Supplemental Figures. B cell tolerance via GARP-TGF-β axis

Size: px
Start display at page:

Download "Supplemental Figures. B cell tolerance via GARP-TGF-β axis"

Transcription

1 cell tolerance via GRP-TGF-β axis Supplemental Figures.. Spleen... Spleen mln Total FoxP + FoxP + Helios + FoxP + Helios - Total FoxP + FoxP + Helios + FoxP + Helios - Peyer s Small Intestine mln cell Small intestine cell Supplemental Figure : hanges in other immune compartments and increased mucosal cell proliferation in cell Lrrc deficient M chimera mice. Immune compartments were analyzed in M chimera mice months post M reconstitution. () Live Gr + b + granulocytic cells were detected in the spleen by flow, n= biological replicates. () Total FoxP + Tregs and Helios +/- Tregs were detected in the spleen (n=), mesenteric lymph nodes (mln; n=), Peyer s patch (n=), and small intestine lamina propria (n=-) by flow cytometry. () Immune cells were isolated from the mln and small intestine, and stained for 9 to detect cells and intracellularly for Ki7, followed by flow cytometry analysis (n=- and mice). () ctive and total TGF-β levels were measured by ELIS in and GRP M chimera mice months post M reconstitution. Statistics performed by two-tailed t-test; p<., error bars represent S..

2 cell tolerance via GRP-TGFβ axis Lupus-free. Lupus int Transitional I - -. Follicular + int.7 Marginal Zone GRP Lupus free NZM Lupus NZM Follicular Trans I Marginal Zone GRP Supplemental Figure : cell GRP in murine lupus models. () Representative flow plots of GRP and LP expression gated on live total splenic 9 + cells from NZM mice with (Lupus) and without (Lupus-free) active lupus and the quantification of the data (right), n=, representative of two independent experiments. Statistical analysis performed by two-tailed t-test, p<., error bars represent S.. () Flow plots depicting GRP and LP surface expression on live splenic 9 + follicular cells ( + int ), marginal zone cells ( - + ), and transitional I cells ( - - ) from lupus NZM mice and the quantification of the data (right), n=, representative of two independent experiments. Statistical analysis performed by one-way NOV with Tukey s test for multiple comparisons, p<., p<., error bars represent S..

3 cell tolerance via GRP-TGFβ axis week old mice TM inj i.p. Pristane inj. i.p. 7 N analysis Monitor mice h cre- Lrrc f/f cell gated. Weeks h cre- Lrrc f/f h cre+ Lrrc f/f. h cre+ Lrrc f/f GRP h cre- Lrrc f/f cre+ h Lrrc f/f Supplemental Figure : h-er cre Lrrc f/f cell specific GRP deficient mice have an increase in early onset PIL. Female and h-er cre Lrrc f/f cell GRP mice were injected with Tamoxifen for 7 days to delete GRP, (n=) and GRP (n=) mice. () Scheme of GRP deletion with Tamoxifen and subsequent pristane injection to induce autoimmunity. () Mice were bled days after Tamoxifen injection and peripheral blood was cultured with LPS for hours to induce GRP. ells were stained with 9, GRP, and LP and analyzed by flow cytometry to confirm GRP deletion in mice. ( and ) Two weeks after pristane injection, sera were collected and N was measured. Representative images shown in. ata are representative of two independent experiments. Statistical analysis performed by unpaired two-tailed t-test; p<., error bars represent S..

4 cell tolerance via GRP-TGFβ axis month months... p=.. F E Peyer s patch. G.... mln. Supplemental Figure : GRP overexpression dampens pristane-induced autoimmunity in mice. rtt GRP mice were fed doxycycline in the drinking water one week prior to a single intraperitoneal pristane injection. oxycycline treatment was continued throughout the course of the experiment for both GRP (n=7) and GRP (n=) mice. () IgG N levels were measured in the serum of pristane treated mice at month and months post pristane injection. () Five μm thick kidney sections were stained with anti-igg-fit to detect immunoglobulin deposition in the glomeruli. ata shown are the quantification; n=7 and n= (one mice died prior to analysis). () Immune cells were isolated from the spleen and percentages of cells (9 + ), germinal center cells (GL ), and Ki7 + cells from and mice were quantified. () MSs (Gr + b + ) in pristane treated and mice were quantified. (E) Peyer s patch and mesenteric lymph node (mln) immune cells were isolated and percentages of T cells and T cells were quantified. (F) ctive and total TGF-β levels were measured in the sera of and GRP mice pre- and post-pil by ELIS. (G) Soluble GRP (sgrp) was measured in the sera of and GRP mice pre- and post-pil by ELIS. n= and n= Pre-PIL; n=7 and n= post-pil. Statistical analysis performed by unpaired two-tailed t- test; p<., p<., p<., error bars represent S..

5 cell tolerance via GRP-TGFβ axis GRP TGF-βRII p Supplemental Figure : GRP overexpression reduces Peyer s patch cell cellularity and proliferation. rtt GRP and control mice were both fed doxycycline in the drinking water for months, n= and n=-. () Total number of Peyer s patches on the small intestine were counted. () Peyer s patches were isolated and percentage of 9 + cells was analyzed by flow cytometry. () Peyer s patch cells were stained intracellularly for Ki7 to assess homeostatic proliferation and analyzed by flow cytometry. Each dot is representative of a separate biological replicate; data is representative of independent experiments. (-) Statistical analysis performed by two-tailed t-test; p<., error bar represents S.. () 9 + cells were isolated from the spleen and Peyer s patches of oxycycline treated and GRP mice, followed by RN isolation and cn synthesis. qrt PR was utilized to detect differences in GRP, TGF-βRII and p transcript level, normalized to β actin. Representative data from independent experiments with biological replicates. Statistical analysis performed by one-way NOV with Tukey s test for multiple comparisons, p<., p<., p<., error bars represent S..

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10772 Supplementary Figures: Supplementary Figure 1. Location of CNS1 within of the Foxp3 locus highlighting CNS1 and indicating transcription factor binding motifs downstream of TCR,

More information

Supplementary figures

Supplementary figures Mucida et al. Supplementary material Supplementary figures Supplementary Figure 1. Oral administration of OVA suppresses Th2 differentiation, Germinal Center (GC) formation and immunoglobulin class switching

More information

Supplementary Figure and Table Legends

Supplementary Figure and Table Legends 1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase

More information

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence 1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11809 Supplementary Figure 1. Antibiotic treatment reduces intestinal bacterial load and allows access of non-pathogenic bacteria to the MLN, inducing intestinal

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from

More information

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched

More information

Supporting Information

Supporting Information Supporting Information Tomura et al. 1.173/pnas.8227815 WT CFSE Con A stimulation Before After 2 3 1 CFSE Kaede- Tg No photoconversion Photoconversion Kaede Red Fig. S1. Dilution of photoconverted Kaede

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3206 Supplementary Figure 1 Autophagy-related gene expression in murine and human intestinal tumors. (a) Representative LC3 immunostaining in colonic adenoma and adjacent non tumoral tissue

More information

Supplemental Information. T Follicular Helper Cell-Germinal Center B Cell. Interaction Strength Regulates Entry into Plasma

Supplemental Information. T Follicular Helper Cell-Germinal Center B Cell. Interaction Strength Regulates Entry into Plasma Immunity, Volume 48 Supplemental Information T Follicular Helper ell-germinal enter B ell Interaction Strength Regulates Entry into Plasma ell or Recycling Germinal enter ell Fate Wataru Ise, Kentaro Fujii,

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTRY FIGURE 1 C D E F G * Supplementary Fig. 1: Platelets from Pik3c2b mice exhibit normal function. () Expression of platelet-specific glycoproteins on the surface of platelets in whole blood

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.

Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices. Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to

More information

MLN8237 induces proliferation arrest, expression of differentiation markers and

MLN8237 induces proliferation arrest, expression of differentiation markers and Supplementary Figure Legends Supplementary Figure 1 827 induces proliferation arrest, expression of differentiation markers and polyploidization of a human erythroleukemia cell line with the activating

More information

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low

More information

Supplemental Information. Myeloid-Derived Suppressor Cells Are. Controlled by Regulatory T Cells via TGF-b. during Murine Colitis

Supplemental Information. Myeloid-Derived Suppressor Cells Are. Controlled by Regulatory T Cells via TGF-b. during Murine Colitis Cell Reports, Volume 17 Supplemental Information Myeloid-Derived Suppressor Cells Are Controlled by Regulatory T Cells via TGF-b during Murine Colitis Cho-Rong Lee, Yewon Kwak, Taewoo Yang, Jung Hyun Han,

More information

isolated from ctr and pictreated mice. Activation of effector CD4 +

isolated from ctr and pictreated mice. Activation of effector CD4 + Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via

More information

Nature Immunology: doi: /ni.3694

Nature Immunology: doi: /ni.3694 Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular

More information

Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut

Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut Immunity, Volume 33 Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut Keiichiro Suzuki, Mikako Maruya, Shimpei

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1 (a) (b) Supplementary Figure 1. Histological difference between fat-associated lymphoid clusters (FALC) and lymph nodes. (a) H&E stained specimens of a mesenteric lymphoid cluster

More information

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity. Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1

More information

Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO

Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO (epoecfc) or LacZ (laczecfc) under control of a cytomegalovirus

More information

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting. Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

More information

Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41

Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 were assessed on purified platelets from Casp8 fl/fl and

More information

Ma, et al. Supplemental Data

Ma, et al. Supplemental Data Ma, et al Supplemental Data Title: Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension and its inhibition attenuates pathologic features of disease Authors: Wanli

More information

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase

More information

Thomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den

Thomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den Cell, Volume 129 Supplemental Data Extending the Host Range of Listeria monocytogenes by Rational Protein Design Thomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den Heuvel,

More information

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined

More information

(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets.

(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets. Supplemental Figure S1. Characteristics of Lnk -/- platelets. (A) Electron micrographs of resting platelets showing the normal intracellular structure of Lnk -/ platelets. Samples were fixed with 4% PFA

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

More information

Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size

Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size comparison of the P6 control and PKO mice. (b) H&E staining of hind-limb muscles from control and PKO mice at P6.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor

More information

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

More information

Nature Medicine: doi: /nm.4169

Nature Medicine: doi: /nm.4169 Supplementary Fig.1. EC-specific deletion of Ccm3 by Cdh5-CreERT2. a. mt/mg reporter mice were bred with Cdh5CreERT2 deleter mice followed by tamoxifen feeding from P1 to P3. mg expression was specifically

More information

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects

More information

Supplementary Information

Supplementary Information 1 2 Supplementary Information 3 4 5 6 7 8 Supplementary Figure 1. Loading of R837 into PLGA nanoparticles. The loading efficiency (a) and loading capacity (b) of R837 by PLGA nanoparticles obtained at

More information

To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated

To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated Supplementary Methods Tolerogenic effect of MDSC To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated MDSC in vivo, we used a model described previously

More information

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16 Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding

More information

The cell-cycle regulator c-myc is essential for the formation and maintenance of germinal centers

The cell-cycle regulator c-myc is essential for the formation and maintenance of germinal centers SUPPLEMENTARY INFORMATION The cell-cycle regulator c-myc is essential for the formation and maintenance of germinal centers Dinis Pedro Calado 1,2, Yoshiteru Sasaki 3, Susana A Godinho 4, Alex Pellerin

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained

More information

Revised: RG-RV2 by Fukuhara et al.

Revised: RG-RV2 by Fukuhara et al. Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

More information

TRIM31 is recruited to mitochondria after infection with SeV.

TRIM31 is recruited to mitochondria after infection with SeV. Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

More information

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude

More information

Supplementary Fig. 1 (Li et al.)

Supplementary Fig. 1 (Li et al.) Supplementary Fig. 1 (Li et al.) Fcrg / Supplementary Figure 1 Microcomputed tomography (mct) images of the distal femurs isolated from the indicated bone marrow chimeric mice. indicates the Dap12 -/-

More information

by Alexander Y. Rudensky (Sloan-Kettering Institute, New York). LSL-TβRI CA (TGFβR-

by Alexander Y. Rudensky (Sloan-Kettering Institute, New York). LSL-TβRI CA (TGFβR- Materials and Methods Mice. Tgfbr2 fl/fl CD4-Cre (TGFβR-KO) mice were previously reported (3). Cre negative littermates were used as wild-type controls. DN-TGFβRII (TGFβR-DN) mice were provided by Ronald

More information

ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites.

ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites. Identity Human Mouse Supplemental Figure 1. Amino acid sequence alignment of -MyHC. The alignment was created using the ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity

More information

The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700

The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700 Flow cytometry analysis and cell sorting The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700 anti-cd5. (), APC-Cy7 anti-epcam (G.; Biolegend, San Diego, CA), PE-Cy7 anti-cd31

More information

Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow

Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,

More information

SOM 1 *** *** *** * * n.s GFP + (NK 10 4 ) Naive DNFB OXA. Donor sensitization: Naive OXA DNFB 1,200 6,000 4,000

SOM 1 *** *** *** * * n.s GFP + (NK 10 4 ) Naive DNFB OXA. Donor sensitization: Naive OXA DNFB 1,200 6,000 4,000 SOM 1 a n.s. 4. 3. GFP + (NK 1 4 ) 2. 1.. Naive DNFB OXA splenic NK hepatic NK b Donor sensitization: Naive OXA DNFB NK cells (% of CD45 + 1 5 ) 1,2 9 6 3 NK cells (% of CD45 + 1 5 ) 6, 4, 2, 24 48 72

More information

Table S1. Oligonucleotide primer sequences

Table S1. Oligonucleotide primer sequences Table S1. Oligonucleotide primer sequences Primer Name DNA Sequence (5 -> 3 ) Description CD19c CD19d Cre7 Sfpi1lox1 Sfpi1lox2 Sfpi1lox3 5 -AACCAGTCAACACCCTTCC-3 5 -CCAGACTAGATACAGACCAG-3 5 -TCAGCTACACCAGAGACGG-3

More information

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2

More information

A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response

A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily

More information

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot (vector: ~25 kda). (b) Silver staining was used to assess

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Ricke et al., http://www.jcb.org/cgi/content/full/jcb.201205115/dc1 Figure S1. Kinetochore localization of mitotic regulators in wild-type

More information

Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin

Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin Supporting Information for Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin Hye-Yeong Kim 1,2+, Ran Li 1+, Thomas S.C. Ng 1, Gabriel Courties

More information

Supplementary Figure 1 Activated B cells are subdivided into three groups

Supplementary Figure 1 Activated B cells are subdivided into three groups Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation

More information

Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.

Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization. Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents

More information

Supporting Information

Supporting Information (xe number cells) LSK (% gated) Supporting Information Youm et al../pnas. SI Materials and Methods Quantification of sjtrecs. CD + T subsets were isolated from splenocytes using mouse CD + T cells positive

More information

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05574 SUPPLEMENTARY INFORMATION Supplementary Results Additional Materials and Methods Analysis of epidermal wholemounts and sections: Tail epidermis. The patterned organisation of tail

More information

bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not

bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is

More information

Supplementary information

Supplementary information Supplementary information Cooperation of Oncolytic Herpes Virotherapy and PD-1 Blockade in Murine Rhabdomyosarcoma Models Chun-Yu Chen 1, Pin-Yi Wang 1, Brian Hutzen 1, Les Sprague 3, Hayley M. Swain 1,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3164 Supplementary Figure 1 Validation of effective Gnas deletion and epithelial thickness. a, Representative genotyping in mice treated or not with tamoxifen to show Gnas deletion. To

More information

BIMM18 Dec 20 th - Flow cytometry in clinical diagnostics

BIMM18 Dec 20 th - Flow cytometry in clinical diagnostics BIMM18 Dec 20 th - Flow cytometry in clinical diagnostics I. B cell leukemia and lymphomas Immunophenotyping as part of the diagnostic work- up of hematologic malignancies offers a rapid and effective

More information

A collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP

A collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP Supplemental Materials & Methods Patients and patient samples. A collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP requiring splenectomy and 36 splenic specimens obtained

More information

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto

More information

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP

More information

Additional analysissu

Additional analysissu SSC-A FSC-A 65.6% FSC-H FSC-A 86.1% SSC-A 93.3% Viaprobe Additional analysissu Supplementary Figure S1. Gating strategy for flow cytometry Doublet cells were discriminated by FSC-A/SSC-A and FSC-A/FSC-H

More information

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)

More information

* * IgL locus (V - J ) λ λ

* * IgL locus (V - J ) λ λ Supplementary Figures and Figure Legend Supplementary Figure S1 A C F Vav-P-BCL2 doner mice 8 6 4 2 Lymphoma free (%)1 Tumor Pathology Score Retroviral transduction Vav-P-BCL2 HPCs HPC + shrna VavP-Bcl2

More information

Stress-associated erythropoiesis initiation is regulated by type 1 conventional dendritic cells

Stress-associated erythropoiesis initiation is regulated by type 1 conventional dendritic cells Stress-associated erythropoiesis initiation is regulated by type 1 conventional dendritic cells Taeg S. Kim,, Paul C. Trampont, Thomas J. Braciale J Clin Invest. 2015;125(10):3965-3980. doi:10.1172/jci81919.

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

Supplementary Fig. 5

Supplementary Fig. 5 Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency

More information

Antibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing

Antibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing Antibody used for FC The following antibodies were used following manufacturer s instructions: anti-human CD4 (clone HI3, IgG1, k - Becton Dickinson), anti-human CD33 (clone WM3, IgG1, k- Becton Dickinson),

More information

Supporting Information

Supporting Information Supporting Information Song et al. 10.1073/pnas.1218131110 SI Materials and Methods In Vivo Dislodgment Assays. In vivo dislodgement experiments were performed as previously described (1) using function

More information

Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total

Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused

More information

TRAIL, Death Receptors, TRA-8, and Apoptosis

TRAIL, Death Receptors, TRA-8, and Apoptosis TRAIL, Death Receptors, TRA-8, and Apoptosis DR5 is a pro-apoptotic molecule, which can induce cell death in a variety of cells by engaging the it ligand, TRAIL or anti-dr5 antibody. TRA-8 is a monoclonal

More information

Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation

Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María

More information

The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells

The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,

More information

IL-4 Promotes the Migration of Circulating B Cells to the Spleen and Increases Splenic B Cell Survival

IL-4 Promotes the Migration of Circulating B Cells to the Spleen and Increases Splenic B Cell Survival This information is current as of November 22, 2018. References Subscription Permissions Email Alerts IL-4 Promotes the Migration of Circulating B Cells to the Spleen and Increases Splenic B Cell Survival

More information

Supplementary Figure 1, Wiel et al

Supplementary Figure 1, Wiel et al Supplementary Figure 1, Wiel et al Supplementary Figure 1 ITPR2 increases in benign tumors and decreases in aggressive ones (a-b) According to the Oncomine database, expression of ITPR2 increases in renal

More information

Supplementary Figure 1. Lack of autoimmunity in NKT cell deficient B6.NZBc4L

Supplementary Figure 1. Lack of autoimmunity in NKT cell deficient B6.NZBc4L Supplementary Figure. Lack of autoimmunity in NKT cell deficient L mice. A,.CDd-deficient mice lack CDd-independent NKT cells. B, In the absence of NKT cells,.cdd -/- mice fail to generate high titres

More information

show PB hemoglobin concentration (Hgb) and platelet counts (Plt) in Kras ex3op/ex3op mice

show PB hemoglobin concentration (Hgb) and platelet counts (Plt) in Kras ex3op/ex3op mice Supplemental Data Supplemental Figure Legends Supplemental Figure 1. Hematologic profile of Kras / mice. (A) Scatter plots show PB hemoglobin concentration (Hgb) and platelet counts (Plt) in Kras / mice

More information

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei

More information

Distribution of human ILCs during chronic lung disease.

Distribution of human ILCs during chronic lung disease. Supplementary Figure 1 Distribution of human ILCs during chronic lung disease. Quantification of flow cytometric analysis of lung tissue from patients with COPD or IPF identifying (a) frequencies of total

More information

Tumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1

Tumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 Tumour Tumour 9 t(6;16) Tumour 5 Tumour 6 Tumour 7 www.nature.com/nature 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary

More information

88.7 <GFP-A>: EGFP GFP. Null. % of Cells! <APC-A> B220!

88.7 <GFP-A>: EGFP GFP. Null. % of Cells! <APC-A> B220! B. C. 1 Cell Number (X18) A. % of Cells % of Max 8 Con 6 4 88.7 1 13 14 : EGFP 4 6 4 1 WT 8 % of% ofcells Max 6 6 4 G. 1 13 B Hdac3-/- 14 15 1 13 14 15 Ter119 Ly6C Wild type WT 4

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title: Lipopolysaccharide treatment suppresses spontaneously developing ankylosing enthesopathy in B10.BR male mice: the potential role of interleukin-10 Authors: Jana Capkova

More information

Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression

Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression Supplemental Information Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated Antitumor Immunity to Promote Tumor Progression Yu Wang, Sheng-Nan Sun, Qing Liu, Yang-Yang Yu, Jian Guo, Kun Wang,

More information

Eight-week-old wildtype mice were kept under standard diet (SD) for 4 weeks, or fed Western

Eight-week-old wildtype mice were kept under standard diet (SD) for 4 weeks, or fed Western Supplemental information M. Itoh et al. 0 Supplemental Methods Inducible NASH model using wildtype mice Eight-week-old wildtype mice were kept under standard diet (SD) for weeks, or fed Western diet (WD)

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Rarefaction Analysis and Sampling. a, Rarefaction plots show the expected levels of coverage for different subsamples of sequencing libraries for repertoires of clone size of at

More information

A Thesis. Submitted to the School of Graduate Studies. in Partial Fulfilment of the Requirements. for the Degree of. Doctor of Philosophy

A Thesis. Submitted to the School of Graduate Studies. in Partial Fulfilment of the Requirements. for the Degree of. Doctor of Philosophy CHRONIC GIARDIASIS IN CBA/N MICE: USE OF GENETICALLY IHKUNODEFICIENT HICE TO STUDY MECHANISMS OF IHHUNITY TO AN INTESTINAL PARASITE BY DANNA LYNN SKEA, B.Sc., H.Sc. A Thesis Submitted to the School of

More information

Supplementary Information

Supplementary Information Supplementary Information Mutual reinforcement of inflammation and carcinogenesis by the Helicobacter pylori CagA oncoprotein Nobumi Suzuki, Naoko Murata-Kamiya, Kohei Yanagiya, Wataru Suda, Masahira Hattori,

More information

Smooth muscle FGF/TGFβ cross-talk regulates atherosclerosis progression. P-Y. Chen et al., Appendix. Table of contents:

Smooth muscle FGF/TGFβ cross-talk regulates atherosclerosis progression. P-Y. Chen et al., Appendix. Table of contents: Smooth muscle FGF/TGFβ cross-talk regulates atherosclerosis progression P-Y. Chen et al., Appendix Table of contents: Appendix Figure S1 and figure legend Appendix Figure S2 and figure legend Appendix

More information

Table S1. Primers used in the study

Table S1. Primers used in the study Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping

More information