SUPPLEMENTAL MATERIAL. Carvajal et al. Supplemental Table 1. List of quantitative PCR primers used for cdna analyses and

Size: px
Start display at page:

Download "SUPPLEMENTAL MATERIAL. Carvajal et al. Supplemental Table 1. List of quantitative PCR primers used for cdna analyses and"

Transcription

1 UPPLEMEAL MATERIAL Carvajal et al. upplemental Table 1. List of quantitative PCR primers used for cdna analyses and chromatin immunoprecipitation assays. Figure 1. DNA damage-induced transcriptional repression of, CCNB1, CDC2, RRM2, DHFR, and is p5-dependent. (A) Immunoblot analysis of p5 protein levels corresponding to each sample in Figure 1A. (B) Cell cycle profile using flow cytometry of corresponding samples in Figure 1A. (C) Endogenous p5 was downregulated in U2O cells using an sirna approach. Cells were treated with doxorubicin for 24 hr after transfection. amples were harvested 24 hr after treatment with doxorubicin and processed for D-PAGE. Immunoblot analysis shows p5 protein levels before and after DNA damage in either the control or the p5 sirna transfected cells. (B) Quantitative RT-PCR gene expression study of repression targets using samples corresponding to those described in (A). (Error bars =tandard Error of the Mean, D=Days, statistical significance is shown using the student s t-test analysis, p <.1 =, p <.5 =, = not significant.) Figure 2. DNA damage-induced up-regulation of is dose and timedependent. (A) HCT116 cells were treated with increasing amounts of doxorubicin. Cells were harvest at 24 hr post treatment and processed for quantitative RT-PCR analysis using cdna primers specific for, and. (B-C) U2O and MCF7 cells were treated and processed as in (A). (D) U2O cells were treated

2 with.1 µg/ml doxorubicin and harvested at the indicated time points. amples were processed for qrt-pcr expression analysis of,,, DHFR and RRM2. Bar graphs shown are representative experiments. Figure. Ablation of expression followed by DNA damage abrogates p5- dependent transcriptional repression of replication targets, but not mitotic targets. (A) Flow cytometry cell cycle analysis using U2O samples treated as in Figure 5A for the indicated amount of time. (B) Bar graph shows the average of independent experiments as in (A). (C) expression was downregulated in U2O cells using individual sirna oligonucleotides. Control () or (si5,, si7, si8) sirna transfected cells were treated as in Figure 5A. amples were processed for gene expression analysis of, and. (D) expression was targeted as in (C) using a single RNAi oligonucleotide. amples were processed for gene expression analysis of, CDC2, RRM2, DHFR, and E2F8. ( = Nontreated, D= Days, Error bars = tandard Error of the Mean, statistical significance is shown using the student s t-test analysis, p <.1 =, p <.5 =, = not significant). The average of independent experiments is shown. Figure 4.. is not detected at the promoter of the mitotic target gene Purified DNA fragments from the experiment shown in Figure 6D were analyzed for Flag- enrichment at the indicated promoters by quantitative PCR. Figure 5. The cyclin-dependent kinase inhibitor p21 contributes to DNA damageinduced transcriptional repression of p5 targets. Quantitative RT-PCR using mrna extracted from either HCT116 p5+/+, shown in Figure 1A, and p21 -/- cells

3 before and after treatment with the DNA damaging agent doxorubicin. Gene expression analysis of the same genes used in Figure 1A is shown. ( = Non-treated, D= Days, Error bars = tandard Error of the Mean). The average of independent experiments is shown.

4 Carvajal_upplemental Table 1 qrt-pcr Primers Forward Reverse ACCCTGACCTGCTGCTCTT GCCAGGTACTGATGGTCAGTTT E2F6 GGGCCTGCTGCCATCAAAAAT TCATACACTCTCCGCTTTCG GGAAAGGCAACAGCAAACTCT TGGGAGAGCACCAAGAGTAGAAGA E2F8 GCAGCCAATGATACCTCAAAGG ATGAGCACTGCGTGAGAGGGATTA TCCCTGAAAGATCAAGAAGC CCTTGGAAAAATCACCAATC CDK1 AACTAAGAAACCACTTTTCCAT CAATTTTCATCCAAGTTTTGAC CDK2 ATGGAGAACTTCCAAAAGGTGGA CAGGCGGATTTTCTTAAGCG CCNB1 AAGAGCTTTAAACTTTGGTCTGGG CTTTGTAAGTCCTTGATTTACCATG CDC2 CTGGGTTCCTCTGCAGACAT CGAATGTGTCGATCACTGGT DHFR CAGCAGAGAACTCAAGGAAC CCAACTATCCAGACCATGTC RRM2 CAGCAAGCGATGGCATAGT AGCGGGCTTCTGTAATCTGA ACTCTCAGGGTCGAAAACGG CCTCGCGCTTCCAGGACTG TPP5 CTGCCCTGAACAAGATGTTTT CTATCTGAGCAGCGCTCATGG GAPDH CAATGACCCCTTCATTGACC GATCTCGCTCCTGGAAGATG ChIP qpcr Primers AGGAACCGCCGCCGTTGTTCCCGT GCTGCCTGCAAAGTCCCGGCCACT TTCTGGTTTGGCTTCCAGTC GAGGACAGGAAAGCAGATGG (p21) 5' site CTTTCACCATTCCCCTACCC AATAGCCACCAGCCTCTTCT ALB (Albumin) TGGGGTTGACAGAAGAGAAAAGC TACATTGACAAGGTCTTGTGGAG

5 Carvajal_Figure 1 HCT116 A. p5+/+ p5-/- 2D 2D p5 Actin B. HCT116 2D HCT116.7 HCT116.8 HCT116.9 p5+/+ sub 2 4 sub HCT P5-/-.1 sub HCT P5-/ HCT P5-/-.12 p5-/ sub sub 2 4 sub C. U2O sicontrol sirna: sip5 p5 Actin D. normailized to GAPDH U2O RRM sip5 sirna: sicontrol sirna: CDC2 DHFR CCNB1

6 Carvajal_Figure 2 A. HCT116 (p5 +/+) B μg/ml U2O (p5 +/+) μg/ml.15. C. MCF7 (p5 +/+) μg/ml D. Normailized to GAPDH U2O (p5 +/+) Normailized to GAPDH Hrs DHFR RRM Hrs

7 Carvajal_Figure U2O + A. sicontrol U2O.19 sub sub si sub sub 4 sub U2O.2 2 U2O.21 2 U2O.22 D U2O sub U2O % of cells B D ub G2/ M ub G2/ M si sicontrol C. U2O si7 si7 si RRM2.2 DHFR E2F CDC2.4.2 si5 U2O D..2 si5 si si5.2.1 si7 si8

8 Carvajal_Figure 4 H1299 % of Input ALB Transfected: CMV FLAG CMV FLAG IP: anti-flag IP: No Ab

9 Carvajal_Figure 5 normalized to GAPDH HCT D 2D D 2D p21-/1.5 CDK1 CCNB D 2D RRM2.15 2D 2D CDK D 2D D 2D p21-/ 2D 2D

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al, Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

More information

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1 Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded

More information

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa

More information

2008 Wright State University

2008 Wright State University IN SEARCH FOR NEW p53 REGULATED GENES A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By MELDRICK DANIEL MPAGI B.S., Ohio University, 2006 2008 Wright

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

Supplementary information. Supplementary Figures

Supplementary information. Supplementary Figures Supplementary information Supplementary Figures Supplementary Figure 1. A. i. HA-JMY expressing U2OS cells were treated with SAHA (6h). DAPI was used to visualise nuclei. ii. U2OS cells stably expressing

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

supplementary information

supplementary information DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and

More information

Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence

Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence Supplementary Figure Legends Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence of p53 or p21. HCT116 cells which were null for either p53 (A) or p21 (B) were

More information

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna

More information

Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2

Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Department of Anatomy, Yong Loo Lin School of Medicine, National University of Singapore MD10, 4 Medical Drive, Singapore 117597 ABSTRACT

More information

Supplementary figures

Supplementary figures Relative intensity Relative intensity Relative intensity Supplementary figures a None Caffeine None Caffeine c None Caffeine 6 6 6 ISG 6 6 6 UBE1L 6 6 6 UBCH8 6 6 6 EFP 1 1 DOX (h) 1 1 CPT (h) 1 1 UV (h)

More information

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3

More information

Transcriptional Regulation (Gene Regulation)

Transcriptional Regulation (Gene Regulation) Experimental Techniques in Biomedical Sciences 의생명과학실험기법 Transcriptional Regulation (Gene Regulation) 4/17/13 Jeong Hoon Kim (jeongkim@skku.edu) Department of Health Sciences and Technology, SKKU Graduate

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1, Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected

More information

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, 1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplementary Fig. 1

Supplementary Fig. 1 a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL

More information

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1 A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

(a) Immunoblotting to show the migration position of Flag-tagged MAVS Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene

More information

Mock. Control. sirna1

Mock. Control. sirna1 siha CaSki Mock Control sirna1 Supplementary Data Figure 1: Photomicrographs of siha and CaSki cells taken 48 hours after mock transfection, transfection of control sirna or sirna1. (100X magnification).

More information

Supplementary data 1. Prmers and probes used in Taqman real-time PCR.

Supplementary data 1. Prmers and probes used in Taqman real-time PCR. Supplementary data 1. Prmers and probes used in Taqman real-time PCR. PIG-T Forward Primer: gatctgcctcacgtgcactgt Reverse Primer: aggttcgggtgaggagattgt Probe: 6FAMTGG CCG TGT GCT ATG GCT CCT TCTAMRA PIG-U

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 0 DOI: 0.0/NMICROBIOL.0. The host protein CLUH participates in the subnuclear transport of influenza virus ribonucleoprotein complexes Tomomi Ando,, Seiya Yamayoshi, Yuriko Tomita,, Shinji

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95 Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:

More information

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary

More information

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and

More information

Supplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response

Supplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response Molecular Cell, Volume 67 Supplemental Information HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response Mehdi Morchikh, Alexandra Cribier,

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,

More information

Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two

Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:

Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures: Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:

More information

b alternative classical none

b alternative classical none Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh

More information

Thanasoula et al. - Fig. S1

Thanasoula et al. - Fig. S1 S HK1si G1 Thanasoula et al. - Fig. S1 G2/M HK2si 1 3 5 7 9 11 13 hours after double thymidine block release Figure S1. U2OS synchronous cell cycle progression. U2OS cells transfected with, POT1, HK1,

More information

Supplemental Figure Legends:

Supplemental Figure Legends: Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

More information

The Ups & Downs of Gene Expression:

The Ups & Downs of Gene Expression: The Ups & Downs of Gene Expression: Using Lipid-Based Transfection and RT-qPCR to Deliver Perfect Knockdown and Achieve Optimal Expression Results Hilary Srere, Ph.D. Topics What is RNAi? Methods of Delivery

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/362/ra12/dc1 Supplementary Materials for FOXP1 potentiates Wnt/β-catenin signaling in diffuse large B cell lymphoma Matthew P. Walker, Charles M. Stopford, Maria

More information

Post-translational modification

Post-translational modification Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample

More information

Supplementary Information

Supplementary Information Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,

More information

Mechanisms of embryonic stem cell division and differentiation

Mechanisms of embryonic stem cell division and differentiation Mechanisms of embryonic stem cell division and differentiation Josephine Wbite.'.... Department of Molecular Biosciences (Biochemistry) The University of Adelaide Adelaide, South Australia Submitted for

More information

CRISPR RNA-guided activation of endogenous human genes

CRISPR RNA-guided activation of endogenous human genes CRISPR RNA-guided activation of endogenous human genes Morgan L Maeder, Samantha J Linder, Vincent M Cascio, Yanfang Fu, Quan H Ho, J Keith Joung Supplementary Figure 1 Comparison of VEGF activation induced

More information

Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells

Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells A Dissertation for the Degree of Doctor of Philosophy Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells Department of Pharmacy Graduate School Chungnam National University By Minh

More information

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP

More information

SUPPLEMENTARY EXPEMENTAL PROCEDURES

SUPPLEMENTARY EXPEMENTAL PROCEDURES SUPPLEMENTARY EXPEMENTAL PROCEDURES Plasmids- Total RNAs were extracted from HeLaS3 cells and reverse-transcribed using Superscript III Reverse Transcriptase (Invitrogen) to obtain DNA template for the

More information

Supplementary Information

Supplementary Information Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson

More information

Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1

Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot

More information

Nature Structural & Molecular Biology: doi: /nsmb.1583

Nature Structural & Molecular Biology: doi: /nsmb.1583 Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,

More information

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2. Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected

More information

Supplementary Table S1

Supplementary Table S1 Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG

More information

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

More information

Transcriptional Regulation

Transcriptional Regulation Experimental Techniques in Biomedical Sciences 의생명과학실험기법 Transcriptional Regulation (Gene Regulation) 3/14/12 Jeong Hoon Kim (jeongkim@skku.edu) Department of Health Sciences and Technology, SKKU Graduate

More information

ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System

ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological

More information

Transcriptional Regulation

Transcriptional Regulation Experimental Techniques in Biomedical Sciences 의생명과학연구기법 Transcriptional Regulation (Gene Regulation) 4/2/16 Jeong Hoon Kim (jeongkim@skku.edu) edu) Department of Health Sciences and Technology, SKKU Graduate

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment. Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with

More information

supplementary information

supplementary information DOI: 10.1038/ncb1864 Figure S1 Apak specifically inhibits p53 transcriptional activity. Transcription activity of p53 was measured in U2OS (p53 wild-type) and H1299 (p53 deficient) cells which were transfected

More information

Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of

Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LEGEND FOR SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LLC-1, LLC-3, and LLC-5 cell line series were quantified by BrdU assay after 72 h of

More information

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

More information

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the

More information

Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.

Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements

More information

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray

More information

TRIM31 is recruited to mitochondria after infection with SeV.

TRIM31 is recruited to mitochondria after infection with SeV. Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

More information

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

More information

mir-24-mediated down-regulation of H2AX suppresses DNA repair

mir-24-mediated down-regulation of H2AX suppresses DNA repair Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was

More information

Racine et al, Histone H2B ubiquitylation promotes activity of the intact Set1 histone methyltransferase complex in fission yeast

Racine et al, Histone H2B ubiquitylation promotes activity of the intact Set1 histone methyltransferase complex in fission yeast Supplemental Materials Racine et al, Histone H2B ubiquitylation promotes activity of the intact Set histone methyltransferase complex in fission yeast Supplemental Experimental Procedures Table S Figures

More information

Supplementary Information

Supplementary Information Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara

More information

SUPPLEMENTAL FIGURES AND TABLES

SUPPLEMENTAL FIGURES AND TABLES SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2

More information

hnrnp D/AUF1 Rabbit IgG hnrnp M

hnrnp D/AUF1 Rabbit IgG hnrnp M Mouse IgG Goat IgG Rabbit IgG Mouse IgG hnrnp F Goat IgG Mouse IgG Kb 6 4 3 2 15 5 Supplementary Figure S1. In vivo binding of TERRA-bound RBPs to target RNAs. Immunoprecipitation (IP) assay using 3 mg

More information

e15 e14 3utr i13 K36me3 / H i4 ** ** ** ** ** tss IIIb K36me2 / H IIIb BCOR (% input)

e15 e14 3utr i13 K36me3 / H i4 ** ** ** ** ** tss IIIb K36me2 / H IIIb BCOR (% input) a Epithelial cells (2) Mesenchymal cells () Alternatively spliced region i13 e14 e15 / CycA 25 15 1 5 e14 e13-e14 - - K27me3 / H3 b 2.5 c v5 K36me3 / H3 d 3.5 2.8 2.1 1.4.7 e 3.5 2.8 2.1 1.4.7 v5 K9me3

More information

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,

More information

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from

More information

Supplemental Figure S1

Supplemental Figure S1 Supplemental Figure S1 A. CRPC (C4-2) 12 % Cell Survival 8 6 4 ABT 1 nm ABT 1 nm ABT nm ABT 1 um ABT 5 um ABT 2 :Docetaxel B. HT-sensitive PCa cells CRPC cells 12 12 % Cell Su urvival 8 6 4 2 LAPC4 LNCaP

More information

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively. Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10

More information

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A)

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) Supplementary Figure Legends Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) High-resolution oligonucleotide-based array comparative genomic hybridization shows normal DNA copy number

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Experimental schema for the identification of circular RNAs in six normal tissues and seven cancerous tissues. Supplementary Fiure 2 Comparison of human circrnas

More information