SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 Nanowired three dimensional cardiac patches Tal Dvir, Brian P. Timko, Mark D. Brigham, Shreesh R. Naik, Sandeep S Karajanagi, Oren Levy, Hongwei Jin, Kevin K. Parker, Robert Langer and Daniel S. Kohane NATURE NANOTECHNOLOGY 1

2 Figure S1 Nanowire statistics. Histogram of the length distribution of a typical sample of NWs. Figure S2 Photographs of scaffolds. a, Pristine alginate scaffold. b, NW-containing alginate scaffold (Alg-NW). The scaffolds were 5 mm in diameter and 2 mm high. 2 NATURE NANOTECHNOLOGY

3 SUPPLEMENTARY INFORMATION Figure S3 Mechanical properties of the Alg-NW. a, The Alg-NW prior to lyophilization. b, At higher concentrations of NWs the biomaterial became more viscous. c, Increasing NW concentration increased the elastic shear modulus of the biomaterial. N= 3 for each testing. Figure S4 NWs (0.5 mg/ml) embedded within the scaffold pore wall. a, NWs (yellow arrows) parallel to the scaffold pore wall. b, Elemental analysis of the features within the pore wall indicates the presence of gold. NATURE NANOTECHNOLOGY 3

4 Figure S5 Effect of increased loading of gold nanowires on the conductivity of alginate film. a, Topography of NWs (2 mg/ml) embedded in alginate film. b, Conductivity through the same region of nanowire-containing film as measured by C- AFM. 4 NATURE NANOTECHNOLOGY

5 SUPPLEMENTARY INFORMATION Figure S6 Effect of gold nanrods on the conductivity of alginate film. a, Gold nanorods by TEM. The rods were nm in diameter with a length scale of 60 nm. b, Topography of gold nanorods embedded within an alginate film by conductive-probe AFM (C-AFM). The field of view is 5 x 5 µm. c, Conductivity through the same region of nanorod-containing film as measured by C-AFM. d, The current vs. bias voltage over the range of -1 to 1V was negligible when the C-AFM tip was positioned over either a rod (red trace) or alginate (blue trace). NATURE NANOTECHNOLOGY 5

6 Figure S7 Cytotoxicity assay. Cell viability within the scaffolds was assessed by a metabolic activity assay (XTT assay). Results are normalized to day 0 values. N= 6 for each group at each time point. Figure S8 Protein expression. Troponin I (red) and Connexin 43 (green) co-staining of 3D cardiac constructs on day 3 for a, cardiac cells within pristine alginate scaffolds and b, cells within the Alg-NW scaffold. Nuclei are stained blue. Bar = 100 µm. c, Representative picture of Connexin 43 and sarcomeric actinin expression on days 3 and 8. 6 NATURE NANOTECHNOLOGY

7 SUPPLEMENTARY INFORMATION Supplementary Methods Conductivity and topography measurements by AFM. Topography and conductivity measurements were performed using an Asylum Research AFM (model MFP-3D). We used Pt/Ir-coated probes (Veeco Probes, Camarillo, CA, SPM-PIC, 0.2 N/m spring constant, 13 khz resonant frequency). For topography and current maps, the sample was rastered in contact mode with a 200 mv tip bias. Topography and current were recorded simultaneously. For current vs. voltage curves, the tip was positioned either over a NW or alginate region. A triangular wave potential bias (4 cycles, 0.5 Hz, 1V amplitude) was applied to the tip, and the current was simultaneously recorded. Impedance measurements on thin films. Thin films were prepared by sandwiching alginate film (with or without NWs) between two ITOcoated slides (Sigma, Ω/sq) Subsequent AFM measurements revealed that the resulting films were ca. 500 nm thick. For impedance measurements, we applied an AC potential bias between the ITO electrodes and swept the frequency between 10 6 Hz and 1 Hz (0.1V amplitude, decade/sec sweep rate). The real and imaginary components of the impedance at each frequency were recorded. Below 10 3 Hz, the pristine alginate film was not sufficiently conductive to yield reliable measurements (data not shown). Cardiac patch construction, cultivation and analysis. The cardiac patch was prepared as previously described 4. Briefly, cardiac cells were isolated from the left ventricles of SD neonatal (0-1 day old) rat hearts and seeded onto either Alg-NW or alginate scaffolds (5 x 2 mm, d x h, 0.7x10 8 cells/cm 3 ). The cell-seeded constructs were cultured for 3 days in normal conditions (humidified incubator 5% CO 2, 37 0 C, no electrical field). At that NATURE NANOTECHNOLOGY 7

8 point, constructs (both with NWs and pure alginate) were subjected to electrical stimulation (rectangular, 2 ms, 5 V/cm, 1 Hz) as previously described 6. Briefly, the constructs were cultivated in a glass chamber fitted with two 1/4-inch-diameter carbon rods (Ladd Research Industries, Burlington, VT) placed 1 cm apart and connected to a cardiac stimulator (S88 Grass dual output square pulse stimulator, Astro-med Inc. RI) with platinum wires (Ladd Research Industries). At the end of cultivation period, the patches were analyzed for viability using the XTT assay as described previously 2 (n>4 for each data point, collected from 2 separate experiments), or stained. Mechanical Testing The viscoelastic properties of the hydrogels were measured using an AR-2000 rheometer (TA Instruments, Inc., New Castle, DE). The scaffolds in the wet state were tested at a rate of 10% strain/min on an Instron 5542 mechanical tester (Instron, Norwood, MA). The compressive modulus (Ec) was determined as the slope of the linear region corresponding with 0-5% strain. Histology and immunofluorescence For histology, the cellular constructs were dehydrated in graduated alcohol steps (70 100%), paraffin-embedded, cut into 5-mm-thick sections, and mounted on slides. The sections were stained with hematoxylin and eosin (H&E). For immunofluorescence, the cellular constructs were fixed and permeabilized in cold methanol, blocked for 1 h at room temperature in Dulbecco s modified Eagle s medium (DMEM)-based buffer containing 5% FBS. After three buffer washes, the samples were incubated for 1 h with anti-troponin I (AbCam, Cambridge MA) or connexin 43 (Invitrogen, Carlsbad, CA) antibodies. After incubation, the samples were washed and incubated for 1 h with secondary antibodies. For nuclear detection, the cells were 8 NATURE NANOTECHNOLOGY

9 SUPPLEMENTARY INFORMATION incubated for 3 min with Hoechst and washed. Imaging was performed with a DeltaVision RT deconvolution microscope using the 20 or 40 objective (Applied Precision Inc. Northwest Issaquah, WA). Western blotting Total extracted protein (50 mg) was size-fractionated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, NH). The membranes were incubated with antibodies against Cx-43 (Invitrogen, Carlsbad, CA), sarcomeric actinin (Sigma) and normalized against GAPDH (Santa Cruz Biotechnology, Santa Cruz, CA). At least four cell constructs were tested with each antibody. Densitometric analysis was carried out using ImageJ analysis software (NIH). NATURE NANOTECHNOLOGY 9

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Nanomechanical mapping of first binding steps of a virus to animal cells David Alsteens, Richard Newton, Rajib Schubert, David Martinez-Martin, Martin Delguste, Botond Roska and Daniel J. Müller This PDF

More information

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Immunofluorescence Confocal Microscopy of 3D Cultures Grown on Alvetex

Immunofluorescence Confocal Microscopy of 3D Cultures Grown on Alvetex Immunofluorescence Confocal Microscopy of 3D Cultures Grown on Alvetex 1.0. Introduction Immunofluorescence uses the recognition of cellular targets by fluorescent dyes or antigen-specific antibodies coupled

More information

Supporting Information. Physiological ph-dependent gelation for 3D printing based on the. phase separation of gelatin and oxidized dextran

Supporting Information. Physiological ph-dependent gelation for 3D printing based on the. phase separation of gelatin and oxidized dextran Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting Information Physiological ph-dependent gelation for 3D printing based on the phase separation

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Thirupathi Kumara Raja. S, 1 Thiruselvi. T, 1 Asit Baran Mandal, 1 Gnanamani. A, 1* Adyar, Chennai Tamil Nadu, India

Thirupathi Kumara Raja. S, 1 Thiruselvi. T, 1 Asit Baran Mandal, 1 Gnanamani. A, 1* Adyar, Chennai Tamil Nadu, India Supplementary File ph and redox sensitive albumin hydrogel : A self-derived biomaterial Thirupathi Kumara Raja. S, 1 Thiruselvi. T, 1 Asit Baran Mandal, 1 Gnanamani. A, 1* 1 CSIR-CLRI Adyar, Chennai Tamil

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

Topographical modulation of macrophage phenotype by shrink-film multi-scale. Department of Biomedical Engineering, University of California, Irvine

Topographical modulation of macrophage phenotype by shrink-film multi-scale. Department of Biomedical Engineering, University of California, Irvine Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2016 Supplementary Information for Topographical modulation of macrophage phenotype by shrink-film

More information

WESTERN BLOT. BCH462- Practical

WESTERN BLOT. BCH462- Practical WESTERN BLOT BCH462- Practical What is Antigen [Ag]? What is Antibody [Ab]? Immunoassay: is a test that uses the highly specific and selective antigen-antibody reactions forming antibody and antigen complexes

More information

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich). Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small

More information

In Vitro Study of Receptor-Mediated Silica Nanoparticles Delivery across Blood-Brain Barrier

In Vitro Study of Receptor-Mediated Silica Nanoparticles Delivery across Blood-Brain Barrier Supporting Information In Vitro Study of Receptor-Mediated Silica Nanoparticles Delivery across Blood-Brain Barrier Yang Song, Dan Du, Lei Li, Jun Xu, Prashanta Dutta *,, and Yuehe Lin *, School of Mechanical

More information

Supporting Information

Supporting Information Supporting Information Gemcitabine and Antisense-microRNA Co-encapsulated PLGA-PEG Polymer Nanoparticles for Hepatocellular Carcinoma Therapy Rammohan Devulapally, Kira Foygel, Thillai V Sekar, Juergen

More information

Methodology for Immunohistochemistry. Learning Objectives:

Methodology for Immunohistochemistry. Learning Objectives: Proteomics Methodology for Immunohistochemistry Methodology for Immunohistochemistry A staining process for identifying the proteins location in cells, tissues by using antigen-antibody property. Immuno

More information

Enzyme-mediated preparation of hydrogels composed of poly(ethylene glycol) and gelatin as cell culture platforms

Enzyme-mediated preparation of hydrogels composed of poly(ethylene glycol) and gelatin as cell culture platforms Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supplementary Material (ESI) for RSC Advances Enzyme-mediated preparation of hydrogels composed

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Accuracy of microsphere tracking in x, y and z.

Nature Methods: doi: /nmeth Supplementary Figure 1. Accuracy of microsphere tracking in x, y and z. Supplementary Figure 1 Accuracy of microsphere tracking in x, y and z. Accuracy of tracking at 50 Hz in x, y, and z of a 4.5 µm diameter polystyrene microsphere (a) and a 1.5 µm diameter silica microsphere

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC HIGH SCHOOL STUDENT SCIENCE WEEK St. Paul s Hospital Vancouver, BC Sponsors 2 AGENDA Location: UBC James Hogg Research Centre (JHRC), St. Paul s Hospital, Room 166 Burrard Building, 1081 Burrard Street,

More information

CHAPTER 9 AFM PROFILING AND NANOLITHOGRAPHY WITH NEEDLE-TIPPED CANTILEVERS

CHAPTER 9 AFM PROFILING AND NANOLITHOGRAPHY WITH NEEDLE-TIPPED CANTILEVERS CHAPTER 9 AFM PROFILING AND NANOLITHOGRAPHY WITH NEEDLE-TIPPED CANTILEVERS Since Ag 2 Ga nanoneedles can be directly grown on (or even in place of) the tips on AFM cantilevers using the pulling technique

More information

Electric Supplement Information

Electric Supplement Information Electric Supplement Information Preparation of DNA-AuNPs Thiol-modified oligonucleotide (5 -Cy5- ATCTCGGCTCTGCTAGCGAAAAAAAAAA-(C3H6)-SH-3, 5 15.5 OD) was added to 13 nm citrate-stabilized AuNPs (~3 nmol

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Synthesis of gold nanorods: The synthesis and surface functionalization of gold nanorods were

Synthesis of gold nanorods: The synthesis and surface functionalization of gold nanorods were SUPPLEMENTARY INFORMATION: Experiments Synthesis of gold nanorods: The synthesis and surface functionalization of gold nanorods were carried out as described in the literature 36. For the synthesis of

More information

RAFT Polymerization of an Intrinsically Stretchable Water-Soluble Block Copolymer Scaffold for PEDOT

RAFT Polymerization of an Intrinsically Stretchable Water-Soluble Block Copolymer Scaffold for PEDOT Supporting Information for RAFT Polymerization of an Intrinsically Stretchable Water-Soluble Block Copolymer Scaffold for PEDOT Laure V. Kayser, Madeleine D. Russell, Daniel Rodriquez, Sami N. Abuhamdieh,

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

Immunofluorescence Staining Protocol for 3 Well Chamber, removable

Immunofluorescence Staining Protocol for 3 Well Chamber, removable Immunofluorescence Staining Protocol for 3 Well Chamber, removable This Application Note presents a simple protocol for the cultivation, fixation, and staining of cells using the 3 Well Chamber, removable.

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Polymer Chemistry. This journal is The Royal Society of Chemistry 2017 Supporting Information Injectable Shear-Thinning Hydrogel with Enhanced Strength and Temperature

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Information A highly sensitive and selective diagnostic assay based on virus nanoparticles (Manuscript number:nnano-08090965a) Jin-Seung Park 1, Moon Kyu Cho 2,

More information

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive

More information

Immunofluorescence and phalloidin labeling of mammalian cells

Immunofluorescence and phalloidin labeling of mammalian cells Immunofluorescence and phalloidin labeling of mammalian cells 2 Contents Materials for immunofluorescence and phalloidin labeling of mammalian cells...1 Immunofluorescence-labelling on cultivated adherent

More information

Highly Durable Fuel Cell Electrode Based on Ionomer Dispersed in Glycerol

Highly Durable Fuel Cell Electrode Based on Ionomer Dispersed in Glycerol Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is The Royal Society of Chemistry 214 Electronic Supplementary Information Highly Durable Fuel Cell Electrode

More information

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,

More information

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC- SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

PROTOCOL. Collagen I Thin Gel Coating of Alvetex Scaffold. Introduction. Method. Page 1

PROTOCOL. Collagen I Thin Gel Coating of Alvetex Scaffold. Introduction. Method. Page 1 Page 1 Introduction Extra-cellular matrix (ECM) coating of in vitro culture surfaces is commonly used to enhance cellsubstrate adhesion, encourage cell-matrix signalling and to protect shear-sensitive

More information

15 June 2011 Supplementary material Bagriantsev et al.

15 June 2011 Supplementary material Bagriantsev et al. Supplementary Figure S1 Characterization of K 2P 2.1 (TREK-1) GOF mutants A, Distribution of the positions of mutated nucleotides, represented by a red x, from a pool of 18 unselected K 2P 2.1 (KCNK2)

More information

Antibody was principally purchased from Santa Cruz (EGFR sc-03), Cetuximab (Bristol

Antibody was principally purchased from Santa Cruz (EGFR sc-03), Cetuximab (Bristol Materials and Methods Reagents Antibody was principally purchased from Santa Cruz (EGFR sc-03), Cetuximab (Bristol Mayer Squib), IgG (Jacson Laboratory), Carboplatin (Bristol Mayer Squib), Para formaldehyde

More information

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.

More information

Electrophoresis and transfer

Electrophoresis and transfer Electrophoresis and transfer Electrophoresis Cation = positively charged ion, it moves toward the cathode (-) Anion = negatively charged ion, it moves toward the anode (+) Amphoteric substance = can have

More information

T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp.

T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp. Supplementary Materials and Methods Synthesis of spongian diterpenoids T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp. (sample # 47612) as follows. 45 g dry weight

More information

NanoTA2 Sub-100nm Local Thermal Imaging and Analysis

NanoTA2 Sub-100nm Local Thermal Imaging and Analysis Anasys Instruments introduces the second generation of its award winning nano thermal analysis product, the NanoTA2. This system extends the capabilities of the nano-ta system by the addition of local

More information

Exceptional Technology for Material Science TT DMA. Dynamic Mechanical Analyser

Exceptional Technology for Material Science TT DMA. Dynamic Mechanical Analyser Exceptional Technology for Material Science TT DMA Dynamic Mechanical Analyser The Company Triton Technology Ltd was first established in 1997 to design, manufacture and sell a range of instrumentation

More information

High throughput screening: Huh-7 cells were seeded into 96-well plate (2000

High throughput screening: Huh-7 cells were seeded into 96-well plate (2000 1 SUPPLEMENTARY INFORMATION METHODS 6 7 8 9 1 11 1 1 1 1 16 17 18 19 High throughput screening: Huh-7 cells were seeded into 96-well plate ( cells/well) and infected with MOI of DENV-. One hour post-infection

More information

Week 1: Protein isolation and quantification

Week 1: Protein isolation and quantification Week 1: Protein isolation and quantification Objective The objective of this lab exercise is to obtain protein samples from fruit fly larvae, BCS and FBS, all of which are then quantitated in the preparation

More information

Electronic Supplementary Material (ESI) for Chemical Communications This journal is The Royal Society of Chemistry 2013

Electronic Supplementary Material (ESI) for Chemical Communications This journal is The Royal Society of Chemistry 2013 Sodium-ion battery based on ion exchange membranes as electrolyte and separator Chengying Cao, Weiwei Liu, Lei Tan, Xiaozhen Liao and Lei Li* School of Chemical and Chemistry Engineering, Shanghai Jiaotong

More information

Western Blot Tool Box

Western Blot Tool Box Western Blot Tool Box BOX12/BOX12-03 V1.1 Store at 2-8 C For research use only Introduction The Western Blot Tool Box is designed to conveniently provide reagents/buffers needed for Western blotting, from

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents Supplementary Material (ESI) for Lab on a Chip RPMI medium, FBS, HEPES buffer solution, sodium pyruvate, penicillin, and streptomycin were obtained from Biological

More information

Improved Monitoring of P. aeruginosa on Agar Plates

Improved Monitoring of P. aeruginosa on Agar Plates Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2015 Improved Monitoring of P. aeruginosa on Agar Plates SUPPLEMENTAL INFORMATION T. A. Webster,

More information

A novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin.

A novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin. A novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin. Laura Arnoldo 1,#, Riccardo Sgarra 1,#, Eusebio Chiefari 2, Stefania Iiritano 2, Biagio Arcidiacono

More information

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to Supplemental Materials and Methods TGF bioassay. To quantify the levels of active and total TGF, we used mink lung epithelial cells (MLEC) that produce luciferase under the control of the PAI-1 promoter

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 SUPPORTING INFORMATION Chemical Sporulation and Germination: Cytoprotective Nanocoating of Individual

More information

Current ( pa) Current (pa) Voltage (mv) Voltage ( mv)

Current ( pa) Current (pa) Voltage (mv) Voltage ( mv) Current ( pa) 3000 2000 1000 0-1000 -2000-3000 a -400-200 0 200 400 Voltage (mv) P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 P15 P16 P17 P18 Average Current (pa) 4500 3000 1500 0-1500 -3000-4500 b -400-200

More information

Cdc42 Activation Assay Kit

Cdc42 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay

More information

Supporting Information

Supporting Information Supporting Information Novel Interwoven Polymer Composites via Dual- Electrospinning with Shape Memory/Self-healing Properties Jaimee M. Robertson, Hossein Birjandi Nejad, Patrick T. Mather* Syracuse Biomaterials

More information

Electronic Supplementary Informations

Electronic Supplementary Informations Introduction of disulfide bridges within silica nanoparticles to control their intra- cellular degradation S. Quignard, S. Masse, G. Laurent and T. Coradin Electronic Supplementary Informations ESI-1 :

More information

Scanning thermal microscopy probe capable of simultaneous electrical imaging and the addition of a diamond tip

Scanning thermal microscopy probe capable of simultaneous electrical imaging and the addition of a diamond tip Scanning thermal microscopy probe capable of simultaneous electrical imaging and the addition of a diamond tip E Brown, L Hao, D C Cox and J C Gallop National Physical Laboratory, Hampton Road, Teddington,

More information

ELECTRONIC SUPPLEMENTARY INFORMATION (ESI)

ELECTRONIC SUPPLEMENTARY INFORMATION (ESI) Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 ELECTRONIC SUPPLEMENTARY INFORMATION (ESI) Naringin ameliorates radiation-induced hepatic damage

More information

Erk activation drives intestinal tumorigenesis in Apc min/+ mice

Erk activation drives intestinal tumorigenesis in Apc min/+ mice correction notice Nat. Med. 16, 665 670 (2010) Erk activation drives intestinal tumorigenesis in Apc min/+ mice Sung Hee Lee, Li-Li Hu, Jose Gonzalez-Navajas, Geom Seog Seo, Carol Shen, Jonathan Brick,

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,

More information

Supplementary methods Shoc2 In Vitro Ubiquitination Assay

Supplementary methods Shoc2 In Vitro Ubiquitination Assay Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the

More information

ab BrdU Immunohistochemistry Kit

ab BrdU Immunohistochemistry Kit ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product

More information

Primary normal human keratinocytes were obtained from abdominal dermolipectomy of 3 different

Primary normal human keratinocytes were obtained from abdominal dermolipectomy of 3 different SUPPLEMENTARY MATERIALS AND METHODS Keratinocyte culture and transduction Primary normal human keratinocytes were obtained from abdominal dermolipectomy of 3 different healthy subjects who had given their

More information

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Biosynthesis of Luminescent Quantum Dots in an Earthworm S.R. Stürzenbaum, a# M. Hoeckner, a# A. Panneerselvam, b J. Levitt, b J.-S. Bouillard, b S. Taniguchi, b L.-A. Dailey, d R. Ahmad Khanbeigi, d E.

More information

Nonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2.

Nonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2. Supplementary Figure 1 Nonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2. Free DinB was washed out using

More information

Department of Mechanical Engineering, University of Washington, Seattle, WA, 98195

Department of Mechanical Engineering, University of Washington, Seattle, WA, 98195 Supplementary information Contact Angle Changes Induced by Immunocomplex Formation Jong-Hoon Kim, a Amy Q. Shen, a Kyong-Hoon Lee, b Gerard A. Cangelosi c and Jae-Hyun Chung* a a Department of Mechanical

More information

Rab5 Activation Assay Kit

Rab5 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product

More information

THE EFFECTS OF POLYETHYLENE PARTICLE PHAGOCYTOSIS ON THE VIABILITY OF MATURE HUMAN MACROPHAGES BY PETER ASPINALL, KYRA BURNETT, JOE MAHER, CAT TJAN

THE EFFECTS OF POLYETHYLENE PARTICLE PHAGOCYTOSIS ON THE VIABILITY OF MATURE HUMAN MACROPHAGES BY PETER ASPINALL, KYRA BURNETT, JOE MAHER, CAT TJAN THE EFFECTS OF POLYETHYLENE PARTICLE PHAGOCYTOSIS ON THE VIABILITY OF MATURE HUMAN MACROPHAGES BY PETER ASPINALL, KYRA BURNETT, JOE MAHER, CAT TJAN THE AUTHORS S. Xing Institute of Biomaterials and Biomedical

More information

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer

More information

Western Immunoblotting Standard Protocol:

Western Immunoblotting Standard Protocol: Gel Preparation: Clean plates, combs and casting frames and bottom strips with water and alcohol and allow to dry Place a short plate on top of the spacer plate Slide the two plates into the casting frame,

More information

Supporting Information. A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid. Detection Of Alzheimer's Disease

Supporting Information. A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid. Detection Of Alzheimer's Disease Supporting Information A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid Detection Of Alzheimer's Disease Xiao-Peng He, 1 Qiong Deng, 1 Liang Cai, 1 Chang-Zheng Wang, 1,2 Yi Zang,*,2

More information

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)

More information

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100 Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase,

More information

Microfluidic Devices that Capture Bacteria for Growth and Kill Analysis

Microfluidic Devices that Capture Bacteria for Growth and Kill Analysis Microfluidic Devices that Capture Bacteria for Growth and Kill Analysis Michael J. Lochhead, PhD. Accelr8 Technology Corporation Denver, CO AVS Symposium Biomaterial Interfaces Microbe-Surface Interactions

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK

More information

NanoFabrication Systems DPN. Nanofabrication Systems. A complete line of instruments and tools for micro and nanopatterning applications

NanoFabrication Systems DPN. Nanofabrication Systems. A complete line of instruments and tools for micro and nanopatterning applications DPN Nanofabrication Systems A complete line of instruments and tools for micro and nanopatterning applications DPN Nanofabrication Systems A complete line of instruments and tools for micro and nanopatterning

More information

Promotion of HDF Cell Attachment and Proliferation

Promotion of HDF Cell Attachment and Proliferation Promotion of HDF Cell Attachment and Proliferation Objectives To qualitatively assess the effect of fibronectin (Fn) on HDF cell attachment Fn Attachment Assay To observe HDF cell proliferation and position

More information

Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer

Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer Mingming Wang, Yiyun Cheng * Shanghai Key Laboratory of Regulatory Biology, School of Life Sciences, East China Normal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION A biomimetic DNA-based channel for the ligand-controlled transport of charged molecular cargo across a biological membrane Jonathan R. Burns, Astrid Seifert, Niels Fertig, Stefan Howorka NATURE NANOTECHNOLOGY

More information

Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice

Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice ntibodies used in this study The anti β-actin monoclonal antibody (Sigma-ldrich, St. Louis, MO) was generated against a slightly modified human β-actin N-terminal peptide, c-sp-sp-sp-ile-la-la-leu-val-ile-

More information

Remarkable Reinforcement Effect in Sulfonated. Aromatic Polymers as Fuel Cell Membrane

Remarkable Reinforcement Effect in Sulfonated. Aromatic Polymers as Fuel Cell Membrane Supporting Information Remarkable Reinforcement Effect in Sulfonated Aromatic Polymers as Fuel Cell Membrane Junpei Miyake, Masato Kusakabe, Akihiro Tsutsumida, and Kenji Miyatake*,, Clean Energy Research

More information

MEFs were treated with the indicated concentrations of LLOMe for three hours, washed

MEFs were treated with the indicated concentrations of LLOMe for three hours, washed Supplementary Materials and Methods Cell Fractionation MEFs were treated with the indicated concentrations of LLOMe for three hours, washed with ice-cold PBS, collected by centrifugation, and then homogenized

More information

BrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells

BrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells K-ASSAY BrdU IHC Kit For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells Cat. No. KT-077 For Research Use Only. Not for Use in

More information

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

More information

Screen Printing of Highly Loaded Silver Inks on. Plastic Substrates Using Silicon Stencils

Screen Printing of Highly Loaded Silver Inks on. Plastic Substrates Using Silicon Stencils Supporting Information Screen Printing of Highly Loaded Silver Inks on Plastic Substrates Using Silicon Stencils Woo Jin Hyun, Sooman Lim, Bok Yeop Ahn, Jennifer A. Lewis, C. Daniel Frisbie*, and Lorraine

More information

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM Introduction: IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM IP/Western Blot Reagents and Procedures (patent pending) provide an improved method for the detection of immunoprecipitated

More information

Supporting Information for. Exploring a wider range of Mg-Ca-Zn metallic glass as biocompatible alloys using combinatorial sputtering

Supporting Information for. Exploring a wider range of Mg-Ca-Zn metallic glass as biocompatible alloys using combinatorial sputtering Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting Information for Exploring a wider range of Mg-Ca-Zn metallic glass as biocompatible

More information

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham

More information

RheB Activation Assay Kit

RheB Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table

More information

SUPPLEMENTAL INFROMATION

SUPPLEMENTAL INFROMATION SUPPLEMENTAL INFROMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES IP 1 accumulation - IP 1 accumulation was quantified using the HTRF IP-One kit (Cisbio Bioassys, Bedford, MA, USA) according to the manufacturer

More information

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended

More information

Supplementary information

Supplementary information Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary

More information

SUPPORTING INFORMATION: Collateral Advantages of a Gel Electrolyte for. Higher Voltage; Reduced Volume

SUPPORTING INFORMATION: Collateral Advantages of a Gel Electrolyte for. Higher Voltage; Reduced Volume SUPPORTING INFORMATION: Collateral Advantages of a Gel Electrolyte for MnO 2 Nanowire Capacitors: Higher Voltage; Reduced Volume Mya Le Thai, Shaopeng Qiao, Rajen K. Dutta, Gaurav Jha, Alana Ogata, Girija

More information

Cell Surface-Anchored Fluorescent Aptamer Sensor Enables. Imaging of Chemical Transmitter Dynamics

Cell Surface-Anchored Fluorescent Aptamer Sensor Enables. Imaging of Chemical Transmitter Dynamics Supporting Information for Cell Surface-Anchored Fluorescent Aptamer Sensor Enables Imaging of Chemical Transmitter Dynamics Takeshi Tokunaga, Shigeyuki Namiki, Katsuhiro Yamada, Takahiro Imaishi, Hiroshi

More information

ab BrdU Immunohistochemistry Kit

ab BrdU Immunohistochemistry Kit ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product

More information

Supplementary Information

Supplementary Information Supplementary Information Biomimetic nanoflowers by self-assembly of nanozymes to induce intracellular oxidative damage against hypoxic tumors Wang et al. Supplementary Figure 1. The effect of Pt/Co ratio

More information

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al., Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained

More information

Scaffolds Covalently Immobilized with VEGF and Angiopoietin-1 to Promote Angiogenesis In Engineered Cardiac Tissues

Scaffolds Covalently Immobilized with VEGF and Angiopoietin-1 to Promote Angiogenesis In Engineered Cardiac Tissues Scaffolds Covalently Immobilized with VEGF and Angiopoietin-1 to Promote Angiogenesis In Engineered Cardiac Tissues Loraine L.Y. Chiu 1 and Milica Radisic 1,2,3 1 Department of Chemical Engineering and

More information

CONTENTS. Introduction. NSOM Optical Fiber Probes

CONTENTS. Introduction. NSOM Optical Fiber Probes CONTENTS Introduction NSOM Optical Fiber Probes AFM Probes AFM Probes Hard to achieve Force Constants and Resonance Frequencies Deep Trench AFM Probes Electrical and STM Probes Hollow AFM Nanopipette Probes

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

Purification of Lactate Dehydrogenase

Purification of Lactate Dehydrogenase Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase

More information