Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size
|
|
|
- Norma Parsons
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size comparison of the P6 control and PKO mice. (b) H&E staining of hind-limb muscles from control and PKO mice at P6. (c) Immunohistochemical analysis of CD3 (green) and F4/80 (red) in control and PKO muscles at P6. Scale bars represent 25 μm in b and 50 μm in c. 1
2 Supplementary Figure 2 Specificity of Pdgfrβ-driven Cre in injured conditions. Immunohistochemical analyses were performed on muscle sections from laminin-deficient reporter (F/F:Ai14:Pdgfrβ-Cre + ) mice. (a-f) TdT (red) expression co-localized with PDGFRβ (a, green), PW1 (d, green), but not Pax7 (b, green), PDGFRα (c, green), CD31 (e, green) or CD45 (f, green) in F/F:Ai14:Pdgfrβ-Cre + reporter mice. TdT, tdtomato. Scale bars represent 50 μm. 2
3 Supplementary Figure 3 Representative FACS plots and gating boundaries. (a) Representative FACS plot for PDGFRβ + CD31 - CD45 - population. The gating boundary was determined based on PDGFRβ-FMO control. (b) Representative FACS plot and gating boundary for SM/C CD31 - CD45 - Sca1 - cells (satellite cells). (c) Representative FACS plot for PDGFRα + CD31 - CD45 - population (FAPs). The gating boundary was determined based on PDGFRα-FMO control. (d) Representative FACS plot and gating boundary for CD34 + Sca1 Med CD45 - cells (PICs). 3
4 Supplementary Figure 4 Characterization of FACS-isolated PDGFRβ + cells and satellite cells. (a) CD13 (green) and NG2 (red) expression in PDGFRβ + cells isolated from wild-type mice. (b) ALP (green) expression in PDGFRβ + cells isolated from wild-type mice. (c and d) PDGFRβ (c, green) and PDGFRα (d, green) expression in satellite cells isolated from wild-type mice. Scale bar represents 20 μm. 4
5 Supplementary Figure 5 The proliferation of PDGFRβ + cells is unchanged in PKO mice at P6. (a) PDGFRβ (red) and Ki67 (green) expression in hind-limb muscles from P6 mice. (b, c) Quantification of PDGFRβ expression and PDGFRβ + Ki67 + cells in a. n=3. Scale bar represents 100 μm. Results are shown as mean ± SD. 5
6 Supplementary Figure 6 Loss of laminin in PDGFRβ + cells does not induce apoptosis. (a, b) Quantification of TUNEL + cells in hind-limb muscles from 2-month-old mice (a) and freshly isolated PDGFRβ + cells (b). DNase I-treated PDGFRβ + cells were used as the positive control. n=4. Results are shown as mean ± SD. 6
7 Supplementary Figure 7 The proliferation of PDGFRβ + cells is unaltered in barium chloride-induced injury. (a) Edu (green), PDGFRβ (red), and laminin (blue) expression 5 days after barium chloride injection in the presence of saline or laminin. (b-d) Quantification of PDGFRβ expression (b), total Edu + (c), and Edu + PDGFRβ + cells (d) in a. n=3. Scale bar represents 25 μm. Results are shown as mean ± SD. 7
8 Supplementary Figure 8 The myogenesis of PDGFRβ + cells is unaffected at P6 in PKO mice. (a) S- Myosin (green) expression in hind-limb muscles from P6 control and PKO mice. (b) Quantification of S-Myosin expression in a. n=3. (c) E-Myosin (red) expression in hind-limb muscles from P6 control and PKO mice. (d) Quantification of E-Myosin expression in c. n=3. Scale bars represent 100 μm. Results are shown as mean ± SD. 8
9 Supplementary Figure 9 The adipogenesis of PDGFRβ + cells is unaffected at P6 in PKO mice. (a) Perilipin (green) expression in hind-limb muscles from P6 control and PKO mice. (b) Quantification of perilipin expression in a. n=3. (c) Oil Red O staining of hind-limb muscles from P6 control and PKO mice. Scale bars represent 100 μm. Results are shown as mean ± SD. 9
10 Supplementary Figure 10 CMA1 does not regulate the differentiation of PDGFRβ + cells. (a) RT-PCR analysis of CMA1 expression in PDGFRβ + cells. Actin was used as a loading control. n=3. (b) Western blot analysis of CMA1 expression in PDGFRβ + cells. GAPDH was used as a loading control. n=4. (c) Western blot analysis of perilipin expression in wild-type PDGFRβ + cells treated with rabbit IgG or CMA1 antibody and PKO PDGFRβ + cells treated with BSA or CMA1. GAPDH was used as a loading control. n=4. (d) Western blot analysis of S-Myosin expression in wild-type PDGFRβ + cells treated with rabbit IgG or CMA1 antibody and PKO PDGFRβ + cells treated with BSA or CMA1. GAPDH was used as a loading control. n=4. Results are shown as mean ± SD. *p<0.05 (Student s t-test). 10
11 Supplementary Figure 11 Exogenous laminin increases gpihbp1 expression in laminin α2-deficient (dyw) mice. Western blot analysis of gpihbp1 expression in PDGFRβ + cells isolated from wild-type, dyw, or laminin-treated dyw mice. GAPDH was used as a loading control. n=3. Results are shown as mean ± SD. *p<0.05; **p<0.01 (Student s t-test). 11
12 Supplementary Figure 12 Full size images of the blots. (a) Full blots for Figure 2g. (b) Full blots for Figure 5c. (c) Full blots for Figure 6b. (d) Full blots for Figure 7d. (e) Full blots for Figure 7e. (f) Full blots for Figure 7f. (g) Full blots for Figure 7g. (h) Full blots for Figure 7h. (i) Full blots for Figure 7i. (j) Full blots for Figure 8f. (k) Full blots for Figure 8g. (l) Full blots for Supplementary Figure 9a. (m) Full blots for Supplementary Figure 10b. (n) Full blots for Supplementary Figure 10c. (o) Full blots for Supplementary Figure 10d. (p) Full blots for Supplementary Figure
Supplementary Figures
Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained
Laminin regulates PDGFRb þ cell stemness and muscle development
Received Nov 15 Accepted Mar 16 Published 3 May 16 Laminin regulates PDGFRb þ cell stemness and muscle development Yao Yao 1,, Erin H. Norris 1, Christopher E. Mason 3,,5,6 & Sidney Strickland 1 DOI: 1.138/ncomms1115
The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells
Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,
Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
STAT3 signaling controls satellite cell expansion and skeletal muscle repair
SUPPLEMENTARY INFORMATION STAT3 signaling controls satellite cell expansion and skeletal muscle repair Matthew Timothy Tierney 1 *, Tufan Aydogdu 2,3 *, David Sala 2, Barbora Malecova 2, Sole Gatto 2,
supplementary information
DOI: 10.1038/ncb2015 Figure S1 Confirmation of Sca-1 CD34 stain specificity using isotypematched control antibodies. Skeletal muscle preparations were stained and gated as described in the text (Hoechst
Supplementary Information
Supplementary Information Supplementary Figure 1: Identification of new regulators of MuSC by a proteome-based shrna screen. (a) FACS plots of GFP + and GFP - cells from Pax7 ICN -Z/EG (upper panel) and
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Suppl. Fig. 1. Notch and myostatin expression is unaffected in the absence of p65 during postnatal development. A & B. Myostatin and Notch-1 expression levels were determined
(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
Supplemental Material
Supplemental Material Figure S1.(A) Immuno-staining of freshly isolated Myf5-Cre:ROSA-YFP fiber (B) Satellite cell enumeration in WT and cko mice from resting hind limb muscles. Bulk hind limb muscles
SUPPLEMENTARY INFORMATION
Elastase levels and activity are increased in dystrophic muscle and impair myoblast cell survival, proliferation and differentiation N. Arecco 1,2,3, C.J. Clarke 1,2, F.K. Jones 1,2, D. Simpson 1,4, D.
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),
Supplemental Table/Figure Legends
MiR-26a is required for skeletal muscle differentiation and regeneration in mice Bijan K. Dey, Jeffrey Gagan, Zhen Yan #, Anindya Dutta Supplemental Table/Figure Legends Suppl. Table 1: Effect of overexpression
Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41
Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 were assessed on purified platelets from Casp8 fl/fl and
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Gillespie et al., http://www.jcb.org/cgi/content/full/jcb.200907037/dc1 repressor complex induced by p38- Gillespie et al. Figure S1. Reduced fiber size
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating
Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low
neutrophils (CD11b+, the total Statistical multiple
Supplementary Figure 1. (A) Wild type and Vim / mice were treated with (24mg/kg LPS); lungs were harvested at 48h and enzymaticallyy digested. CD45+ cells were excluded from the total cell population and
Supplementary Information
Supplementary Information PDGFRα plays a crucial role in connective tissue remodeling Shinjiro Horikawa 1,2, Yoko Ishii 1, Takeru Hamashima 1, Seiji Yamamoto 1,*, Hisashi Mori 3, Toshihiko Fujimori 4,
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,
Supplementary Figure S1. Expression of complement components in E4 chick eyes. (a) A
Supplementary Figure S1. Expression of complement components in E4 chick eyes. (a) A schematic of the eye showing the ciliary margin (CM) of the anterior region, and the neuroepithelium (NE) and retinal
SUPPLEMENTAL INFORMATION
UTX/KDM6A demethylase activity is required for satellite cell-mediated muscle regeneration Hervé Faralli 1,2, Chaochen Wang 3, Kiran Nakka 1,2, Soji Sebastian 1,, Aissa Benyoucef 1,2, Lenan Zhuang 3, Alphonse
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
a KYSE270-CON KYSE270-Id1
a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/85/ra48/dc1 Supplementary Materials for The VDAC2-BAK Rheostat Controls Thymocyte Survival Decheng Ren, Hyungjin Kim, Ho-Chou Tu, Todd D. Westergard, Jill K.
Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox
Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is
immunofluorescence. Name of antibodies Manufacturer Catalog Number Rabbit anti-pdyn Rabbit anti-kor-1
Supplemental Tables Table S1. List of primary antibodies used for immunohistochemistry, FACS, and immunofluorescence. Name of antibodies Manufacturer Catalog Number Rabbit anti-pdyn Bioss USA bs-13041r
Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy
Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy Keijiro Ishikawa, 1,2 Shikun He, 2, 3 Hiroto Terasaki, 1 Hossein
Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,
Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin
Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin (A), D1-CD2 (B), and the D1-CD2 variant 3 (C) to Adomain
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
Supplementary Figure 1 Activated B cells are subdivided into three groups
Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation
Nature Medicine: doi: /nm.4169
Supplementary Fig.1. EC-specific deletion of Ccm3 by Cdh5-CreERT2. a. mt/mg reporter mice were bred with Cdh5CreERT2 deleter mice followed by tamoxifen feeding from P1 to P3. mg expression was specifically
Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
Regulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO (epoecfc) or LacZ (laczecfc) under control of a cytomegalovirus
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100
(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for
Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote
Supplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi
Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Table 1 Supplementary Figures 1, 2, 3, 4, 5, 6, 7, 8 and legends Supplementary Video 1, 2 legends AON Sequence Position Length MW tcdna 5 -AACCTCGGCTTACCT-3 +2-13
Supplementary Figure and Table Legends
1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for
Supplemental Information
Supplemental Information RSPO3-LGR4 regulates osteogenic differentiation of human adipose-derived stem cells via ERK/FGF signaling Min Zhang a,b1, Ping Zhang a,b1, Yunsong Liu a,b, Longwei Lv a,b, Xiao
Nodal expression was directly inhibited using antisense Morpholino oligonucleotides
Supplementary Note Rationale for Morpholino based inhibition of Nodal expression Nodal expression was directly inhibited using antisense Morpholino oligonucleotides (MO Nodal ) fluorescently labeled with
Supplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9
Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.
Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)
Supplementary material
Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin
Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4
Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
Supplemental Figure 1: Podocyte specific knockdown of Klf4 in Podocin-Cre Klf4 flox/flox mice was confirmed. (A) Primary glomerular epithelial cells
Supplemental Figure 1: Podocyte specific knockdown of Klf4 in Podocin-Cre Klf4 flox/flox mice was confirmed. (A) Primary glomerular epithelial cells were isolated from 10-week old Podocin-Cre Klf4 flox/flox
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
Rejuvenation of the muscle stem cell population restores strength to injured aged muscles
Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Benjamin D Cosgrove, Penney M Gilbert, Ermelinda Porpiglia, Foteini Mourkioti, Steven P Lee, Stephane Y Corbel,
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1. Generation of a synaptobrevin2-mrfp knock-in mouse. (a) Targeting strategy of Syb2-mRFP knock-in mouse leaving the synaptobrevin2 gene locus intact except
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
Wnt16 smact merge VK/AB
A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day
Pei et al. Supplementary Figure S1
Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:
TITLE: Enhancement of Skeletal Muscle Repair by the Urokinase Type Plasminogen Activator System
AD Award Number: W81XWH-05-1-0159 TITLE: Enhancement of Skeletal Muscle Repair by the Urokinase Type Plasminogen Activator System PRINCIPAL INVESTIGATOR: Timothy J. Koh, Ph.D. CONTRACTING ORGANIZATION:
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.
Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,
Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in
Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in platelets. (a) RT-PCR of Pfn isoforms in control mouse platelets, Pfn1 -/- platelets and control heart. Expected band size for Pfn1
Supplemental Figures. B cell tolerance via GARP-TGF-β axis
cell tolerance via GRP-TGF-β axis Supplemental Figures.. Spleen... Spleen mln Total FoxP + FoxP + Helios + FoxP + Helios - Total FoxP + FoxP + Helios + FoxP + Helios - Peyer s Small Intestine mln cell
Supplementary Table S1
Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure S1. Efficacy of STIM1 knockdown by electroporation of STIM1 sirnas. (a) Western blot of FDB muscles from 4 mice treated with either STIM1-specific sirna (KD)
Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
88.7 <GFP-A>: EGFP GFP. Null. % of Cells! <APC-A> B220!
B. C. 1 Cell Number (X18) A. % of Cells % of Max 8 Con 6 4 88.7 1 13 14 : EGFP 4 6 4 1 WT 8 % of% ofcells Max 6 6 4 G. 1 13 B Hdac3-/- 14 15 1 13 14 15 Ter119 Ly6C Wild type WT 4
Single cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data
Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures
Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with
Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with blunted cusp formation, and presence of an ectopic molar
WT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
DRG Pituitary Cerebral Cortex
Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.
7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells.
Antibody staining for Ho uptake analyses For HSC staining, 10 7 BM cells from Ho perfused mice were stained with biotinylated lineage antibodies (CD3, CD5, B220, CD11b, Gr-1, CD41, Ter119), anti Sca-1-PECY7,
Supplementary Information. HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis
Supplementary Information HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis by recruiting EZH2 and repressing p27kip1/cdk2 signaling Jiao-Jiao Hu 1, Wei Song 1, Shao-Dan Zhang 1, Xiao-Hui
Supplementary Fig. 5
Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency
IGF-1 promotes the development and cytotoxic activity of human NK cells regulated
Supplementary Information for IGF-1 promotes the development and cytotoxic activity of human NK cells regulated by mir-483-3p Fang Ni 1, 2, Rui Sun 1, Binqing Fu 1, Fuyan Wang 1, Chuang Guo 1, Zhigang
Supplementary Figure 1 a
3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min
Supplementary Figures, Tables, and Legends:
Supplementary Figures, Tables, and Legends: Supplementary Figure 1. RBPjκ is efficiently knocked down in RBPjk Prx1 mutant compact bones. Western blot analyses for RBPjk in protein extracts from femurs
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
Bcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein
Bcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein Maybelline Giam 1,2, Toru Okamoto 1,2,3, Justine D. Mintern 1,2,4, Andreas Strasser 1,2 and Philippe Bouillet 1, 2 1 The Walter and Eliza
Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.
LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4
Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs
a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5
Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.
Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
Supporting Online Material. Methods
Supporting Online Material Methods Cell culture Cells were prepared from muscle tissue by enzymatic dissociation as previously described. Cells were plated on gelatin coated dishes in a 1:1mixture (v/v)
Transcription factor TBX4 regulates myofibroblast accumulation and lung fibrosis
Transcription factor TBX4 regulates myofibroblast accumulation and lung fibrosis Ting Xie, 1 Jiurong Liang, 1 Ningshan Liu, 1 Caijuan Huan, 1,2 Yanli Zhang, 1,3 Weijia Liu, 4,5 Maya Kumar, 6 Rui Xiao,
Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: Notch2 (forward: 5 -ATGCACCATGACATCGTTCG-3, reverse:
Supplementary Information Supplementary Methods. RT-PCR. For mouse ES cells, the primers used were: Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: 5 -CAATCAGAGATGTTGGAATGC-3 ) 1, Notch2 (forward:
Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri