Generation of ips-derived model cells for analyses of hair shaft differentiation

Transcription

1 Supplementary Material Generation of ips-derived model cells for analyses of hair shaft differentiation Takumi Kido, Tomoatsu Horigome, Minori Uda, Naoki Adachi, Yohei Hirai Department of Biomedical Chemistry, Graduate School of Science and Technology, Kwansei Gakuin University. Procedure Cells Mouse embryonic fibroblasts (MEF) and human dermal papilla cells (DPC) purchased from Kurabo (Tokyo, Japan) were maintained in DMEM/HamF12 medium supplemented with 10% FCS along with penicillin and streptomycin (DH10). Mouse ips cell line provided by RIKEN BRC Cell Bank (ips-mef-ng-20d-17), was maintained on MEF feeder cells in DMEM medium supplemented with 15% FCS, 0.1 mm non-essential amino acid (Sigma-Aldorich, Tokyo, Japan), 0.1 mm mercaptoethanol, and 1000 U/ml mouse LIF (Wako Chemicals, Osaka, Japan). For induction of differentiation, the culture medium of gene-manipulated ips cells was changed to DH10 medium containing 1 µm of all-trans retinoic acid (RA) (Sigma-Aldrich) and 5 µg/ml of doxycycline (Dox) (Takara Bio, Mountain View, CA, USA). In some cultures, keratinocyte growth factor (KGF) or Wnt5a (R & D systems, Minneapolis, MN, USA) was added to medium at a concentration of 100 ng/ml. For co-culture, a cell-culture insert (pore size, 0.4 µm) (BD Falcon, Tokyo Japan) was seeded with DPC (1 x 10 5 cells/insert) and set on ips-derived cells in a well of 24-well-plate, which only allowed diffusible factors from DPC to be accessible to ips-derived cells. Expression constructs and transfection To construct the plasmid for tetracycline/dox-inducible expression of bone morphogenic protein-4 (BMP4), cdna encoding BMP4 was generated by PCR and subcloned into the PiggyBac-Tet transposon plasmid (1). To generate ips cells with tetracycline/doxycycline (Dox)-dependent expression of BMP4, the plasmids was transfected into cells, together with PB-CArtTA Adv, pcag-pbase and neomycin resistant plasmid SV40-neo (2), using Lipofectamine 2000 (ThermoFisher, Osaka, Japan). Clones that were resistant to G418 and expressed BMP4 in response to Dox treatment (5 µg/ml) were then selected (Tet-BMP4 ips). To construct the reporter plasmid the DNA sequence from the KRT31 promoter (-1706 ~ +9), which contains putative target sites of transcription factors (supplementary material S4), was amplified from mouse genomic DNA

2 and subcloned into the luciferase reporter plasmid pgl4 (Promega). Tet-BMP4 ips cells were introduced with this plasmid (Tet-BMP4-KRT31-Luc ips) and luciferase activity was evaluated using the Dual-Luciferase Reporter assay system (Promega, Tokyo, Japan), according to the manufacture s protocol. Antibodies and immunodetection Western blotting and immunocytochemistry were performed according to standard protocols. Affinity-purified polyclonal antibodies against BMP4 were prepared as described previously (3). Anti-keratin 14 (KRT14) monoclonal antibody was purchased from Abcam (Tokyo, Japan). Reverse transcription quantitative PCR (qrt-pcr) Total RNA was extracted from cells using an RNeasy Mini Kit (Qiagen) and reverse-transcribed with an RNA-PCR Kit (Takara Bio). To assess transgene expression, qrt-pcr analyses were carried out using FastStart Essential DNA Green Master on a LightCycler Nano System (Roche, Tokyo, Japan) according to the manufacturer's protocol (PCR; 45 cycles). Primer pairs used in this study are listed in supplementary material S5. qrt-pcr was conducted in triplicate and the mrna expression was normalized to that of β-actin. Statistical analyses Results are expressed as the mean ± SD of three independent experiments. Data were analyzed by either a Student s t-test or Mann Whitney U-test, and a p-value of < 0.05 was considered statistically significant. References 1.Okashita, N., Y. Kumaki, K. Ebi, M. Nishi, Y. Okamoto, M. Nakayama, S. Hashimoto, T. Nakamura, et al PRDM14 promotes active DNA demethylation through the ten-eleven translocation (TET)-mediated base excision repair pathway in embryonic stem cells. Development (Cambridge, England) 141: Hagiwara-Chatani, N., K. Shirai, T. Kido, T. Horigome, A. Yasue, N. Adachi, and Y. Hirai Membrane translocation of t-snare protein syntaxin-4 abrogates ground-state pluripotency in mouse embryonic stem cells. Scientific reports 7: Masuda, E., K. Shirai, K. Maekubo, and Y. Hirai A newly established culture method highlights regulatory roles of retinoic acid on morphogenesis and calcification of mammalian limb cartilage. BioTechniques 58:

3 Supplementary Figure S1 - +RA BMP4:ON KRT14 DAPI KRT14 DAPI KTR14-positive KTR14-negative 8.1% 61% HaCaT (positive control) - +RA BMP:ON Tet-BMP4-iPS Expression of KRT14, a marker for epidermal progenitor, in Tet-BMP4-iPS cells cultured in the absence or presence of RA/Dox for 24 hours. Upper, cells were immunostained for KRT14 (red). Nuclei were counterstaiined with DAPI (blue). Bar, 200 mm. Lower, ratio of a KTR14-positive cell population in these cells. While that in a keratinocyte cell line HaCaT (positive control) was 61% (left), only 8.1% of Tet-BMP4-iPS cells became positive for this marker in response to RA/Dox (right).

4 Supplementary Figure S2 A mrna Expression (relative) krt14 *** KGF - + 無添加 KGF 添加 +RA & Dox n = 3 ***; p< mrna Expression (relative) K31 B krt31 n.s KGF - + +RA & Dox mrna Expression (relative) KGF KGFなし2 日目 - + K75 krt75 n.s. KGF2 日目 +RA & Dox Effect of KGF on the behavior of Tet-BMP4-iPS cells in the presence of RA and Dox for 24 hours. A, qrt-pcr analyses revealed that the number of krt14-positive epidermal progenitors was increased by KGF. B, Despite the increase in epidermal progenitors, markers for hair/hair follicles krt31 (left) and krt75 (right) were not affected. n.s.; not significant.

5 Supplementary Figure S tgtctccagacccgcctatttcacccactttcaaagtcttgggggggtgggagaagaaaatttgat tttattacaagtccaaggctcttttgtagtgctctgggcctttagaaactgaatggttttataata agtgtgggataatggtcttggggactgcagacactggaccttttatcggagcctccagccacatga agactaccatgaaagctcactggggagagggactccaatgaggtgtcagtaaagaagaagctttgg ctgcgagccaaagccacaggagcttgggtgatgtactggagtgcagttggtatcggctggtgccta taattacctaacctttatacatctctagcttgggccacctcatcctcagatcttctgttctcttcc atcaccacccatttctagcttggcactcctgctaaagaatagtcctgtgatttcagggcatttcaa tattttctttcctagcatctaagcccttggattcaatgatataatgtagcccctctttcatgcttt tgaaccttcggtccttagaacatctgtatgcacatccaagctggagcttggatgcccagagcaaag cactgagtttacatgtattgaactaggagaactagacagaagggtagaacgtttaactagaaattt caaagcgatttttaatgttaaagccaacacatggatacgttacaaactgtaaagccaatttgctcc atgtttaatataaagtgattttttttttttttgctagtggagacctctttgggctatctcttgcct tgctggggattgaacccaagccattttatacagtaggcaagtgctctacctatcacagacctgtct gcattttaccctcccttgggttacttcttgactttactaatgagctcactcactctgttttgattg atgcctcatggaaaaattagatgaacatgttcttatttcttgcacagttcttttcctagacagctt aaatgaatctacacccatctatcagccaaaagctataactctttaaaaactgtctcttctctcaga atcttctctgttctcaaggttatcatcaaagccactaccagtctcttaagtgataagagaggtcat tatgtggtcctgtaaactacagaaagctctccaaacttcacatccaaggcttagatcaagcctgga aggctacaacatttagagagtttactttcatcagaagaaacaagagctgatggctgtaactgaatg tatcttctttctccaaccaaccaaccaaccaaccaaccaaccaaccaaccaaccaaccaatttctc tctctctctctctctctctctctctctctctctctcaggatagggcattaggttgattgtgagtct tcaggatcttgtaacacaaaagaatgtcactggatggaccaacacccaactgaccagggctgggcc atgtgacttctttgaagggctactgcagaactctgtttcatgggtgcaatggctgaagaagagtcc tgacttggcaagaagctcaagtaaagaattttatgggaccagggactcttctgagggaagcaaatg acagactgaaggagagggcgtctgaaaaccagtgaagaagtacaaagaaaaaaagatgttacatac tgtgtccacaccctctgtagaaggcttataaagtctcaccaagggaaggagactcagagctctga Transcription start site DNA sequence of KRT31 promoter used in this study. The region that was amplified from mouse genomic DNA by PCR contains three putative promoter regions (red), which were predicted by a gene-prediction tool provided by Berkeley Drosophila Gene Project ( Score cutoff; 0.80.

6 Supplementary Table S1 The primer pairs used in this study krt14 forward krt14 reverse tgase1 forward tgase1 reverse nanog forward nanog reverse nestin forward nestin reverse brachury (t) forward brachury (t) reverse gata4 forward gata4 reverse krt31 forward krt31 reverse krt33a forward krt33a reverse krt75 forward krt75 reverse b-actin forward b-actin reverse 5'-ATCGAGGACCTGAAGAGCAA-3' 5'-TCGATCTGCAGGAGGACATT-3' 5'-CCTGACCCTGGATCCCTACT-3' 5'-TGTCAGGCAGTCGCTGTACT-3' 5'-TTCTTGCTTACAAGGGTCTGC-3' 5'-CAGGGCTGCCTTGAAGAG-3' 5'-TGCAGGCCACTGAAAAGTTC-3' 5'-TCTGACTCTGTAGACCCTGCTTC-3' 5'-CCACAAAGATGTAATGGAGGAAC-3' 5'-GAACAAGCCACCCCCATT-3' 5'-GGAAGACACCCCAATCTCG-3' 5'-CATGGCCCCACAATTGAC-3' 5'-GCAGGTGGAGTCCCTGAA-3' 5'-CTGGCAGCGTAGGGTGTT-3' 5'-CAGGCCTACTTCAGGACCAT-3' 5'-CGTTCTCAGATTTGCCACAC-3' 5'-CCAGATCAACTTCTACCGGATG-3' 5'-CACCTGGTTCTGCATCTGAG-3' 5'-CCTCACCCTCCCAAAAGC-3' 5'-GTGGACTCAGGGCATGGA-3'