SUPPLEMENTARY INFORMATION

Transcription

1 Supplementary Figure 1 (a) (b) Supplementary Figure 1. Histological difference between fat-associated lymphoid clusters (FALC) and lymph nodes. (a) H&E stained specimens of a mesenteric lymphoid cluster (left panels) and a mesenteric lymph node (MLN) (right panels). Scale bars indicate: upper left, 300 µm; upper right, 1000 µm; lower panels, 50 µm. Arrowheads in lower right panel indicate a fibrous capsule. (b) Colored areas indicate a blood vessel found in FALC. Scale bar, 50 µm. 1

2 Supplementary Figure 2 (a) (b) Supplementary Figure 2. Immunofluorescence staining of FALC and milky spot. (a) Frozen sections of a mesenteric FALC and an omental milky spot were stained with the indicated antibodies and DAPI. Scale bar, 50 µm. (b) Flow cytometric analysis of Peyer s patch, FALC and omental milky spot B cells. Cells were stained with the indicated antibodies. B220 + GL7 (Ly77) + cells are germinal center B cells. 2

3 Supplementary Figure 3 Supplementary Figure 3. FALC c-kit + Sca-1 + cells do not differentiate into T or B cells in vitro. FALC c-kit + Sca-1 + and Lin - c-kit + cells from fetal liver (E17) were seeded at 5.8 x 10 4 or 8.3 x 10 4 cells/well, respectively, into 6 well tissue culture plates containing a confluent monolayer of TSt-4 or TSt-4/DLL1. Co-cultures were performed in RPMI complete medium with 10 ng ml -1 IL7 and 10 ng ml -1 Flt3l, and media changed by half every 4 days. Cells were analyzed by FACSCalibur after 2 weeks of co-culture. Since TSt-4 and TSt-4/DLL1 cells express GFP, GFP - cells were gated and analyzed for the indicated surface markers. Furthermore, no T cell development was observed in a fetal thymic organ culture system where FALC c-kit + Sca-1 + cells were co-cultured with deoxyguanosine-treated fetal thymic lobes (data not shown). 3

4 Supplementary Figure 4 Supplementary Figure 4. H&E stained specimens of FALC in aly/aly and Rorc GFP/GFP mice. Scale bars, 200 µm. 4

5 Supplementary Figure 5 Supplementary Figure 5. Microarray analysis of the expression of T cell- or LTi cell-related genes in FALC c-kit + Sca-1 +, DN2 and LTi cells. Total RNAs of FALC c-kit + Sca-1 +, DN2 and LTi cells were extracted and duplicate samples examined. 5

6 Supplementary Figure 6 Supplementary Figure 6. Growth curve of FALC c-kit + Sca-1 + cells cultured with IL2. Five thousand cells were plated per well and cultured with 10 ng ml -1 IL2. Cell numbers were counted in triplicate samples on the indicated days. 6

7 Supplementary Figure 7 (a) (b) Supplementary Figure 7. Production of Th2 cytokines from various cells. (a) Expression levels of T1/ST2 on various cells. Thin lines are control staining patterns, bold lines are T1/ST2 levels. The shaded histogram indicates the expression level of T1/ST2 on FALC c-kit + Sca-1 + cells after stimulation with IL33. (b) Production of cytokines from various cells. The indicated cells (5 x 10 3 ) were stimulated with the specified cytokines for 4 days and the concentrations of IL5, IL6 and IL13 in the supernatants were determined by ELISA. Although not shown, IFNγ production was not detected in these cultures. 7

8 Supplementary Figure 8 Supplementary Figure 8. Antibody production by B cells co-cultured with FALC c-kit + Sca-1 + cells. Splenic B cells ( ) were co-cultured with BAFF (50 ng ml -1 ) and the indicated numbers of FALC c-kit + Sca-1 + cells for 4 days under various conditions (LPS: 10 µg ml -1, TGF-β1: 2 ng ml -1, IL2: 10 ng ml -1, anti-cd40: 5 µg ml -1, IL4: 10 ng ml -1 ). The amounts of the indicated class of antibodies produced in each culture condition were determined by ELISA. Data represent the mean and SD of triplicate samples. Similar results were obtained with B cells from Peyer s patches and from peritoneal cavity (data not shown). 8

9 Supplementary Figure 9 Supplementary Figure 9. Dose-dependent cytokine production by FALC c-kit + Sca-1 + cells in response to IL33. FALC c-kit + Sca-1 + cells (5,000 cells in 200 µl media) were cultured with the indicated concentrations of IL33 for 3 days and culture supernatants analyzed by ELISA for IL5 and IL13. As shown in Fig. 4f, helminth infection induced 100 pg ml -1 IL33 in the peritoneal wash, indicating that more than 100 pg ml -1 IL33 was produced by helminth infection, which is sufficient to induce ng ml -1 levels of IL13 in the peritoneal cavity. 9

10 Supplementary Table 1 Oligos Sequences 5'-3' length reference Id2-F Id2-R Rorc-F Rorc-R Lta-F Lta-R Ltb-F Ltb-R Ltbr-F Ltbr-R Tbx21-F Tbx21-R Stat4-F Stat4-R Maf-F Maf-R Gata3-F Gata3-R Junb-F Junb-R Stat6-F Stat6-R Il5-F Il5-R Il13-F Il13-R Actb-F Actb-R AAAACAGCCTGTCGGACCAC CTGGGCACCAGTTCCTTGAG AGCAGTGTAATGTGGCCTAC GCACTTCTGCATGTAGACTG CACGAGGTCCAGCTCTTTTC AGTGCAAAGGCTCCAAAGAA GGAGCACAGGCTCAGAAAAG GAGCTCAGGGTTGAGGTCAG GAGCAGAACCGGACACTAGC GAAGGTAGGGATGAGCACC CTAAGCAAGGACGGCGAATGT GGCTGGGAACAGGATACTGG TGGCAACAATTCTGCTTCAAAAC GAGGTCCCTGGATAGGCATGT GTGCAGCAGAGACACGTCCT CAACTAGCAAGCCCACTC TCGGCCATTCGTACATGGAA GAGAGCCGTGGTGGATGGAC ACCATCAGCTACCTCCCACATG ACCATCAGCTACCTCCCACATG CTCTGTGGGGCCTAATTTCCA CATCTGAACCGACCAGGAACT GAGCACAGTGGTGAAAGAGACCTT ATGACAGGTTTTGGAATAGCATTT CCCCAGGGCCGGTGCCAAGATCT GAAGGGGCCGTGGCGAAACAGTTG GTGGGCCGCTCTAGCCACCAA TCTTTGATGTCACGCACGATTTC 121bp S. Saika et al., Am. J. Physiol. Cell. Physiol. 290, C282 (2006). 180bp A. De Luca et al., J. Immunol. 179, 5999 (2007). 218bp E. Alcamo et al., J. Exp. Med. 195, 233 (2002). 276bp E. Alcamo et al., J. Exp. Med. 195, 233 (2002). 271bp A. Kather et al., Immunology 108, 338 (2003). 624bp O. Brenner et al., Proc. Natl. Acad. Sci. U. S. A. 101, (2004). 225bp S. Zaheer, Y. Wu, J. Bassett, B. Yang, A. Zaheer, Neurochem. Res. 32, 2123 (2007). 272bp B. Z. Ring, S. P. Cordes, P. A. Overbeek, G. S. Barsh, Development 127, 307 (2000). 285bp T. Ikawa et al., Blood 103, 530 (2004). 105bp S. Kinser et al., J. Toxicol. Environ. Health A 67, 1423 (2004). 135bp Zaheer, Y. Wu, J. Bassett, B. Yang, A. Zaheer, Neurochem. Res. 32, 2123 (2007). 200bp O. Brenner et al., Proc. Natl. Acad. Sci. U. S. A. 101, (2004). 335bp A. M. Murray, B. Simm, K. W. Beagley, Cytokine 10, 337 (1998). 540bp Doi, K. Obayashi, T. Kadowaki, H. Fujii, S. Koyasu, Int. Immunol. 20, 499 (2008). Supplementary Table 1. Primer sequences used for RT-PCR 10