The Central Dogma of Molecular Biology
|
|
|
- Reynard Chandler
- 6 years ago
- Views:
Transcription
1 The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1
2 DNA: The ultimate instruction manual hdp://askabiologist.asu.edu/explore/dna- abcs 3,080,000,000 characters (750 MB data or 5000 textbooks) Only 4 letters make up the code Human possess approx. 29,000 protein-coding genes on 23 chromosomes Approximately 1000 genes per chromosome All of this information is in each and every one of our trillion Watson and Crick James D. Watson Francis Crick Wrote the 1953 Nature Journal article describing the structure of DNA Molecular Structure of Nucleic Acids: A Structure of Deoxyribose Nucleic Acid Won the 1962 Nobel Peace Prize in Physiology or Medicine Demonstrated the double helix structure of DNA Used X-ray distraction data that was collected by Rosalind Franklin 2
3 The structure of deoxyribonucleic acid (DNA) Nucleus hdp://campus.udayton.edu/~hume/dna/dna.htm Sugar phosphate backbone Base (nucleobde) Hydrogen bond What is the direcbonality of DNA? A. 5 to 3 B. 3 to 5 C. 4 to 2 3
4 The double helix Adapted from Phosphodiester Bond Adapted from: hdp:// books.com/mobio/free/ch3a5.htm 4
5 In double stranded DNA, adenine pairs with which nucleobde? A. Adenine B. Thymine C. Cytosine D. Guanine How many hydrogen bonds form between guanine and cytosine nucleobdes in double stranded DNA? A. 1 B. 2 C. 3 D. 4 5
6 A phosphodiester bond forms between A. 5 PO 4 and 2 OH B. 5 PO 4 and 3 OH C. 5 OH and 2 PO 4 D. 5 OH and 3 PO 4 DNA is not a mysterious, complex molecule from a textbook! hdp://learn.genebcs.utah.edu/content/begin/tour/ 6
7 DNA: Prokaryotes vs. Eukaryotes DNA promoter Prokaryotes ATG TAA TAG TGA Term. DNA Eukaryotes promoter ATG TAA TAG TGA Term. Operon A cluster of genes that are controlled by a single promoter. Found in prokaryotes and some eukaryotes (nematodes and flies) Genes are transcribed together into a single mrna Transcription is regulated by the operator sequence, which is between the promoter and genes Translation occurs by: Translating mrnas together Separating the mrnas into single mrnas, which are then translated. 7
8 The lac Operon The genes in the lac Operon are involved in the breakdown and metabolism of lactose Modified from: DNA Replication hdp://universe- review.ca/f11- monocell.htm 8
9 Bacterial DNA contains introns A. True B. False What is the purpose of helicase in DNA replicabon? A. Unwinds the dsdna into single strands B. Adds a short single stranded oligo to inibate DNA synthesis C. Forms phosphodiester bonds 9
10 H - bonds A T C G Phosphodiester backbone You each are going to receive a kit with materials needed to make DNA. Inside your kit you will find: Licorice which will serve as your phosphodiester bonds Jelly candy which will serve as your nucleotides Tooth picks which will serve as your hydrogen bonds. You will also attach your nucleotides to your phosphodiester bonds with toothpicks. Each student will need to make a double stranded DNA molecule based on the single stranded sequence (sense strand) that is in your kit. Be sure to include the correct anti-sense strand as well as the appropriate number of hydrogen bonds. nucleobdes Let s make Candy DNA! Ribonucleic Acid (RNA) ribose deoxyribose Adapted from 10
11 What are some differences between DNA and RNA? In mrna, adenine pairs with which nucleobde? A. Adenine B. Thymine C. Uracil D. Cytosine E. Guanine 11
12 mrna is single stranded. A. True B. False Transcription = the process of making RNA from DNA REPLICATION TRANSCRIPTION TRANSLATION DNA RNA PROTEIN 12
13 Definitions Promoter: a region of DNA that is upstream of a gene where RNA polymerase binds and initiates transcription. Transcription factor: a protein that binds DNA at specific sequences and aids in the initiation of transcription. RNA polymerase: an enzyme involved in transcription that synthesizes an mrna molecule from a DNA template Terminator: a region of DNA that is downstream of a gene where RNA polymerase stops transcribing a gene. Simplified overview of transcription 13
14 Transcription Video What is a promoter? A. A protein that acbvates RNA polymerase B. A single stranded oligo that tells RNA polymerase where to transcribe mrna C. An area of DNA upstream of the gene where RNA polymerase binds 14
15 Transcription: Prokaryotes vs. Eukaryotes DNA Prokaryote promoter ATG transcription Gene TAA TAG TGA Term. DNA transcription Eukaryotes promoter Gene ATG TAA TAG TGA Term. mrna RBS mrna RBS processing mrna RBS Which of the following is not a funcbon of the 5 cap of eukaryobc mrna? A. Transport of mrna out of the nucleus B. IniBaBon of transcripbon C. Increase the stability of mrna D. Aid in mrna splicing 15
16 Translation Process by which the mrna is decoded by the ribosome to generate a specific polypeptide made up of amino acids hdp://faculty.clintoncc.suny.edu/faculty/ michael.gregory/files/bio%20101/bio %20101%20lectures/protein%20synthesis/protein.htm Translation hdp:// PSTQ&feature=related 16
17 Genetic Code hdp:// N100/2k3ch13dogma.html Translation: Prokaryotes vs. Eukaryotes DNA transcription Prokaryotes promoter Gene ATG TAA TAG TGA Term. DNA Eukaryotes promoter ATG transcription Gene TAA TAG TGA Term. mrna RBS mrna RBS protein translation processing RBS mrna translation protein 17
Nucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
DNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
Adv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
RNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
Prokaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
Chapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
Review of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Unit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase
DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
Protein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
Protein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
Frederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
STUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
DNA Structure and Protein synthesis
DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,
1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
Division Ave. High School Ms. Foglia AP Biology. Nucleic acids. AP Biology Nucleic Acids. Information storage
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 1 DNA Nucleic Acids Function: u genetic material stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
Nucleic acids AP Biology
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 Nucleic Acids Function: u genetic material DNA stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
Ch. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
DNA - The Double Helix
Name Date Period DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
DNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
Name: Date: Pd: Nucleic acids
Name: Date: Pd: DNA - The Double Helix Nucleic acids Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of
Name Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
Central Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
DNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
DNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
UNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
DNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
THE COMPONENTS & STRUCTURE OF DNA
THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made
Molecular Genetics I DNA
Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
DNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
BIOCHEMISTRY Nucleic Acids
BIOCHEMISTRY Nucleic Acids BIOB111 CHEMISTRY & BIOCHEMISTRY Session 17 Session Plan Types of Nucleic Acids Nucleosides Nucleotides Primary Structure of Nucleic Acids DNA Double Helix DNA Replication Types
DNA Replication. Packet #17 Chapter #16
DNA Replication Packet #17 Chapter #16 1 HISTORICAL FACTS ABOUT DNA 2 Historical DNA Discoveries 1928 Frederick Griffith finds a substance in heat-killed bacteria that transforms living bacteria 1944 Oswald
Protein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
PUC Vikasana Program- 2012
Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the
What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
Chapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
Brief History. Many people contributed to our understanding of DNA
DNA (Ch. 16) Brief History Many people contributed to our understanding of DNA T.H. Morgan (1908) Frederick Griffith (1928) Avery, McCarty & MacLeod (1944) Erwin Chargaff (1947) Hershey & Chase (1952)
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
Friday, April 17 th. Crash Course: DNA, Transcription and Translation. AP Biology
Friday, April 17 th Crash Course: DNA, Transcription and Translation Today I will 1. Review the component parts of a DNA molecule. 2. Describe the process of transformation. 3. Explain what is meant by
DNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
DNA Structure, Nucleic Acids, and Proteins
DNA Structure, Nucleic Acids, and Proteins Strands Topic Primary SOL Related SOL Life at the Molecular and Cellular Level; Scientific Investigation Investigating DNA structure, nucleic acids, and protein
Click here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
DNA Replication AP Biology
DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.
Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.
Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is
DNA Replication AP Biology
DNA Replication 2007-2008 Watson and Crick 1953 article in Nature Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible
Name Class Date. Information and Heredity, Cellular Basis of Life Q: What is the structure of DNA, and how does it function in genetic inheritance?
12 DNA Big idea Information and Heredity, Cellular Basis of Life Q: What is the structure of DNA, and how does it function in genetic inheritance? WHAT I KNOW WHAT I LEARNED 12.1 How did scientists determine
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
DNA Structure and Replication
Name: DNA Structure and Replication 1. DNA: Deoxyribonucleic Acid a. Credit for discovery is given to Watson & Crick b. DNA stands for c. This chemical substance is present in the of all cells in all living
Nucleic acids. What important polymer is located in the nucleus? is the instructions for making a cell's.
Nucleic acids DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
DNA Structure and Replication 1
Name: # Date: Per: Why? DNA Structure and Replication How is genetic information stored and copied? Deoxyribonucleic acid or DNA is the molecule of heredity. It contains the genetic blueprint for life.
DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA?
DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA? By the late 1800s, scientists knew that genetic information existed as distinct units called genes. hapter 11 By the
Genome Architecture Structural Subdivisons
Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.
DNA is a nucleic acid which acts as molecular repository for all genetic information
FLOW OF INFORMATION DNA is a nucleic acid which acts as molecular repository for all genetic information Chemically, DNA is a long polymer of simple units called nucleotides, with a backbone made of sugars
CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
Developmental Biology BY1101 P. Murphy
Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
CHAPTER 16 MOLECULAR BASIS OF INHERITANCE
CHAPTER 16 MOLECULAR BASIS OF INHERITANCE DNA as genetic material? Deducted that DNA is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths
By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?
Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand
DNA and RNA
http://faculty.uca.edu/~johnc/mbi1440.htm DNA and RNA http://www.wappingersschools.org/rck/staff/teacherhp/johnson/visualvocab/mrna.gif GENETIC MATERIAL In the middle of the 1900 s scientists were asking