Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
|
|
- Abel Baldwin
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Multiple sequence alignments of four Swi2/Snf2 subfamily proteins, ScChd1, SsoRad54 and the RNA helicase Vasa. The sequence alignments of the Swi2/Snf2 subfamily proteins, ScChd1 and SsoRad54 were done with Clustal Omega, which were further aligned with the sequence of Vasa according to structural superposition (PDB code 2DB3). Secondary structural assignments labeled on the top are based on the structure determined in this study, and the helicase motifs are assigned as reported 23. The assignment of HSA domain is based on the reported structure (PDB code 4I6M) 20. The SnAc domain is labeled as an orange bar. The residues numbering is based on the sequence of MtSnf2. The suppressor mutants found in ScSth1 are labeled as magenta dots (in posthsa) and yellow dots (in supph) 18. Blue dots, the DNA-binding residues identified in this study; blue triangles, arginine fingers; red triangle, cancer-associated mutations found in human Brg1 gene 11, Bartlett, C., Orvis, T.J., Rosson, G.S. & Weissman, B.E. BRG1 mutations found in human cancer cell lines inactivate Rb-mediated cell-cycle
2 arrest. J. Cell Physiol. 226, (2011). 51. Medina, P.P. et al. Genetic and epigenetic screening for gene alterations of the chromatin-remodeling factor, SMARCA4/BRG1, in lung tumors. Genes Chromosomes Cancer 41, (2004). 52. Medina, P.P. et al. Frequent BRG1/SMARCA4-inactivating mutations in human lung cancer cell lines. Hum. Mutat. 29, (2008). 53. Wong, A.K. et al. BRG1, a component of the SWI-SNF complex, is mutated in multiple human tumor cell lines. Cancer Res. 60, (2000).
3 Supplementary Figure 2 SAXS measurements of MtSnf2. (a) Three different views of the overlay of the final average ab initio molecular envelope of MtSnf2 ( ) reconstructed from SAXS measurements (grey) with the docked crystal structure. The protein is colored as in Fig.1, and the N-and C-termini are labeled. Additional densities near the N- and C-termini can be attributed to the disordered residues at both ends (the first 13 and the last 48 residues, respectively). (b) Scattering intensity in arbitrary units versus momentum transfer q in Å -1 for MtSnf2. The linear fitting in the Guinier region of scattering curve (inset) indicates that MtSnf2 is monodisperse and homogenuous in solution. (b) The dimensionless Kratkyplot of MtSnf2 has typical feature for folded protein with disordered regions. (d) Pair distance distribution function (PDDF) of MtSnf2 with D max = 117 Å calculated using GNOM (q max =0.30 Å -1 ). (e) Fitting the theoretical scattering curve (red line) of MtSnf2 crystal structure to the experimental scattering curve (black circles), with a chi of 2.1. The theoretical SAXS curve agrees well with the SAXS measurement in solution, further validating the observed conformation in the crystals.
4 Supplementary Figure 3 Comparisons with the SF2 family proteins SsoRad54 and Vasa. (a) Structural alignment of the core1 domains of MtSnf2 (green) and SsoRad54 (grey). The DNA bound by SsoRad54 is shown as ribbon presentation. The DNA-binding sites of the core1 domains of MtSnf2 and SsoRad54 align very well, with K665 and K692 of MtSnf2 located at the same positions as R547 and K573 of SsoRad54. K687 of MtSnf2 is disordered in current structure, and aligned with K568 of SsoRad54 in the primary sequence (Supplementary Figure 1). (b) Structural alignment of the core2 domains of MtSnf2 (cyan) and SsoRad54 (grey). The arginine fingers of SsoRad54 are labeled (R840 and R843). The DNA binds to the surface of the core2 domain of SsoRad54 at a position in conflict with the SnAc domain (orange) of MtSnf2, suggesting MtSnf2 interacts with DNA in a different manner. Instead, biochemical analyses indicated that DNA contacts the core2 domains of both proteins in solution at motif V (around R950 of MtSnf2 and K808 of SsoRad54). R832 of MtSnf2 is also involved in DNA binding, which is absence in SsoRad54. (c) Structural alignment of the core1 domains of MtSnf2 (green) and Vasa helicase (grey). The bound RNA by Vasa is shown as stick presentation. Motif I of MtSnf2 is colored red, with bound sulfate ion as sphere presentation. The DNAbinding sites of MtSnf2 (K665, K687 and K692) identified in this study are in close proximity to the RNA bound by Vasa. (d) Structural alignment of the core2 domains of MtSnf2 (green) and Vasa (grey). Motif VI of MtSnf2 is colored red. The DNA-binding site of R950 in MtSnf2 is close to the RNA bound by Vasa.
5 Supplementary Figure 4 Interactions between post-hsa and supph of MtSnf2. (a) Structure of the posthsa-supph region of MtSnf2. The structure is colored as in Fig.1 with the supph helix in yellow. The suppressor mutants of ScSth1 are mapped to the corresponding positions of MtSnf2 (showed as stick models) 18. Residues are labeled based on the sequence of MtSnf2, and the residues in the parentheses are the corresponding suppressor mutants of ScSth1. Three suppressor mutations are located at posthsa (N384K, D385Yand L392V) and four at supph (E676Q, L680M/V, L681F and K688T). Two mutations at the HSA domain (T373P and K382N) are not present in the current structure. (b) Interactions between supph, posthsa and the core1 domain. The core1 domain is shown as surface presentation, and colored coded by the spectra of blue-to-white (decreasing conservation). The posthsa and supph helices bind to a conserved surface of the core1 domain through hydrophobic interactions, and they also interact with each other through specific H-bonds. (c) Multiple sequence alignments of the Swi2/Snf2 subfamily proteins around the posthsa and supph regions. The suppressor mutations of Sth1 are highlighted in magenta and yellow at the posthsa and supph helices, respectively.
6 Supplementary Figure 5 Chromatin-remodeling activities of various constructs used in this study. (a) Gels of the restriction enzyme-accessibility assays of four core1-core2 interface mutants of MtSnf2 ( ). The cut fractions were quantified and shown in Fig. 3d. Three independent assays were performed and one was showed. (b) Gels of the restriction enzyme-accessibility assays of MtSnf2 ( ) with the WT interface and five DNA-binding mutants. The cut fractions were shown in Fig. 4e. (c) Gels of the restriction enzyme-accessibility assays for ScSnf2 with different N-terminal boundaries. The catalytic core of ScSnf2 ( ), left panel; half HSAcontaining ScSnf2 ( ), middle panel; full HSA-containing ScSnf2 ( ) in complex with Arp7-Arp9-Rtt102 (Snf2 tetramer), right panel. The cut fractions were quantified and shown in Fig. 5c. (d) Gels of the restriction enzyme-accessibility assays of MtSnf2 with different N- terminal boundaries. The catalytic core MtSnf2 ( ), left panel; half HSA-containing MtSnf2 ( ), middle panel. The cut fractions were shown on the right. (e) The ATPase activities of MtSnf2 with different N-terminal boundaries in the absence (-) and presence of DNA/NCP. MtSnf2 ( ), black; MtSnf2 ( ), white. (f) Gels of the restriction enzyme-accessibility assays of MtSnf2 with truncation of the C- terminal flexible tail at different positions. The cut fractions were quantified and shown in Fig. 6e.
7 Supplementary Figure 6 Nucleosome binding activities of various constructs used in this study. (a) EMSA of the nucleosome binding activities of MtSnf2 ( ) with the WT interface and five DNA-binding mutants. 2 nm Cy5-labelled 147 bp NCP was mixed with increasing amounts of proteins (in nm). The samples were resolved by electrophoresis on 4.5% native acrylamide gels, and the fluorescent bands were detected by Typhoon Trio+ imager. With higher concentrations of the proteins, the bound NCPs migrate more slowly, suggesting a heterogeneous population of the protein-bound NCP in the solution, and one NCP might bind more than one molecule of the protein. The star * sign indicates the position of free DNA. The bound fractions were quantified as the disappearance of free NCP relative to the intensity of the whole lane, and shown in Fig. 4c. (b) EMSA of nucleosome binding of three constructs of ScSnf2. The quantification of the bound fractions was showed in Fig. 5a. (c) EMSA of nucleosome binding of MtSnf2 ( ). EMSA of MtSnf2 ( ) was shown in Supplementary Fig. 6a, the left panel (WT interface). Quantification of the bound fractions is shown (right panel). The apparent Kds of the catalytic core MtSnf2 ( ) and the HSA-containing MtSnf2 ( ) are about 150 nm and 190 nm, respectively. (d) EMSA of nucleosome binding of MtSnf2 with truncation of the C-terminal flexible tail at different positions. EMSA of MtSnf2 ( ) was shown in Supplementary Fig. 6a, the left panel (WT interface). The quantification of the bound fractions is showed in Fig. 6c.
Supplementary Online Material. Structural mimicry in transcription regulation of human RNA polymerase II by the. DNA helicase RECQL5
Supplementary Online Material Structural mimicry in transcription regulation of human RNA polymerase II by the DNA helicase RECQL5 Susanne A. Kassube, Martin Jinek, Jie Fang, Susan Tsutakawa and Eva Nogales
More informationSupplemental Information Molecular Cell, Volume 41
Supplemental Information Molecular Cell, Volume 41 Molecular Mechanisms for the RNA-Dependent ATPase Activity of Upf1 and Its Regulation by Upf2 Sutapa Chakrabarti, Uma Jayachandran, Fabien Bonneau, Francesca
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,
More informationSuppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid
Supplementary Figures Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid sequence of Drosophila RCC1. Same colors are for Figure 1 with sequence of β-wedge that interacts with Ran in
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures 1-8
SUPPLEMENTARY INFORMATION Supplementary Figures 1-8 Supplementary Figure 1. TFAM residues contacting the DNA minor groove (A) TFAM contacts on nonspecific DNA. Leu58, Ile81, Asn163, Pro178, and Leu182
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Domain architecture and conformational states of the decapping complex, as revealed by structural studies. (a) Domain organization of Schizosaccharomyces pombe (Sp) and Saccharomyces
More informationNature Structural & Molecular Biology: doi: /nsmb.3428
Supplementary Figure 1 Biochemical characterization of the monou and oligou activity switch of TUT4(7). (a) Mouse TUT4 and human TUT7 were assayed for monou and Lin28-dependent oligou addition activities
More informationSupplementary Figure S1. Binding of HSA mutants to hfcrn. (a) The levels of titrated amounts of HSA
Supplementary Figure S1. Binding of HSA mutants to hfcrn. (a) The levels of titrated amounts of HSA variants (5.0-0.002 μg/ml) directly coated in the wells at ph 6.0 were controlled using a horseradish
More informationSupplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a
Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a HNH-state 1 in PDB 4OO8, in which the distance from the C atom of the HNH catalytic residue 840 to the
More informationRNP purification, components and activity.
Supplementary Figure 1 RNP purification, components and activity. (a) Intein-mediated RNP production and purification. The Ll.LtrB intron RNA (red) (Exons E1 and E2 in green) and associated intron encoded
More informationSupplementary Table 1. DNA sequence synthesized to express the Zika virus NS5 protein.
Supplementary Table 1. DNA sequence synthesized to express the Zika virus NS5 protein. MR766 NS5 sequence 1 ACAGAGAACAGATTGGTGGTGGAGGTGGGACGGGAGAGACTCTGGGAGAGAAGTGGAAAG 61 CTCGTCTGAATCAGATGTCGGCCCTGGAGTTCTACTCTTATAAAAAGTCAGGTATCACTG
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature08627 Supplementary Figure 1. DNA sequences used to construct nucleosomes in this work. a, DNA sequences containing the 601 positioning sequence (blue)24 with a PstI restriction site
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06147 SUPPLEMENTARY INFORMATION Figure S1 The genomic and domain structure of Dscam. The Dscam gene comprises 24 exons, encoding a signal peptide (SP), 10 IgSF domains, 6 fibronectin
More informationChapter 14 Regulation of Transcription
Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription
More informationSupplementary Information. Structural basis for duplex RNA recognition and cleavage by A.
Supplementary Information Structural asis for duplex RNA recognition and cleavage y A. fulgidus C3PO Eneida arizotto 1, Edward D Lowe 1 & James S Parker 1 1 Department of Biochemistry University of Oxford
More informationVisualization of codon-dependent conformational rearrangements during translation termination
Supplementary information for: Visualization of codon-dependent conformational rearrangements during translation termination Shan L. He 1 and Rachel Green 1 1 Howard Hughes Medical Institute, Department
More informationNature Structural & Molecular Biology: doi: /nsmb.2996
Supplementary Figure 1 Negative-stain EM of native cytoplasmic dynein. (a) A representative micrograph of negatively stained dynein, with the flexible dimeric molecules circled in white. (b) Reference-free
More informationSupplementary Information for. Structure of human tyrosylprotein sulfotransferase-2 reveals the mechanism of protein tyrosine sulfation reaction
Supplementary Information for Structure of human tyrosylprotein sulfotransferase-2 reveals the mechanism of protein tyrosine sulfation reaction Takamasa Teramoto, Yukari Fujikawa, Yoshirou Kawaguchi, Katsuhisa
More informationHEK293T. Fig. 1 in the
Supplementary Information Supplementary Figure 1 Zinc uptake assay of hzip4 and hzip4-δecd transiently expressed in HEK293T cells. The results of one representative e experiment are shown in Fig. 1 in
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Crystallographic statistics CRM1-SNUPN complex Space group P6 4 22 a=b=250.4, c=190.4 Data collection statistics: CRM1-selenomethionine SNUPN MAD data Peak Inflection Remote Native
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Mechanism for signal-induced opening of the DNA box. a, An atomic model of the DNA box held closed by locks (orange and blue) that are double helices formed by two short strands
More informationSUPPLEMENTARY INFORMATION
Results Construct purification and coupling. Two A1-GP1bα ReaLiSM constructs, with and without cysteine residues near the N and C-termini (Fig. S2a), were expressed and purified by Ni affinity chromatography
More informationNature Structural & Molecular Biology: doi: /nsmb.2548
Supplementary Figure 1. Structure of GltPhout. (a) Stereo view of a slice through a single GltPhout protomer shown in stick representation along with 2Fo-Fc and anomalous difference electron maps. The
More informationHmwk # 8 : DNA-Binding Proteins : Part II
The purpose of this exercise is : Hmwk # 8 : DNA-Binding Proteins : Part II 1). to examine the case of a tandem head-to-tail homodimer binding to DNA 2). to view a Zn finger motif 3). to consider the case
More informationSam68 STARR Sam68 QUA1- KH. p(r ) [Å] [Å] TSTAR STAR. Sam68 QUA1-KH and. constructs are
a b Sam68 STARR Sam68 QUA1- KH c d e ) p(r p(r ) r [Å] r [Å] Supplementary Figure 1: The QUA2 domain is not involved in i the overall conformation of the STAR domain (a) Overlay of T-STAR QUA1-KH in complex
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationSUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly
SUPPLEMENTARY INFORMATION Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly Dustin J. E. Huard, Kathleen M. Kane and F. Akif Tezcan* Department of Chemistry and Biochemistry,
More informationSupplementary Figure 1. FRET probe labeling locations in the Cas9-RNA-DNA complex.
Supplementary Figure 1. FRET probe labeling locations in the Cas9-RNA-DNA complex. (a) Cy3 and Cy5 labeling locations shown in the crystal structure of Cas9-RNA bound to a cognate DNA target (PDB ID: 4UN3)
More informationSUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS
SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS Riccardo Miggiano 1, Valentina Casazza 1, Silvia Garavaglia 1,
More informationSUPPLEMENTARY INFORMATION. Chemical modulation of Chaperone-mediated autophagy by novel
SUPPLEMENTARY INFORMATION Chemical modulation of Chaperone-mediated autophagy by novel retinoic acid derivatives Jaime Anguiano 1, Thomas P Garner 2, Murugesan Mahalingam 1, Bhaskar C. Das 1, Evripidis
More informationhas only one nucleotide, U20, between G19 and A21, while trna Glu CUC has two
SPPLEMENTRY INFORMTION doi:1.138/nature9411 Supplementary Discussion The structural characteristics of trn Gln G in comparison to trn Glu 16 in trn Gln G is directed towards the G19 56 pair, or the outer
More informationSupplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain
Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain architecture. Various C-terminal fragments were cloned and
More informationWhy does this matter?
Background Why does this matter? Better understanding of how the nucleosome affects transcription Important for understanding the nucleosome s role in gene expression Treats each component and region of
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10258 Supplementary Figure 1 Reconstitution of the CENP-A nucleosome with recombinant human histones H2A, H2B, H4, and CENP-A. a, Purified recombinant human
More informationMolecular design principles underlying β-strand swapping. in the adhesive dimerization of cadherins
Supplementary information for: Molecular design principles underlying β-strand swapping in the adhesive dimerization of cadherins Jeremie Vendome 1,2,3,5, Shoshana Posy 1,2,3,5,6, Xiangshu Jin, 1,3 Fabiana
More informationChapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO
More informationNature Structural & Molecular Biology: doi: /nsmb.3175
Supplementary Figure 1 Medium- and low-fret groups probably representing varying positions on the DNA show similar changes between H3 and CENP-A nucleosomes with and without CENP-C CD, as does the high-fret
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Construction of a sensitive TetR mediated auxotrophic off-switch.
Supplementary Figure 1 Construction of a sensitive TetR mediated auxotrophic off-switch. A Production of the Tet repressor in yeast when conjugated to either the LexA4 or LexA8 promoter DNA binding sequences.
More informationSUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are the amino acid sequences of human DDR2, mouse DDR2 and the closest homologs in zebrafish and C. Elegans.
More informationThe molecular basis of lysine 48 ubiquitin chain synthesis by Ube2K
Supplementary Information The molecular basis of lysine 48 ubiquitin chain synthesis by Adam J. Middleton, Catherine L. Day* Department of Biochemistry, Otago School of Medical Sciences, University of
More informationSolutions to 7.02 Quiz II 10/27/05
Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11726 Supplementary Figure 1 SRP RNA constructs used in single molecule experiments. a, Secondary structure of wildtype E. coli SRP RNA, which forms an elongated hairpin structure capped
More informationSequence Determinants of a Conformational Switch in a Protein
Sequence Determinants of a Conformational Switch in a Protein Thomas A. Anderson, Matthew H. J. Cordes, and Robert T. Sauer Kyle Skalenko 4/17/09 Introduction Protein folding is guided by the following
More informationX-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction
X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction Tomohisa Shimasaki 1, Hiromi Yoshida 2, Shigehiro Kamitori 2 & Koji
More informationPlant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter
Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA
More informationSupplementary Figure 1 Telomerase RNA fragments used in single-molecule FRET experiments. A pseudoknot fragment (nts ) labeled at position U42
Supplementary Figure 1 Telomerase RNA fragments used in single-molecule FRET experiments. A pseudoknot fragment (nts 32-195) labeled at position U42 with Cy3 (green circle) was constructed by a two piece
More informationSupplemental Figure 1
Supplemental Figure 1 Supplemental Fig. 1. (A) The binding avidity between Fz4-FcH6 and MBP-Norrin dimers measured by biolayer interferometry. 5 µg/ml Fz4-Fc protein was loaded onto anti human Fc capture
More information(a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The
1 Supplementary Figure 1 Design of the DNA origami spring (nanospring). (a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The scheme was produced by cadnano software 1. Scaffold,
More informationPDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.
More informationStructure and Possible Mechanism of the CcbJ Methyltransferase from Streptomyces caelestis
Supplemental material to accompany Structure and Possible Mechanism of the CcbJ Methyltransferase from Streptomyces caelestis Jacob Bauer, a Gabriela Ondrovičová, a Lucie Najmanová, b Vladimír Pevala,
More informationSUPPLEMENTARY INFORMATION Figures. Supplementary Figure 1 a. Page 1 of 30. Nature Chemical Biology: doi: /nchembio.2528
SUPPLEMENTARY INFORMATION Figures Supplementary Figure 1 a b c Page 1 of 0 11 Supplementary Figure 1: Biochemical characterisation and binding validation of the reversible USP inhibitor 1. a, Biochemical
More informationSite-specific time-resolved FRET reveals local variations in the unfolding mechanism in an apparently two-state protein unfolding transition
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2017 Supplementary information for Site-specific time-resolved FRET reveals local variations
More informationSupplemental Information. Structural Basis for Guide RNA Processing and. Seed-Dependent DNA Targeting by CRISPR-Cas12a
Molecular Cell, Volume 66 Supplemental Information Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a Daan C. Swarts, John van der Oost, and Martin Jinek Figure
More informationhuman Cdc45 Figure 1c. (c)
1 Details of the refined crystallographic model of human Cdc45 and comparison of its active-site region with that of bacterial RecJ. (a) Stereo view of a representative example of the final 2F o -F c electron
More informationMycobacterium tuberculosis (Mtb) and Mycobacterium smegmatis (Msmeg) contain two ε (dnaq) exonuclease homologs.
Supplementary Figure 1 Mycobacterium tuberculosis (Mtb) and Mycobacterium smegmatis (Msmeg) contain two ε (dnaq) exonuclease homologs. (a) Sequence alignment of the ε-exonuclease homologs from four different
More informationChromatin Structure. a basic discussion of protein-nucleic acid binding
Chromatin Structure 1 Chromatin DNA packaging g First a basic discussion of protein-nucleic acid binding Questions to answer: How do proteins bind DNA / RNA? How do proteins recognize a specific nucleic
More informationOligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis
SUPPLEMENRY INFORMION Purification of probes and Oligonucleotides sequence Oligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis and recovered by electroelution. Labelling
More informationEnhancers. Activators and repressors of transcription
Enhancers Can be >50 kb away from the gene they regulate. Can be upstream from a promoter, downstream from a promoter, within an intron, or even downstream of the final exon of a gene. Are often cell type
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/11/e1601625/dc1 Supplementary Materials for A molecular mechanism of chaperone-client recognition This PDF file includes: Lichun He, Timothy Sharpe, Adam Mazur,
More informationStructural basis of a novel PD-L1 nanobody for immune checkpoint blockade
Structural basis of a novel PD-L1 nanobody for immune checkpoint blockade Supplementary Materials Supplementary methods Table S1-S Figure S1-S 1 1 1 1 1 1 1 1 1 0 1 0 Supplementary Methods Competitive
More informationAP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?
The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationEnsemble refinement shows conformational flexibility in crystal structures of human complement factor D
Supplementary Information for Ensemble refinement shows conformational flexibility in crystal structures of human complement factor D Federico Forneris a,b, B. Tom Burnley a,b,c and Piet Gros a * a Crystal
More informationDNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli
Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain
More informationModulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system
SUPPLEMENTARY DATA Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system Daniel Gleditzsch 1, Hanna Müller-Esparza 1, Patrick Pausch 2,3, Kundan Sharma 4, Srivatsa Dwarakanath 1,
More informationMolecular Biology (BIOL 4320) Exam #1 March 12, 2002
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.
More informationSupplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0
More informationSupplementary Fig. 1. Initial electron density maps for the NOX-D20:mC5a complex obtained after SAD-phasing. (a) Initial experimental electron
Supplementary Fig. 1. Initial electron density maps for the NOX-D20:mC5a complex obtained after SAD-phasing. (a) Initial experimental electron density map obtained after SAD-phasing and density modification
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1: Function of MICAL1 and dmical in cytokinesis (a) HeLa transfected with GFP- MICAL1 (green) were stained with Aurora B (red). Scale bars, 10 µm. (b) Western
More informationMolecular basis for H3K36me3 recognition by the Tudor domain of PHF1
Supplementary information Molecular basis for H3K36me3 recognition by the Tudor domain of PHF1 Catherine A. Musselman 1, Nikita Avvakumov 2, Reiko Watanabe 3, Christopher G. Abraham 4, Marie-Eve Lalonde
More informationPhi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail. Marc C Morais et al., Nature Structural Biology 2003
Phi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail Marc C Morais et al., Nature Structural Biology 2003 Free scaffold 13+ 10 min 3 min 1 min 40 sec 100 % 0 100 % 0 100 % 0 100 % 0 Partially
More informationSupporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy
Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy Jonathan R. Burns* & Stefan Howorka* 1 Contents 1. Design of DNA nanopores... 3 1.1.
More informationA quantitative investigation of linker histone interactions with nucleosomes and chromatin
White et al Supplementary figures and figure legends A quantitative investigation of linker histone interactions with nucleosomes and chromatin 1 Alison E. White, Aaron R. Hieb, and 1 Karolin Luger 1 White
More informationSupplementary Information. Single-molecule analysis reveals multi-state folding of a guanine. riboswitch
Supplementary Information Single-molecule analysis reveals multi-state folding of a guanine riboswitch Vishnu Chandra 1,4,#, Zain Hannan 1,5,#, Huizhong Xu 2,# and Maumita Mandal 1,2,3,6* Department of
More informationSupplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494
Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting
More informationSUPPLEMENTARY INFORMATION. Determinants of laminin polymerization revealed. by the structure of the α5 chain amino-terminal region
SUPPLEMENTARY INFORMATION Determinants of laminin polymerization revealed by the structure of the α5 chain amino-terminal region Sadaf-Ahmahni Hussain 1, Federico Carafoli 1 & Erhard Hohenester 1 1 Department
More informationEngineering splicing factors with designed specificities
nature methods Engineering splicing factors with designed specificities Yang Wang, Cheom-Gil Cheong, Traci M Tanaka Hall & Zefeng Wang Supplementary figures and text: Supplementary Figure 1 Supplementary
More informationZhang et al., RepID facilitates replication Initiation. Supplemental Information:
Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the
More informationPractice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients.
Practice Exam 2007 1. A special JAK-STAT signaling system (JAK5-STAT5) was recently identified in which a gene called TS5 becomes selectively transcribed and expressed in the liver upon induction by a
More informationSupplementary Note 1. Enzymatic properties of the purified Syn BVR
Supplementary Note 1. Enzymatic properties of the purified Syn BVR The expression vector pet15b-syn bvr allowed us to routinely prepare 15 mg of electrophoretically homogenous Syn BVR from 2.5 L of TB-medium
More informationSupplementary Figure 1. Supporting data for Figure 1
Supplementary Figure 1 Supporting data for Figure 1 (A) Schematic of BLI assay used to measure dissociation. 5 monobiotinylated substrate DNA (identical to λ1, Figure 2) is associated with streptavidin-coated
More informationComplex Transcription Machinery
Complex Transcription Machinery Subunits of the Basal Txn Apparatus Stepwise Assembly of the Pre-initiation Complex Interplay of Activators, Co-regulators and RNA Polymerase at the Promoter Divide and
More informationCSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004
CSE 397-497: Computational Issues in Molecular Biology Lecture 19 Spring 2004-1- Protein structure Primary structure of protein is determined by number and order of amino acids within polypeptide chain.
More informationReduced structural flexibility for exonuclease deficient DNA polymerase III mutant
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Reduced structural flexibility for exonuclease deficient DNA polymerase III mutant
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationBiol 321 Spring 2013 Quiz 4 25 pts NAME
Biol 321 Spring 2013 Quiz 4 25 pts NAME 1. (3 pts.) a. What is the name of this compound? BE EXPLICIT deoxyribose 5 b. Number the carbons on this structure: 4 1 3 2 2. (4 pts.) Circle True or False. If
More informationSupplementary Figure 1 Strategy for parallel detection of DHSs and adjacent nucleosomes
Supplementary Figure 1 Strategy for parallel detection of DHSs and adjacent nucleosomes DNase I cleavage DNase I DNase I digestion Sucrose gradient enrichment Small Large F1 F2...... F9 F1 F1 F2 F3 F4
More informationSupplementary Information Crystal structure, biochemical and cellular activities demonstrate separate functions of MTH1 and MTH2
Supplementary Information Crystal structure, biochemical and cellular activities demonstrate separate functions of MTH1 and MTH2 Supplementary Figure 1 Comparison of activities of NUDIX proteins with nucleotide
More informationSupplementary information to eif4b stimulates eif4a ATPase and unwinding activities by direct
Supplementary information to eif4b stimulates eif4a ATPase and unwinding activities by direct interaction through its 7-repeats region, Alexandra Z. Andreou, Ulf Harms & Dagmar Klostermeier. Supplementary
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationSupplemental Information. Single-Molecule Imaging Reveals How. Mre11-Rad50-Nbs1 Initiates DNA Break Repair
Molecular Cell, Volume 67 Supplemental Information Single-Molecule Imaging Reveals How Mre11-Rad50-Nbs1 Initiates DNA Break Repair Logan R. Myler, Ignacio F. Gallardo, Michael M. Soniat, Rajashree A. Deshpande,
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Origin use and efficiency are similar among WT, rrm3, pif1-m2, and pif1-m2; rrm3 strains. A. Analysis of fork progression around confirmed and likely origins (from cerevisiae.oridb.org).
More informationSupplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible.
Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible. Because SYBR Gold is less sensitive to single stranded
More informationSupplementary Figure 1.
Supplementary Figure 1. Assessment of quaternary structure of soluble RSV F proteins. Soluble variants of F proteins from A2 and B1 RSV strains were expressed in HEK293 cells. The cell culture supernatants
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL 1 Table 1. Comparison of experimental and theoretical nucleosomal arrangements on selected sequences* Sequence High-affinity 601 synthetic sequence experimental method site-directed
More informationGene Expression - Transcription
DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making
More informationSupplementary Information. Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly
Supplementary Information Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly Joshua M. Karchin, Jeung-Hoi Ha, Kevin E. Namitz, Michael S. Cosgrove, and
More informationChallenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor
Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+
More informationBiochemistry 111. Carl Parker x A Braun
Biochemistry 111 Carl Parker x6368 101A Braun csp@caltech.edu Central Dogma of Molecular Biology DNA-Dependent RNA Polymerase Requires a DNA Template Synthesizes RNA in a 5 to 3 direction Requires ribonucleoside
More informationNucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Detection of MCM-subunit SUMOylation under normal growth conditions. a. Sumoylated forms of MCM subunits show differential shifts when SUMO is attached to differently sized tags.
More information