Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers

Size: px
Start display at page:

Download "Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers"

Transcription

1 Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers T.R. Mereniuk et al. Supplemental tlmt Material: il Supplemental l Figures 1-7 Supplemental Tables 1 and 2 1

2 A B A549δPNKP A549 PNKP SHP-1 SHP-1 SHP-1 SHP-1 #5 #6 #1 #11 A549 SHP-1 β-actin β-actin C D Karpas pci only Karpas SHP-1 A549 SHP-1 SHP-1 β-actin β-actin Supplemental Figure 1. Western blots of key proteins used during experimentation. (A) Stable knockdown of PNKP in A549δPNKP compared to A549-Scramble control lysate. (B) Transient knockdown of SHP-1 in A549 using four distinct sirnas targeting SHP-1 mrna. (C) Reexpression of SHP-1 in Karpas 299 cells alongside the vector only control (Karpas+pCI) p and a positive control (A549). (D) Level of SHP-1 protein remaining in the stable A549δSHP-1 cell line. 2

3 4 A549-Scramble 35 Replicate # R² = Replicate #1 45 A549δPNKP 4 Replicatte # R² = Replicate #1 Supplemental Figure 2. Comparative analysis of the entire druggable genome sirna screen. Cell viability values from all the plates in the screen were normalized and plotted against their respective replicates. In both the screen using (A) A549-Scramble cells and (B) A549δPNKP cells, the duplicates were shown to have good reproducibility with R2 values of.75 and.759, respectively. 3

4 A549δPNKP 1 A549-Scramble 8 Per rcent survival SHP-1 KCND2 TAP1 sirna used Supplemental Figure 3. Survival of SHP-1 and PNKP co-disrupted cells compared to randomly selected non-hits. There was a large difference in survival between those that were deemed hits when compared to those that were labeled non-hits. Error bars represent standard error (± S.E.) from at least three independent determinations for the SHP-1 values. Error bars for the KCND2 and TAP1 values represent standard error (± S.E.) taken from the raw data from the duplicate screens. 4

5 Supplemental Figure 4. SHP-1 and PARP-1 do not have a synthetic lethal partnership. (A) Clonogenic survival assay showing lack of sensitivity of A549δSHP-1 cells towards the PARP-1 S inhibitor DPQ. Q( (B) Cell proliferation assay following transient transfection of PARP-1 or ASN sirna in A549δSHP-1 or A549-Scramble cells. (C) Western blots showing PARP-1 protein levels following transient transfection with sirna. 5

6 Type 1 Type 2 Type 3 Type 4 Type 5 Supplemental Figure 5. Characteristics of typical comets scored. The tail of the comets indicates the level of DNA damage present in these cells beginning with type 1 comets that showed no DNA damage, progressing to type 5 comets, which showed the most DNA damage (Kumaravel TS, Vilhar B, Faux SP, et al. Comet Assay measurements: a perspective. Cell Biol Toxicol. 29;25:53-64). 6

7 1 Type 1 8 Type 2 Type 3 6 Type 4 4 Type 5 A Perce ent comet ty ype Control Control Control B C Time (h) 7

8 Percent comet typ pe Type 1 Type 2 Type 3 Type 4 Type 5 Control Control D E F Control Time (min) 8

9 Supplemental Figure 6. Single-cell gel electrophoresis (comet) assays for DSBR (A-C) and SSBR (D-F). A549-Scramble, A549δPNKP and A549 cells stably depleted of SHP-1 (A549δSHP-1 cells) were grown to confluence in 6-mm plates in complete DMEM/F12. The cells were irradiated with 5 Gy ( 6 Co Gammacell; Atomic Energy of Canada Limited, Ottawa, Canada) and incubated at 37 C for, 2, 6, and 24 h for neutral comet assays and, 1, 3, 6 or 12 min for the alkaline comet assay. Controls were also included in which cells were not irradiated to give the baseline level of DNA damage present in each cell line. Double and single-strand breaks were then determined by single-cell gel electrophoresis as previously described (Kumaravel TS, Vilhar B, Faux SP, et al. Comet Assay measurements: a perspective. Cell Biol Toxicol. 29;25:53-64; Freschauf GK, Mani RS, Mereniuk TR, et al. Mechanism of action of an imidopiperidine inhibitor of human polynucleotide kinase/phosphatase. J. Biol. Chem. 21;285:2351-6). Each experiment was performed in duplicate, with ten random microscope fields examined per determination. The data were combined to generate a higher total number of cells counted. 2-6 comets were analyzed for each time point. 9

10 h A549-Scramble + 1 μm BH3I-1 4 h 24 h 48 h Supplemental Figure 7. A549-Scramble cells were treated with 1 μm of the apoptotic inducer BH3I-1 continuously over a period of 48 and the phosphorylation of H2AX was monitored at the indicated time points. Quantification of the H2AX phosphorylation (Fig. 7) suggested that only a minor proportion of the H2AX phosphorylation observed when SHP-1-depleted cells are treated with the PNKP inhibitor is due to apoptotic DNA fragmentation. 1

11 11

12 12

13 13

14 14

15 15

16 16

17 17

18 18

19 19

20 2

21 Supplemental Table 2. Tumor suppressors identified as potentially synthetic lethal with PNKP by the sirna screen a These values were obtained with a relatively high concentration (56 nm) of sirna for each target gene, which may explain the poor survival in A549-Scramble cells of some of the possible hits. All subsequent confirmatory experiments were conducted using 2 nm of sirna to reduce toxicity in A549-Scramble cells. 21

Li et al., Supplemental Figures

Li et al., Supplemental Figures Li et al., Supplemental Figures Fig. S1. Suppressing TGM2 expression with TGM2 sirnas inhibits migration and invasion in A549-TR cells. A, A549-TR cells transfected with negative control sirna (NC sirna)

More information

Supplementary Figure 1. Additional RNAi screen data

Supplementary Figure 1. Additional RNAi screen data Supplementary Figure 1. Additional RNAi screen data A. Cisplatin induced ATR autophosphorylation. Western blot illustrating ATR and phospho-atr (T1989) in cells exposed to 1 µm cisplatin for 24 hours prior

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

More information

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4

More information

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

More information

Journal of Cell Science Supplementary Material

Journal of Cell Science Supplementary Material 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

More information

FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and

FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and Supplementary Figures FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and mutant (mut) cells. Higher magnification is shown in Figure 1A. Arrows indicate cisplatin-induced

More information

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection

More information

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

14_integrins_EGFR

14_integrins_EGFR α1 Integrin α1 -/- fibroblasts from integrin α1 knockout animals Figure S1. Serum-starved fibroblasts from α -/- 1 and +/+ mice were stimulated with 10% FBS for 30 min. (FBS) or plated on collagen I (CI)

More information

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.

More information

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct (pgl38xgli), EWS-FLI1 luciferase reporter construct (NROB1-Luc) with or without GLI1, EWS- FLI1 and cdnas respectively.

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

More information

Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743

Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743 Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743 Technical support: 1-888-412-2225 Page 1 Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743

More information

Transfection Reagent SPECIFICATIONS MATERIALS. For Research Use Only. Materials Supplied. Materials required, but not supplied

Transfection Reagent SPECIFICATIONS MATERIALS. For Research Use Only. Materials Supplied. Materials required, but not supplied TransIT-siQUEST Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2110 INTRODUCTION TransIT-siQUEST is a broad spectrum sirna transfection reagent

More information

Supporting Information

Supporting Information Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:

More information

M X 500 µl. M X 1000 µl

M X 500 µl. M X 1000 µl GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,

More information

Figure S1. Optimization of reverse-transfection protocols using GAPDH sirnas. MDA- MB-231 cells were seeded in 96-well plates at a density of 5000

Figure S1. Optimization of reverse-transfection protocols using GAPDH sirnas. MDA- MB-231 cells were seeded in 96-well plates at a density of 5000 Figure S1. Optimization of reverse-transfection protocols using GAPDH sirnas. MDA- MB-231 cells were seeded in 96-well plates at a density of 5000 cells per well, and reverse transfected with the indicated

More information

Second Generation PARP1 Pharmacodynamic Assay

Second Generation PARP1 Pharmacodynamic Assay Second Generation PARP1 Pharmacodynamic Assay 1 What is a Pharmacodynamic Assay? Pharmacodynamic Assays: Provide evidence of drug action on molecular target. Guide drug development process. Base line values

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction

Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Journal of Alzheimer s Disease 20 (2010) 1 9 1 IOS Press Supplementary Material Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Mithu Raychaudhuri and Debashis

More information

Supplemental Material: Rev1 promotes replication through UV lesions in conjunction with DNA

Supplemental Material: Rev1 promotes replication through UV lesions in conjunction with DNA Supplemental Material: Rev1 promotes replication through UV lesions in conjunction with DNA polymerases,, and, but not with DNA polymerase Jung-Hoon Yoon, Jeseong Park, Juan Conde, Maki Wakamiya, Louise

More information

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated

More information

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna

More information

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1: Activation of the ATM pathway by I-PpoI. A. HEK293T cells were either untransfected, vector transfected, transfected with an I-PpoI expression vector, or subjected to 2Gy γ-irradiation. 24 hrs

More information

Transfection Reagent Protocol for MIR 2110, 2114, 2115, 2116

Transfection Reagent Protocol for MIR 2110, 2114, 2115, 2116 TransIT-siQUEST Transfection Reagent INTRODUCTION TransIT-siQUEST is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery and knockdown of target gene expression in many

More information

OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes

OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes High-throughput Gene Function Validation Tool Introduction sirna screening libraries enable scientists to identify

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla

More information

FSC-H FSC-H FSC-H

FSC-H FSC-H FSC-H Supplement Figure A 4 h control + h B 4 h control + h Supplement Figure A-H BV6/TNF-α + ctrl A B 9 h C D h E F 8 h G H Supplement Figure I-P + ctrl I J 8 h K L 4 h M N h O P Supplement Figure 3 A Survival

More information

Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2

Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Department of Anatomy, Yong Loo Lin School of Medicine, National University of Singapore MD10, 4 Medical Drive, Singapore 117597 ABSTRACT

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Analyses of ECTRs by C-circle and T-circle assays.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Analyses of ECTRs by C-circle and T-circle assays. Supplementary Figure 1 Analyses of ECTRs by C-circle and T-circle assays. (a) C-circle and (b) T-circle amplification reactions using genomic DNA from different cell lines in the presence (+) or absence

More information

Loss of Cul3 in Primary Fibroblasts

Loss of Cul3 in Primary Fibroblasts PSU McNair Scholars Online Journal Volume 5 Issue 1 Humans Being: People, Places, Perspectives and Processes Article 15 2011 Loss of Cul3 in Primary Fibroblasts Paula Hanna Portland State University Let

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/258/rs3/dc1 Supplementary Materials for A Genome-Wide sirna Screen Reveals Positive and Negative Regulators of the NOD2 and NF-κB Signaling Pathways Neil Warner,

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the

More information

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity] L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different

More information

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

TransIT-X2 Dynamic Delivery System

TransIT-X2 Dynamic Delivery System INTRODUCTION TransIT-X2 Dynamic Delivery System is an advanced, non-liposomal polymeric system that enables high efficiency transfection of many cell types, including primary cells. TransIT-X2 can be used

More information

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells

More information

Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells

Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells Debasis Nayak, a,1 Anmol Kumar, b Souneek Chakraborty, a,1 Reyaz ur Rasool, a,1 Hina Amin, a Archana

More information

Supporting Information

Supporting Information Supporting Information Zorde Khvalevsky et al..73/pnas.337.9 mm sikrsg Molecule PG Matrix ± mm right sc left retained in OER E T= days T= days (iver) T= days (PS) Fig. S. OER characteristics. () iagram

More information

Supplementary Information

Supplementary Information Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara

More information

Supplementary Figure Legends

Supplementary Figure Legends Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/496/eaam6291/dc1 Supplementary Materials for Regulation of autophagy, NF-κB signaling, and cell viability by mir-124 in KRAS mutant mesenchymal-like NSCLC cells

More information

Supplemental Figure 1: CIP2A and SET levels are increased in some. primary human pancreatic cancer samples. (A) CIP2A mrna levels were

Supplemental Figure 1: CIP2A and SET levels are increased in some. primary human pancreatic cancer samples. (A) CIP2A mrna levels were Supplemental Figure Legends and Figures: Supplemental Figure 1: CIP2A and SET levels are increased in some primary human pancreatic cancer samples. (A) CIP2A mrna levels were measured in 3 benign (non-cancer)

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-06-1-0323 TITLE: Checkpoint Functions of the BRCA1/BARD1 Tumor Suppressor PRINCIPAL INVESTIGATOR: Ami Modi CONTRACTING ORGANIZATION: Columbia University New York, NY 10032 REPORT

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A)

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) Supplementary Figure Legends Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) High-resolution oligonucleotide-based array comparative genomic hybridization shows normal DNA copy number

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

Supplementary Figure 1. Related to Figure 1. Characterization of centrosome fragmentation in mitotically delayed RPE1 cells. (a) Cells transiently

Supplementary Figure 1. Related to Figure 1. Characterization of centrosome fragmentation in mitotically delayed RPE1 cells. (a) Cells transiently Supplementary Figure 1. Related to Figure 1. Characterization of centrosome fragmentation in mitotically delayed RPE1 cells. (a) Cells transiently transfected with EGFP centrin-2 (Green), synchronized

More information

Validation of Hits from an sirna Library Screen using Real-Time qpcr. Gregory L. Shipley The University of Texas Health Science Center- Houston

Validation of Hits from an sirna Library Screen using Real-Time qpcr. Gregory L. Shipley The University of Texas Health Science Center- Houston Validation of Hits from an sirna Library Screen using Real-Time qpcr Gregory L. Shipley The University of Texas Health Science Center- Houston sirnas and Gene Silencing Small interfering RNAs or sirnas

More information

supplementary information

supplementary information DOI: 10.1038/ncb2156 Figure S1 Depletion of p114rhogef with different sirnas. Caco-2 (a) and HCE (b) cells were transfected with individual sirnas, pools of the two sirnas or the On Target (OnT) sirna

More information

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1 A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the

More information

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively. Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK

More information

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53 Supplementary Information ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53 Kelly D. Sullivan 1, Nuria Padilla-Just 1, Ryan E. Henry 1, Christopher C. Porter 2, Jihye Kim 3,

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

Supplementary methods Shoc2 In Vitro Ubiquitination Assay

Supplementary methods Shoc2 In Vitro Ubiquitination Assay Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the

More information

Supplementary Figures and Legends.

Supplementary Figures and Legends. Supplementary Figures and Legends. Supplementary Figure 1: Impact of injury on Rb1 and PPARϒ expression. Following ipsilateral axotomy injury, adult DRG expression of Rb1 mrna declined (*p

More information

In-Cell Western QUANTITATIVE CELL-BASED ASSAYS ACCURATE QUANTIFICATION MULTIPLEX DETECTION HIGH SENSITIVITY DIRECT DETECTION

In-Cell Western QUANTITATIVE CELL-BASED ASSAYS ACCURATE QUANTIFICATION MULTIPLEX DETECTION HIGH SENSITIVITY DIRECT DETECTION In-Cell Western QUANTITATIVE CELL-BASED ASSAYS ACCURATE QUANTIFICATION MULTIPLEX DETECTION HIGH SENSITIVITY DIRECT DETECTION IMMUNOFLUORESCENT-BASED ASSAY MULTIPLE TARGETS In-Cell Western QUANTITATIVE

More information

VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor

VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor Liang Xue 1, Emily E. Blythe 1, Elyse C. Freiberger 2, Jennifer Mamrosh 1, Alexander S. Hebert

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery and knockdown of target gene expression in many cell types including primary cells. TransIT-TKO

More information

Supplementary Information for: CRISPR/Cas9-based target validation. for p53-reactivating model compounds

Supplementary Information for: CRISPR/Cas9-based target validation. for p53-reactivating model compounds for: CRISPR/Cas9-based target validation for p53-reactivating model compounds Michael Wanzel 1,5, Jonas B. Vischedyk 1, Miriam P. Gittler 1, Niklas Gremke 1, Julia R. Seiz 1, Mirjam Hefter 1, Magdalena

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Elastase levels and activity are increased in dystrophic muscle and impair myoblast cell survival, proliferation and differentiation N. Arecco 1,2,3, C.J. Clarke 1,2, F.K. Jones 1,2, D. Simpson 1,4, D.

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.

More information

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/282/ra53/dc1 Supplementary Materials for Estrogen Alters the Splicing of Type 1 Corticotropin-Releasing Hormone Receptor in Breast Cancer Cells Suchita Lal,

More information

Supplemental Experimental Procedures

Supplemental Experimental Procedures Supplemental Experimental Procedures Generation of BLM protein segments and mutants. For immunoprecipitation experiments with topoisomerase IIα, BLM N-terminal segments were generated by PCR amplification

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

TRIM31 is recruited to mitochondria after infection with SeV.

TRIM31 is recruited to mitochondria after infection with SeV. Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

More information

Supplementary Table, Figures and Videos

Supplementary Table, Figures and Videos Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation

More information

Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples

Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.

More information

mir-24-mediated down-regulation of H2AX suppresses DNA repair

mir-24-mediated down-regulation of H2AX suppresses DNA repair Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn

More information

Supplementary Discussion and Figures

Supplementary Discussion and Figures Supplementary Discussion and Figures Differences in chromatin retention between the two CHD3 isoforms The pan-nuclear loss of the KAP-1-interacting CHD3 isoform from chromatin (observed in Fig. 2A) is

More information