Supplemental Figures. B cell tolerance via GARP-TGF-β axis
|
|
- Ashlynn West
- 5 years ago
- Views:
Transcription
1 cell tolerance via GRP-TGF-β axis Supplemental Figures.. Spleen... Spleen mln Total FoxP + FoxP + Helios + FoxP + Helios - Total FoxP + FoxP + Helios + FoxP + Helios - Peyer s Small Intestine mln cell Small intestine cell Supplemental Figure : hanges in other immune compartments and increased mucosal cell proliferation in cell Lrrc deficient M chimera mice. Immune compartments were analyzed in M chimera mice months post M reconstitution. () Live Gr + b + granulocytic cells were detected in the spleen by flow, n= biological replicates. () Total FoxP + Tregs and Helios +/- Tregs were detected in the spleen (n=), mesenteric lymph nodes (mln; n=), Peyer s patch (n=), and small intestine lamina propria (n=-) by flow cytometry. () Immune cells were isolated from the mln and small intestine, and stained for 9 to detect cells and intracellularly for Ki7, followed by flow cytometry analysis (n=- and mice). () ctive and total TGF-β levels were measured by ELIS in and GRP M chimera mice months post M reconstitution. Statistics performed by two-tailed t-test; p<., error bars represent S..
2 cell tolerance via GRP-TGFβ axis Lupus-free. Lupus int Transitional I - -. Follicular + int.7 Marginal Zone GRP Lupus free NZM Lupus NZM Follicular Trans I Marginal Zone GRP Supplemental Figure : cell GRP in murine lupus models. () Representative flow plots of GRP and LP expression gated on live total splenic 9 + cells from NZM mice with (Lupus) and without (Lupus-free) active lupus and the quantification of the data (right), n=, representative of two independent experiments. Statistical analysis performed by two-tailed t-test, p<., error bars represent S.. () Flow plots depicting GRP and LP surface expression on live splenic 9 + follicular cells ( + int ), marginal zone cells ( - + ), and transitional I cells ( - - ) from lupus NZM mice and the quantification of the data (right), n=, representative of two independent experiments. Statistical analysis performed by one-way NOV with Tukey s test for multiple comparisons, p<., p<., error bars represent S..
3 cell tolerance via GRP-TGFβ axis week old mice TM inj i.p. Pristane inj. i.p. 7 N analysis Monitor mice h cre- Lrrc f/f cell gated. Weeks h cre- Lrrc f/f h cre+ Lrrc f/f. h cre+ Lrrc f/f GRP h cre- Lrrc f/f cre+ h Lrrc f/f Supplemental Figure : h-er cre Lrrc f/f cell specific GRP deficient mice have an increase in early onset PIL. Female and h-er cre Lrrc f/f cell GRP mice were injected with Tamoxifen for 7 days to delete GRP, (n=) and GRP (n=) mice. () Scheme of GRP deletion with Tamoxifen and subsequent pristane injection to induce autoimmunity. () Mice were bled days after Tamoxifen injection and peripheral blood was cultured with LPS for hours to induce GRP. ells were stained with 9, GRP, and LP and analyzed by flow cytometry to confirm GRP deletion in mice. ( and ) Two weeks after pristane injection, sera were collected and N was measured. Representative images shown in. ata are representative of two independent experiments. Statistical analysis performed by unpaired two-tailed t-test; p<., error bars represent S..
4 cell tolerance via GRP-TGFβ axis month months... p=.. F E Peyer s patch. G.... mln. Supplemental Figure : GRP overexpression dampens pristane-induced autoimmunity in mice. rtt GRP mice were fed doxycycline in the drinking water one week prior to a single intraperitoneal pristane injection. oxycycline treatment was continued throughout the course of the experiment for both GRP (n=7) and GRP (n=) mice. () IgG N levels were measured in the serum of pristane treated mice at month and months post pristane injection. () Five μm thick kidney sections were stained with anti-igg-fit to detect immunoglobulin deposition in the glomeruli. ata shown are the quantification; n=7 and n= (one mice died prior to analysis). () Immune cells were isolated from the spleen and percentages of cells (9 + ), germinal center cells (GL ), and Ki7 + cells from and mice were quantified. () MSs (Gr + b + ) in pristane treated and mice were quantified. (E) Peyer s patch and mesenteric lymph node (mln) immune cells were isolated and percentages of T cells and T cells were quantified. (F) ctive and total TGF-β levels were measured in the sera of and GRP mice pre- and post-pil by ELIS. (G) Soluble GRP (sgrp) was measured in the sera of and GRP mice pre- and post-pil by ELIS. n= and n= Pre-PIL; n=7 and n= post-pil. Statistical analysis performed by unpaired two-tailed t- test; p<., p<., p<., error bars represent S..
5 cell tolerance via GRP-TGFβ axis GRP TGF-βRII p Supplemental Figure : GRP overexpression reduces Peyer s patch cell cellularity and proliferation. rtt GRP and control mice were both fed doxycycline in the drinking water for months, n= and n=-. () Total number of Peyer s patches on the small intestine were counted. () Peyer s patches were isolated and percentage of 9 + cells was analyzed by flow cytometry. () Peyer s patch cells were stained intracellularly for Ki7 to assess homeostatic proliferation and analyzed by flow cytometry. Each dot is representative of a separate biological replicate; data is representative of independent experiments. (-) Statistical analysis performed by two-tailed t-test; p<., error bar represents S.. () 9 + cells were isolated from the spleen and Peyer s patches of oxycycline treated and GRP mice, followed by RN isolation and cn synthesis. qrt PR was utilized to detect differences in GRP, TGF-βRII and p transcript level, normalized to β actin. Representative data from independent experiments with biological replicates. Statistical analysis performed by one-way NOV with Tukey s test for multiple comparisons, p<., p<., p<., error bars represent S..
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10772 Supplementary Figures: Supplementary Figure 1. Location of CNS1 within of the Foxp3 locus highlighting CNS1 and indicating transcription factor binding motifs downstream of TCR,
More informationSupplementary figures
Mucida et al. Supplementary material Supplementary figures Supplementary Figure 1. Oral administration of OVA suppresses Th2 differentiation, Germinal Center (GC) formation and immunoglobulin class switching
More informationSupplementary Figure and Table Legends
1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11809 Supplementary Figure 1. Antibiotic treatment reduces intestinal bacterial load and allows access of non-pathogenic bacteria to the MLN, inducing intestinal
More informationSupplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
More informationSupplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from
More informationDC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN
CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched
More informationSupporting Information
Supporting Information Tomura et al. 1.173/pnas.8227815 WT CFSE Con A stimulation Before After 2 3 1 CFSE Kaede- Tg No photoconversion Photoconversion Kaede Red Fig. S1. Dilution of photoconverted Kaede
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3206 Supplementary Figure 1 Autophagy-related gene expression in murine and human intestinal tumors. (a) Representative LC3 immunostaining in colonic adenoma and adjacent non tumoral tissue
More informationSupplemental Information. T Follicular Helper Cell-Germinal Center B Cell. Interaction Strength Regulates Entry into Plasma
Immunity, Volume 48 Supplemental Information T Follicular Helper ell-germinal enter B ell Interaction Strength Regulates Entry into Plasma ell or Recycling Germinal enter ell Fate Wataru Ise, Kentaro Fujii,
More informationSUPPLEMENTARY FIGURE 1
SUPPLEMENTRY FIGURE 1 C D E F G * Supplementary Fig. 1: Platelets from Pik3c2b mice exhibit normal function. () Expression of platelet-specific glycoproteins on the surface of platelets in whole blood
More informationSupplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or
More informationNature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.
Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to
More informationMLN8237 induces proliferation arrest, expression of differentiation markers and
Supplementary Figure Legends Supplementary Figure 1 827 induces proliferation arrest, expression of differentiation markers and polyploidization of a human erythroleukemia cell line with the activating
More informationSupplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating
Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low
More informationSupplemental Information. Myeloid-Derived Suppressor Cells Are. Controlled by Regulatory T Cells via TGF-b. during Murine Colitis
Cell Reports, Volume 17 Supplemental Information Myeloid-Derived Suppressor Cells Are Controlled by Regulatory T Cells via TGF-b during Murine Colitis Cho-Rong Lee, Yewon Kwak, Taewoo Yang, Jung Hyun Han,
More informationisolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
More informationNature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
More informationSupplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut
Immunity, Volume 33 Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut Keiichiro Suzuki, Mikako Maruya, Shimpei
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1 (a) (b) Supplementary Figure 1. Histological difference between fat-associated lymphoid clusters (FALC) and lymph nodes. (a) H&E stained specimens of a mesenteric lymphoid cluster
More informationSupplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.
Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1
More informationFigure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO (epoecfc) or LacZ (laczecfc) under control of a cytomegalovirus
More informationSupplementary Figure 1. Reconstitution of human-acquired lymphoid system in
Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationNature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
More informationSupplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41
Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 were assessed on purified platelets from Casp8 fl/fl and
More informationMa, et al. Supplemental Data
Ma, et al Supplemental Data Title: Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension and its inhibition attenuates pathologic features of disease Authors: Wanli
More informationSupplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +
Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase
More informationThomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den
Cell, Volume 129 Supplemental Data Extending the Host Range of Listeria monocytogenes by Rational Protein Design Thomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den Heuvel,
More informationSupplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined
More information(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets.
Supplemental Figure S1. Characteristics of Lnk -/- platelets. (A) Electron micrographs of resting platelets showing the normal intracellular structure of Lnk -/ platelets. Samples were fixed with 4% PFA
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationSupplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size
Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size comparison of the P6 control and PKO mice. (b) H&E staining of hind-limb muscles from control and PKO mice at P6.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor
More informationSupplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
More informationNature Medicine: doi: /nm.4169
Supplementary Fig.1. EC-specific deletion of Ccm3 by Cdh5-CreERT2. a. mt/mg reporter mice were bred with Cdh5CreERT2 deleter mice followed by tamoxifen feeding from P1 to P3. mg expression was specifically
More informationStrategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
More informationSupplementary Information
1 2 Supplementary Information 3 4 5 6 7 8 Supplementary Figure 1. Loading of R837 into PLGA nanoparticles. The loading efficiency (a) and loading capacity (b) of R837 by PLGA nanoparticles obtained at
More informationTo determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated
Supplementary Methods Tolerogenic effect of MDSC To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated MDSC in vivo, we used a model described previously
More informationReceptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16
Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding
More informationThe cell-cycle regulator c-myc is essential for the formation and maintenance of germinal centers
SUPPLEMENTARY INFORMATION The cell-cycle regulator c-myc is essential for the formation and maintenance of germinal centers Dinis Pedro Calado 1,2, Yoshiteru Sasaki 3, Susana A Godinho 4, Alex Pellerin
More informationSupplementary Figures
Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained
More informationRevised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
More informationTRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
More informationMultiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,
Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude
More informationSupplementary Fig. 1 (Li et al.)
Supplementary Fig. 1 (Li et al.) Fcrg / Supplementary Figure 1 Microcomputed tomography (mct) images of the distal femurs isolated from the indicated bone marrow chimeric mice. indicates the Dap12 -/-
More informationby Alexander Y. Rudensky (Sloan-Kettering Institute, New York). LSL-TβRI CA (TGFβR-
Materials and Methods Mice. Tgfbr2 fl/fl CD4-Cre (TGFβR-KO) mice were previously reported (3). Cre negative littermates were used as wild-type controls. DN-TGFβRII (TGFβR-DN) mice were provided by Ronald
More informationClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites.
Identity Human Mouse Supplemental Figure 1. Amino acid sequence alignment of -MyHC. The alignment was created using the ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity
More informationThe following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700
Flow cytometry analysis and cell sorting The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700 anti-cd5. (), APC-Cy7 anti-epcam (G.; Biolegend, San Diego, CA), PE-Cy7 anti-cd31
More informationSupplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,
More informationSOM 1 *** *** *** * * n.s GFP + (NK 10 4 ) Naive DNFB OXA. Donor sensitization: Naive OXA DNFB 1,200 6,000 4,000
SOM 1 a n.s. 4. 3. GFP + (NK 1 4 ) 2. 1.. Naive DNFB OXA splenic NK hepatic NK b Donor sensitization: Naive OXA DNFB NK cells (% of CD45 + 1 5 ) 1,2 9 6 3 NK cells (% of CD45 + 1 5 ) 6, 4, 2, 24 48 72
More informationTable S1. Oligonucleotide primer sequences
Table S1. Oligonucleotide primer sequences Primer Name DNA Sequence (5 -> 3 ) Description CD19c CD19d Cre7 Sfpi1lox1 Sfpi1lox2 Sfpi1lox3 5 -AACCAGTCAACACCCTTCC-3 5 -CCAGACTAGATACAGACCAG-3 5 -TCAGCTACACCAGAGACGG-3
More informationSupplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin
Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2
More informationA group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response
A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily
More informationSupplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot
Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot (vector: ~25 kda). (b) Silver staining was used to assess
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Ricke et al., http://www.jcb.org/cgi/content/full/jcb.201205115/dc1 Figure S1. Kinetochore localization of mitotic regulators in wild-type
More informationQuantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin
Supporting Information for Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin Hye-Yeong Kim 1,2+, Ran Li 1+, Thomas S.C. Ng 1, Gabriel Courties
More informationSupplementary Figure 1 Activated B cells are subdivided into three groups
Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation
More informationSupplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
More informationSupporting Information
(xe number cells) LSK (% gated) Supporting Information Youm et al../pnas. SI Materials and Methods Quantification of sjtrecs. CD + T subsets were isolated from splenocytes using mouse CD + T cells positive
More informationAccelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05574 SUPPLEMENTARY INFORMATION Supplementary Results Additional Materials and Methods Analysis of epidermal wholemounts and sections: Tail epidermis. The patterned organisation of tail
More informationbronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
More informationSupplementary information
Supplementary information Cooperation of Oncolytic Herpes Virotherapy and PD-1 Blockade in Murine Rhabdomyosarcoma Models Chun-Yu Chen 1, Pin-Yi Wang 1, Brian Hutzen 1, Les Sprague 3, Hayley M. Swain 1,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3164 Supplementary Figure 1 Validation of effective Gnas deletion and epithelial thickness. a, Representative genotyping in mice treated or not with tamoxifen to show Gnas deletion. To
More informationBIMM18 Dec 20 th - Flow cytometry in clinical diagnostics
BIMM18 Dec 20 th - Flow cytometry in clinical diagnostics I. B cell leukemia and lymphomas Immunophenotyping as part of the diagnostic work- up of hematologic malignancies offers a rapid and effective
More informationA collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP
Supplemental Materials & Methods Patients and patient samples. A collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP requiring splenectomy and 36 splenic specimens obtained
More informationInterferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information
Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto
More informationSupplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP
More informationAdditional analysissu
SSC-A FSC-A 65.6% FSC-H FSC-A 86.1% SSC-A 93.3% Viaprobe Additional analysissu Supplementary Figure S1. Gating strategy for flow cytometry Doublet cells were discriminated by FSC-A/SSC-A and FSC-A/FSC-H
More informationSupplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
More information* * IgL locus (V - J ) λ λ
Supplementary Figures and Figure Legend Supplementary Figure S1 A C F Vav-P-BCL2 doner mice 8 6 4 2 Lymphoma free (%)1 Tumor Pathology Score Retroviral transduction Vav-P-BCL2 HPCs HPC + shrna VavP-Bcl2
More informationStress-associated erythropoiesis initiation is regulated by type 1 conventional dendritic cells
Stress-associated erythropoiesis initiation is regulated by type 1 conventional dendritic cells Taeg S. Kim,, Paul C. Trampont, Thomas J. Braciale J Clin Invest. 2015;125(10):3965-3980. doi:10.1172/jci81919.
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationSupplementary Fig. 5
Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency
More informationAntibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing
Antibody used for FC The following antibodies were used following manufacturer s instructions: anti-human CD4 (clone HI3, IgG1, k - Becton Dickinson), anti-human CD33 (clone WM3, IgG1, k- Becton Dickinson),
More informationSupporting Information
Supporting Information Song et al. 10.1073/pnas.1218131110 SI Materials and Methods In Vivo Dislodgment Assays. In vivo dislodgement experiments were performed as previously described (1) using function
More informationSupplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused
More informationTRAIL, Death Receptors, TRA-8, and Apoptosis
TRAIL, Death Receptors, TRA-8, and Apoptosis DR5 is a pro-apoptotic molecule, which can induce cell death in a variety of cells by engaging the it ligand, TRAIL or anti-dr5 antibody. TRA-8 is a monoclonal
More informationSupplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation
Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María
More informationThe non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells
Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,
More informationIL-4 Promotes the Migration of Circulating B Cells to the Spleen and Increases Splenic B Cell Survival
This information is current as of November 22, 2018. References Subscription Permissions Email Alerts IL-4 Promotes the Migration of Circulating B Cells to the Spleen and Increases Splenic B Cell Survival
More informationSupplementary Figure 1, Wiel et al
Supplementary Figure 1, Wiel et al Supplementary Figure 1 ITPR2 increases in benign tumors and decreases in aggressive ones (a-b) According to the Oncomine database, expression of ITPR2 increases in renal
More informationSupplementary Figure 1. Lack of autoimmunity in NKT cell deficient B6.NZBc4L
Supplementary Figure. Lack of autoimmunity in NKT cell deficient L mice. A,.CDd-deficient mice lack CDd-independent NKT cells. B, In the absence of NKT cells,.cdd -/- mice fail to generate high titres
More informationshow PB hemoglobin concentration (Hgb) and platelet counts (Plt) in Kras ex3op/ex3op mice
Supplemental Data Supplemental Figure Legends Supplemental Figure 1. Hematologic profile of Kras / mice. (A) Scatter plots show PB hemoglobin concentration (Hgb) and platelet counts (Plt) in Kras / mice
More informationSI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers
SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei
More informationDistribution of human ILCs during chronic lung disease.
Supplementary Figure 1 Distribution of human ILCs during chronic lung disease. Quantification of flow cytometric analysis of lung tissue from patients with COPD or IPF identifying (a) frequencies of total
More informationTumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1
doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 Tumour Tumour 9 t(6;16) Tumour 5 Tumour 6 Tumour 7 www.nature.com/nature 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary
More information88.7 <GFP-A>: EGFP GFP. Null. % of Cells! <APC-A> B220!
B. C. 1 Cell Number (X18) A. % of Cells % of Max 8 Con 6 4 88.7 1 13 14 : EGFP 4 6 4 1 WT 8 % of% ofcells Max 6 6 4 G. 1 13 B Hdac3-/- 14 15 1 13 14 15 Ter119 Ly6C Wild type WT 4
More informationAuthor's response to reviews
Author's response to reviews Title: Lipopolysaccharide treatment suppresses spontaneously developing ankylosing enthesopathy in B10.BR male mice: the potential role of interleukin-10 Authors: Jana Capkova
More informationAutocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression
Supplemental Information Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated Antitumor Immunity to Promote Tumor Progression Yu Wang, Sheng-Nan Sun, Qing Liu, Yang-Yang Yu, Jian Guo, Kun Wang,
More informationEight-week-old wildtype mice were kept under standard diet (SD) for 4 weeks, or fed Western
Supplemental information M. Itoh et al. 0 Supplemental Methods Inducible NASH model using wildtype mice Eight-week-old wildtype mice were kept under standard diet (SD) for weeks, or fed Western diet (WD)
More informationSupplementary Figure 1
Supplementary Figure 1 Rarefaction Analysis and Sampling. a, Rarefaction plots show the expected levels of coverage for different subsamples of sequencing libraries for repertoires of clone size of at
More informationA Thesis. Submitted to the School of Graduate Studies. in Partial Fulfilment of the Requirements. for the Degree of. Doctor of Philosophy
CHRONIC GIARDIASIS IN CBA/N MICE: USE OF GENETICALLY IHKUNODEFICIENT HICE TO STUDY MECHANISMS OF IHHUNITY TO AN INTESTINAL PARASITE BY DANNA LYNN SKEA, B.Sc., H.Sc. A Thesis Submitted to the School of
More informationSupplementary Information
Supplementary Information Mutual reinforcement of inflammation and carcinogenesis by the Helicobacter pylori CagA oncoprotein Nobumi Suzuki, Naoko Murata-Kamiya, Kohei Yanagiya, Wataru Suda, Masahira Hattori,
More informationSmooth muscle FGF/TGFβ cross-talk regulates atherosclerosis progression. P-Y. Chen et al., Appendix. Table of contents:
Smooth muscle FGF/TGFβ cross-talk regulates atherosclerosis progression P-Y. Chen et al., Appendix Table of contents: Appendix Figure S1 and figure legend Appendix Figure S2 and figure legend Appendix
More informationTable S1. Primers used in the study
Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping
More information