresses only this enzyme and not ChiB.

12 The closest related homologues of the Glyco_18 domain of the listerial ChiB gene product were distributed within Clostridiales including Clostridium paraputrificium, Eubacterium ventrosum and other Clostridium spp. which mostly are soil bacteria (Fig. 2). More distantly related sequences were found in the bacterial genera Bacillus spp., Shewanella and Vibrio that include mainly soil and marine bacteria, respectively in addition to the genera Myxococcus and Saccharopolyspora. For marine bacteria chitinolytic activity may facilitate attachment to zooplankton (22), whereas such activity may support a saprophytic life style of soil associated Firmicutes or contribute to antagonistic activities towards fungi as suggested for Clostridium thermocellum ATTC endochitinase chi18a (Fig. 2)(42). Closely related homologues to the Glyco_18 domain of the chia (lmo1883) gene product were comprised of Listeria spp. and the related Firmicute Enterococcus faecalis (Fig. 3). Chitinolytic activity of E. faecalis has been suggested to support survival in the aqueous environment by supporting attachment to and survival on zooplankton (33). The putative catalytic regions of the Glyco_18 domains of L. monoctyogenes ChiB and ChiA belong to different groups according to Svitil and Kirchman (34) and phylogenetic analyses show them to be very distantly related (Fig. 2 and 3) suggesting that they do not have a monophyletic origin. This result is supported by the fact that the genes are distantly localized on the genome and furthermore also located far away from the lmo2467 gene that encodes a putative chitin-binding protein. This situation is in contrast to other bacterial chitinolytic systems in which many of the genes involved are organized in operons including V. cholerae N16961 (12, 19, 22) and V. furnisii (19). The products of L. monocytogenes ChiB and ChiA are very distantly related to similar V. cholerae 01 biovar eltor str. N16961 genes, VCA0027 and VC1952 (Fig. 2, 3) that are components of the best understood bacterial chitinolytic system (12, 22). Taken together the genetic

13 information on lmo0105 and lmo1883 does not present a clear indication of the biological roles of their enzymatic activities. One possibility is that these enzymes may enable Listeria to attach to and persist in chitin containing invertebrates and thereby adding to their virulence as exemplified by Vibrio infection of the crab Cancer pagurus (37). A note of caution towards this hypothesis is offered, however, by the scarcity of reports on presence of Listeria in arthropods even as several other Firmicutes including Bacillus, Clostridium, Enterococcus and Lactococcus are frequently isolated from this habitat (e.g. 1, 2, 7, 13). L. monocytogenes, including the EGD strain, has been shown to exert virulence towards Drosophila melanogaster (14, 20). This effect cannot, however, be attributed to chitinolytic activity as infection was established by injection of bacterial cells into the thorax, thereby bypassing the first natural step of infection including entry of the pathogen over the chitin-containing cuticula. As an alternative the chitinolytic activity may instead support a saprophytic life style in soil and sediments. Indeed, L. monocytogenes may survive for considerably periods of time in such environments (6, 41). Presently, we do not know how the chitinolytic activity of L. monocytogenes affects the biology of the organism and impacts on food safety. However, this phenotype may prove to be of considerable importance as it has been shown that chitin enhances the survival of L. monocytogenes (29) and that this species shows increased resistance to biocides while attached to chitin (21). It will be of considerable interest to further explore the role of chitinolytic activity for growth and survival of L. monocytogenes in the environment and for its transmission into foodmanufacturing plants. ACKNOWLEDGEMENTS Christel Galschiøt Buerholt, Jan Pedersen and Vi Phuong Thi Nguyen are thanked for excellent technical assistance. Professor Henrik Christensen, Department of Veterinary Pathobiology,

14 University of Copenhagen, is thanked for valuable input to the phylogenetic analyses of chitinase genes. REFERENCES 1. Bauer, S., A. Tholen, J. Overmann, A. Brune Characterization of abundance and diversity of lactic acid bacteria in the hindgut of wood- and soil-feeding termites by molecular and culture-dependent techniques. Arch. Microbiol. 173: Broderick, N.A., K.F. Raffa, R.M. Goodman, J. Handelsman Census of the bacterial community of the gypsy moth larval midgut by using culturing and culture-independent methods. Appl. Environ. Microbiol. 70: Cauchie, H.-M Chitin production by arthropods in the hydrosphere. Hydrobiologia 470: Chakraborty, T., M. Leimeister-Wachter, E. Domann, M. Hartl, W. Goebel, T. Nichterlein and S. Notermans Coordinate regulation of virulence genes in Listeria monocytogenes requires the product of the prfa gene. J. Bacteriol. 174: Cox, L.J., T. Kleiss, J.L. Cordier, C. Cordellana, P. Konkel, C. Pedrazzini, R. Beumer and A. Siebenga Listeria spp. in food processing, non-food and domestic environments. Food Microbiol. 6: Dowe, M.J., E.D. Jackson, J.G. Mori and C.R. Bell Listeria monocytogenes survival in soil and incidence in agricultural soils. J. Food Prot. 60: Egert, M., U. Stingl, L.D. Bruun, B. Pommerenke, A. Brune A, M.W. Friedrich Structure and topology of microbial communities in the major gut compartments of Melolontha melolontha larvae (Coleoptera: Scarabaeidae). Appl. Environ. Microbiol. 71:

15 Flyg, C. and H.G. Boman Drosophila genes cut and miniature are associated with the susceptibility to infection in Serratia marcescens. Genet. Res. 52: Glaser, P., L. Frangeul, C. Buchrieser, C. Rusniok, A. Amend, F. Baquero, P. Berche, H. Bloecker, P. Brandt, T. Chakraborty, A. Charbit, F. Chetouani, E. Couvé, A. de Daruvar, P. Dehoux, E. Domann, G. Domínguez-Bernal, E, Duchaud, L. Durant, O. Dussurget, K.-D. Entian, H. Fsihi, F. Garcia-del Portillo, P. Garrido, L. Gautier, W. Goebel, N. Gómez-López, T. Hain, J. Hauf, D. Jackson, L.-M. Jones, U. Kaerst, J. Kreft, M. Kuhn, F. Kunst, G. Kurapkat, E. Madueňo, A. Maitournam, J. Mata Vicente, E. Ng, H. Nedjari, G. Nordsiek, S. Novella, B. de Pablos, J.-C. Pérez-Diaz, R. Purcell, B. Remmel, M. Rose, T. Schlueter, N. Simoes, A. Tierrez, J.-A. Vázquez-Boland, H. Voss, J. Wehland and P. Cossart Comparative genomics of Listeria species. Science 294: Gooday, G.W The ecology of chitin degradation, pp In K.C. Marshall (ed.), Advances in Microbial Ecology, vol. 11. Plenum Press, New York, London. 11. Horton, R.M., Z.L. Cai, S.N. Ho and L.R. Pease Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8: Hunt, D.E., D. Gevers, N.M. Vahora and M.F. Polz Conservation of the chitin utilization pathway in the Vibrionaceae. Appl. Environ. Microbiol. 74: Jensen, G.B., B.M. Hansen, J. Eilenberg and J. Mahillon The hidden lifestyles of Bacillus cereus and relatives. Environ. Microbiol. 5: Jensen R.L., K.S. Pedersen, V. Loeschcke, H. Ingmer and J.J. Leisner Limitations in the use of Drosophila melanogaster as a model host for Gram positive bacterial infection. Lett. Appl. Microbiol. 44: Kazmierczak, M.J., S.C. Mithoe, K.J. Boor and M. Wiedmann Listeria monocytogenes σ B regulates stress response and virulence functions. J. Bacteriol. 185:

16 Keyhani, N.O. and S. Roseman Physiological aspects of chitin catabolism in marine bacteria. Biochem. Biophys. Acta 1473: Larsen, C.N., B. Nørrung, H.M. Sommer and M. Jakobsen In vitro and in vivo invasiveness of different pulsed-field gel electrophoresis types of Listeria monocytogenes. App. Environ. Microbiol. 68: Larsen, M.H., B.H. Kallipolitis, J.K. Christiansen, J.E. Olsen, J.E. and H. Ingmer The response regulator ResD modulates virulence gene expression in response to carbohydrates in Listeria monocytogenes. Mol. Microbiol. 61: Li, X. and S. Roseman The chitinolytic cascade in Vibrios is regulated by chitin oligosaccharides and a two-component chitin catabolic sensor/kinase. Proc. Natl. Acad. Sci. USA 101: Mansfield, B.E., M.S. Dionne, D.S. Schneider and N.E. Freitag Exploration of host- pathogen interactions using Listeria monocytogenes and Drosophila melanogaster. Cell. Microbiol. 5: McCarthy, S.A Attachment of Listeria monocytogenes to chitin and resistance to biocides. Food Technol. 46 (December): Meibom, K.L., X.B. Li, A.T. Nielsen, C.-Y. Wu, S. Roseman and G.K. Schoolnik The Vibrio cholerae chitin utilization program. Proc. Natl. Acad. Sci. USA 101: Mertins, S., B. Joseph, M. Goetz, R. Ecke, G. Seidel, M. Sprehe, W. Hillen, W. Goebel and S. Müller-Altrock Interference of components of the phosphoenolpyruvate phosphotransferase system with the central virulence gene regulator PrfA of Listeria monocytogenes. J. Bacteriol. 189: Milenbachs, A.A., D.P. Brown, M. Moors, M. and P. Youngman Carbon-source regulation of virulence gene expression in Listeria monocytogenes. Mol. Microbiol. 23:

17 Morimoto, K., S. Karita, T. Kimura, K. Sakka and K. Ohmiya Cloning, sequencing, and expression of the gene encoding Clostridium paraputrificium chitinase ChiB and analysis of the functions of novel cadherin-like domains and a chitin-binding domain. J. Bacteriol. 179: Nightingale, K.K., K. Lyles, M. Ayodele, P. Jalan, R. Nielsen and M. Wiedmann Novel method to identify source-associated phylogenetic clustering shows that Listeria monocytogenes includes niche-adapted clonal groups with distinct ecological preferences. J. Clin. Microbiol. 44: Nightingale, K.K., S.R. Milillo, R.A. Ivy, A.J. Ho, H.F. Oliver and M. Wiedmann Listeria monocytogenes F2365 carries several authentic mutations potentially leading to truncated gene products, including InlB, and demonstrates atypical phenotypic characteristics. J. Food Prot. 70: Orikoshi, H., S. Nakayama, K. Miyamoto, C. Hanato, M. Yasuda, Y. Inamori and H. Tsujibo Roles of four chitinases (ChiA, ChiB, ChiC and ChiD) in the chitin degradation system of marine bacterium Alteromonas sp. strain O-7. Appl. Environ. Microbiol. 71: Premaratne, R.J., W.-J. Lin and E.A. Johnson Development of an improved chemically defined minimal medium for Listeria monocytogenes. Appl. Environ. Microbiol. 57: Sauders, B.D. and M. Wiedmann Ecology of Listeria species and L. monocytogenes in the natural environment, pp In E.T. Ryser and E.H. Marth (ed.), Listeria, listeriosis, and food safety. CRC Press, Boca Raton, London, New York. 31. Sauders, B.D., M. Zeki Durak, E. Fortes, K. Windham, Y. Schukken, A.J. Lembo Jr., B. Akey, K. K. Nightingale and M. Wiedmann Molecular characterization of Listeria monocytogenes from natural and urban environments. J. Food Prot. 69:

18 Shen, S. and D.E. Higgins The MogR transcriptional repressor regulates nonhierarchal expression of flagellar motility genes and virulence in Listeria monocytogenes. PLoS Pathogens 2(4):e Signoretto C., G. Burlacchini, M. del Mar Lleò, C. Pruzzo, M. Zampini, L. Pane, G. Franzini and P. Canepari Adhesion of Enterococcus faecalis in the nonculturable state to plankton is the main mechanism responsible for persistence of this bacterium in both lake and seawater. Appl. Environ. Microbiol. 70: Svitil, A.L. and D.L. Kirchman A chitin-binding domain in a marine bacterial chitinase and other microbial chitinases: implications for the ecology and evolution of 1,4-β-glycanases. Microbiol. 144: Tamura, K., J. Dudley, M. Nei and S. Kumar MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin and D.G. Higgins The clustalx windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24: Vogan, C.L., C. Costa-Ramos and A.F. Rowley Shell disease syndrome in the edible crab, Cancer pagurus isolation, characterization and pathogenicity of chitinolytic bacteria. Microbiol. 148: Watanabe, T., W. Oyanagi, K. Suzuki and H. Tanaka Chitinase system of Bacillus circulans WL-12 and importance of chitinase A1 in chitin degradation. J. Bacteriol. 172: Watanabe, T., K. Suzuki, W. Oyanagi, K. Ohnishi and H. Tanaka Gene cloning of chitinase A1 from Bacillus circulans WL-12 revealed its evolutionary relationship to Serratia chitinase and to the type III homology units of fibronectin. J. Biol. Chem. 265:

19 Watanabe, T., W. Oyanagi, K. Suzuki, K. Ohnishi and H. Tanaka Structure of the gene encoding chitinase D of Bacillus circulans WL-12 and possible homology of the enzyme to other prokaryotic chitinases and class III plant chitinases. J. Bacteriol. 174: Welshimer, H.J Survival of Listeria monocytoggenes in soil. J. Bacteriol. 80: Zverlov, V.V., K.-P. Fuchs and W.H. Schwarz Chi18A, the endochitinase in the cellulosome of the thermophilic, cellulolytic bacterium Clostridium thermocellum. Appl. Environ. Microbiol. 68:

20 TABLE 1. Chitinolytic acitivity of Listeria strains Species and strain(s), serotype, (source) Chitinolytic activity 10 o C 30 C 37 o C L. grayi LMG L. innocua CLIP L. innocua Div-A8 (DVP a, mackerel) L. ivanovii Div-B1 (DVP a ) + b + b + b L. monocytogenes 4239, serotype 1 (human clinical) c + + -/+ L. monocytogenes 4274, serotype 4 (human clinical) c L. monocytogenes 4446, serotype 4 (human clinical) c L. monocytogenes 4459, serotype 1 (human clinical) c L. monocytogenes 4466, serotype 1 (human clinical) c L. monocytogenes 4629, serotype 1 (human clinical) c L. monocytogenes 4651, serotype 4 (human clinical) c L. monocytogenes 6896, serotype 1 (roast pork) c L. monocytogenes 7286, serotype 1 (crab meat) c L. monocytogenes serotype 4 (tomato sauce) c L. monocytogenes 7291, serotype 4 (pasta/chicken) c L. monocytogenes 7385, serotype 1 (pickled pork) c L. monocytogenes 7386, serotype 1 (smoked fillet) c L. monocytogenes 7394, serotype 1 (smoked ham) c L. monocytogenes 7418, serotype 1 (spread able sauce) c L. monocytogenes 7430, serotype 1 (ham/cheese) c L. monocytogenes 7813, serotype 1 (spread able cheese) c L. monocytogenes Scott A, serotype 4b -/+ + -/+ L. monocytogenes NCTC7973, serotype 1/2a L. monocytogenes F2365 (LMG 23356), serotype 4b L. monocytogenes LO28, serotype 1/2a + + -/+ L. moocytogenes EGD-e + + -/+ L. seeligeri LMG b + b - L. welshimeri LMG T =no presence of clearing zones, +=presence of clearing zones -/+= variable a DPV=Department of Veterinary Pathobiology, University of Copenhagen. b Delayed reaction c Reference (17).

21 TABLE 2. Primer sequences used to obtain internal deletions of 2226 bp, 1011 bp and 1392 bp of lmo0105, lmo1883 and lmo2467 by double cross-over recombination. Primer Sequence (5-3 ) lmo0105a tatgttcccgtttcttttttacggttttgttat lmo0105b cagaagtaatactaaaaagctttttcatcttctt lmo0105c gctttttagtattacttctgggttgttaataaattaatag a lmo0105d tatgtacattttttgccacacctaaccaaagtt lmo1883a ctgtcatatataatcctccattttccttctact lmo1883b tatggtccaatcgttggaacaaaataatatgtc lmo1883c tccaacgattggaccatattacttgttttccat a lmo1883d ggcattaagatgcttggaaaagttaatttcactt lmo2467a tttttggtcattggatcaaatggcttttactaa lmo2467b catccatttggacattattaaattaatacttgagc lmo2467c ataatgtccaaatggatgtcttcgtcattttcttcat a lmo2467d tttgcaccagctgttagtaagaatgagc a The underlined sequences are annealing to primer b

22 FIG. 1. Hydrolysis of chitin by Listeria monocytogenes EGD-e and mutants lmo0105, lmo1883, lmo2467 and lmo0105, Ten µl of bacterial suspensions were inoculated on TSA supplemented with 2.5 g L-1 chitin and incubated for 4 days at 30oC. Arrowheads point to the clearing zones. Photo is representative of 3 independent experiments. EGD-e lmo2467 E C C A lmo1883 lmo0105, lmo1883 lmo0105 T P D E

23 Fig. 2. Alignment of amino acid sequence of L. monocytogenes lmo0105 aa Glyco_18 domain (in bold) with representative sequences of Glyco_18 domains in other species and strains. Sequences marked with an * are referred to in the text NP XP YP NP YP NP YP NP YP BAA ZP YP CAA BAD BAA P ABI YP YP YP L. monocytogenes EGD-e lmo1883 Aedes aegypti Vibrio harveyi ATCC BAA-1116 Vibrio cholerae 01 N16961, VCA0027 * Shewanella sp. ANA-3 L. monocytogenes EGD-E-e lmo0105 L.monocytogenes F2365 L. innocua Clip L. welshimeri 6b SLCC 5334 (LMG T ) Clostridium paraputrificium M21, chitinase B * Eubacterium ventriosum ATCC Clostridium botulinum A str. ATCC 3502 Clostridium thermocellum ATCC 27405, chi18a * Clostridium paraputrificium M21 Kurthia zopfii Bacillus circulans WL-12, chitinase A-1 * Bacillus pumilus ChiS Bacillus cereus subsp. cytotoxis NVH Myxococcus xanthus DK 1622 Saccharopolyspora erythraea NRRL 2338

24 Fig. 3. Alignment of amino acid sequence of L. monocytogenes lmo1883 aa Glyco_18 domain (in bold) with representative sequences of Glyco_18 domains in other species and strains. Sequences marked with an * are referred to in the text NP P YP NP YP YP NP CAF YP YP NP EAY YP AAC ZP NP YP YP NP NP L. monocytogenes EGD-e lmo0105 Bacillus circulans WL-12 chitinase D Clostridium botulinum F str. Langeland Vibrio cholerae 01 N16961, VC1952 * Lactococcus lactis subsp. cremoris MG1363 Lactococcus lactis subsp. cremoris SK11 Lactococcus lactis subsp. lactis IL1403 Serratia marcescens Serratia proteamaculans 568 P. fluorescens PfO-1 P. aeruginosa PAO1 Burkholderia dolosa AUO158 Shewanella pealeana ATCC Vibrio harveyi BB7, chitinase A * Vibrio angustum S14 L. monocytogenes EGD-E-e lmo1883 L.monocytogenes F2365 L. welshimeri 6b SLCC 5334 L. innocua Clip Enterococcus faecalis V583 EF0361

25 Fig. 4. Glucose and temperature influence the chitinase activity of Listeria spp. Bacterial suspensions of L. innocua Clip (1), L. monocytogenes ScottA (2), L. seeligeri LMG (3), L. monocytogenes EGD (4), L. welshimeri LMG 11389T (5) and L. monocytogenes 4446 (6) was spotted onto TSA plates containing 2.5 g L-1 chitin without (A and C) or supplemented with 0.4% glucose (B) and incubated for 2 days at 30 C (A and B) or at 37 C (C). A T P 4 E C C A D E C B