Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds.
|
|
|
- Easter Houston
- 5 years ago
- Views:
Transcription
1 Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds. Kellye Eversole IWGSC Executive Director Plant Genomics and Gene Editing Congress Amsterdam, The Netherlands 16 March 2017
2 The odyssey begins 2005
3 Genome sequencing the wheat challenge
4 How to produce a useful sequence??????? $$$$$
5 Vision Goal Vision Lay a foundation to accelerate wheat improvement Increase profitability throughout the industry High quality annotated genome sequence, comparable to rice Physical map-based, integrated and ordered sequence
6 A chromosome-based approach AA BB Triticum aestivum (2n = 6x = 42) 1C ~ 17,000 Mbp DD Sheath fluid Laser Excitation light Flow chamber Fluorescence emission Dissection of the genome to single chromosomes (arms) representing individual (sub)genomes A B D Deflection plates Scattered light ; Doležel et al., Chromosome Res. 15: 51, 2007 Chromosomes: Mbp ( % of the genome) Chromosome arms: Mbp ( % of the genome) Waste Chromosome specific BAC libraries ( ) Amplified DNA for chromosome survey ( ) IEB
7
8 An integrated and ordered 3B reference sequence MetaQTL analysis 3B consensus map (5000 markers) 3B Physical map 3B pseudomolecule Feuillet, Paux, and Choulet, Science 2008 and Science 2014
9 Roadmap to the Wheat Genome Sequence Illumina sequencing of individual chromosomes Physical maps of individual chromosomes 100% IWGSC CSS v2 (2014) + Whole genome mate pairs IWGSC CSS v3 (2016) MTP sequencing 62% Pseudomolecule assembly 100% Chromosome 3B (2014) 20 chromosomes (2016) NRGene-Illumina WGS IWGSC Whole Genome Assembly v0.4 (2016) + Radiation Hybrid, Hi-C, genetic, LD maps BioNanoGenomics optical maps MTP sequence tags.. Reference Genome Sequence (2017)
10 The IWGSC CS WGA Project timeline 2015 DNA Extraction Sequencing Complete Agreement Go! Libraries Complete Assembly V0.1 Assembly V0.2 Complete QA August Sept October November December January February March ~2 months from data accumulation to completion of first assembly
11 IWGSC Whole Genome Assembly Project De novo assembly: NRGene's DeNovoMagic-2 platform, total run time < 3 weeks, 1Tb RAM computer Illumina short-read sequencing data only (200 x coverage) Assembly size: 14.5 Gbp Est. gaps size: 262 Mbp Gaps %: 1.80 Total # scaffolds: 138,484 N50: 7.1Mbp L50 (#sequences): 566 N90: 1.3 Mbp L90 (#sequences): 2,363 MAX Scaffold: 45.8 Mbp
12 WGA Assembly Statistics IWGSC WGA TGAC WGS IWGSC CSS JGI WGS
13 Concerted integration of resources: RefSeq v1.0
14 IWGSC RefSeq v1.0 Project Timeline Agreement Go! Libraries Complete DNA Extraction Sequencing Complete Assembly v0.1 Assembly v0.2 Hi-C data complete Assembly v0.3 Complete QA Pseudomolecules v0.4 IWGSC PR Prepublication Access v0.4 Pseudomolecules RefSeqv1.0 Chromosome resources integration IWGSC RefSeqv1.0 Pre-pub. Access AUG SEP OCT NOV DEC JAN FEB MAR APR MAY JUN JUL AUG SEP OCT JAN
15 IWGSC RefSeq Project Physical maps for all chromosomes 1,839,128 BACs, 47,810 contigs, 380,675 singletons WGP tags (mostly from MTP BACs) for all chromosomes except 3B 4,305,249 unique tags, 693,697 BACs BAC sequence assemblies for 8 chromosomes (1A, 1B, 3B, 3D, 6B, 7A, 7B, 7D) and partial MTP data for two arms (4AL, 5BS) 52,890 BACs (9.7 Gb), N50-68 kb Optical maps for 7A, 7B and 7DS 1,335 BioNanoGenomics contigs aligned to the WGA assembly GBS map of the SynOp RIL population 179 RILs, 4074 markers
16 Comparison of IWGSC Assembly Releases IWGSCv0.4 RefSeqv1.0 Number / coverage of scaffolds/contigs 138,607 /14.5 Gb 138,665 /14.5 Gb Number / coverage of scaffolds/contigs >=100kb 4,442 / 14.2 Gb 4,443 / 14.2Gb N50 scaffolds / superscaffolds 7.0 Mb 22.8 Mb L50 (no. sequences N50) N90 scaffolds / superscaffolds 1.3 Mb 4.1 Mb L90 (no. sequences N50) Gaps filled with BAC sequences 183 (1.7 Mb) Average size of inserted BAC sequences 9.5 kb Sequence assigned to chromosomes 14.1 Gb (96.8%) 14.1 Gb (96.8%) RefSeq v1.0 contains ~ 75 scaffolds per chrom. Sequence assigned to chromosomes (>=100kb) 14.1 Gb (99.1%) 14.1 Gb (99.1%) No. scaffolds / superscaffolds on chromosomes 3,975 1,601 No. oriented scaffolds / superscaffolds 2,464 1,243 Oriented sequence 13.1 Gb (90.2%) 13.8 Gb (95%) Oriented sequence >=100kb 13.1 Gb (92.4%) 13.8 Gb (97.3%)
17 IWGSC RefSeq v1.0 Annotation IWGSC RefSeq v1.0 pseudomolecules Triannot pipeline PGSB pipeline Repeat-masked scaffolds Repeat database ClariTeRep Agreed Gene Model Evidence: RNASeq,ISOSeq,flcDNA Gene calls Manual annotation of gene families: NB- LRR, AA-transporter, PPR,. Gene Models Repeat database ReCAT Gene Models Continued manual annotation and curation of annotations Gene model evaluation, EarIham Institute Functional annotation, GO, InterPRO Combined gene models Classification, pseudogene identification Future Annotated IWGSC RefSeq v2.0 IWGSC RefSeq v1.0 pseudomolecules for genome-wide analysis IWGSC RefSeq v1.0 pseudomolecules for publication
18 IWGSC RefSeq Data Access & Availability Pre-publication data access: IWGSC WGA v0.4: June 13, 2016 IWGSC RefSeq v1.0: January 14, 2017 Gene models completed: March 2017 Final analyses completed: April/May 2017 Manuscript submission: Summer
19 The IWGSC Today
20 1
21 IWGSC 2.0 Manual and functional annotation of the sequence to empower gene discovery and gene cloning to understand the molecular basis of traits Coordination of re-sequencing activities for diversity panels that represent the breadth of geographic distribution of germplasm for breeders Support the development of user-friendly, integrated databases
22 Lessons learned At least one high quality, manually annotated reference sequence Physical map-based for adaptability to any technology Maintain flexibility for new technologies without losing sight of quality Stay on the course towards your vision
23 Acknowledgments IWGSC Leadership: Rudi Appels, Kellye Eversole, Catherine Feuillet, Beat Keller, Jane Rogers IWGSC Chromosome Leaders: Etienne Paux, Frédéric Choulet Jaroslav Dolezel, Hana Simkova, Miroslav Valarik, Jan Bartos Hirokazu Handa Luigi Cattivelli Bikram Gill Catherine Feuillet John Jacobs Beat Keller Abraham Korol Rudi Appels Hikmet Budak Nils Stein Thorsten Schnurbusch Curtis Pozniak Andrew Sharpe Kuldeep Singh Elena Salina Nikolai Ravin Odd-Arne Olsen Song Weining Matt Clark
24 Acknowledgments Physical maps IWGSC Reference Pseudomolecule* All physical maps and pseudo-molecule sequences available at IWGSC repository:
25 IWGSC RefSeq v1.0 Team Leaders IWGSC Sequence Repository WGA PIs Pseudomolecule Team Michael Alaux BAC Libraries Jaroslav Dolezel, Hana Simkova BAC Library Pools Hélène Bergès BAC WGP Tags John Jacobs Genetic Maps Jesse Poland RH Mapping Vijay Tiwari Curtis Pozniak Andrew Sharpe Nils Stein Jesse Poland Frédéric Choulet Gil Ronen Assaf Distelfeld Mike Thompson Kellye Eversole Jane Rogers Frédéric Choulet Gabriel Keeble-Gagnere Annotation Team Martin Mascher Philippe Leroy Frédéric Choulet Manuel Spannagl, Klaus Mayer David Swarbreck RNASeq Cristobal Uauy
26 IWGSC Sponsors
27 Thank you for your attention!
Excerpts from a Seminar at Bayer CropScience February 2015
Excerpts from a Seminar at Bayer CropScience February 2015 Kellye Eversole IWGSC Executive Director Seminar Ghent, Belgium 12 February 2015 Update on the International Wheat Genome Sequencing Consortium
The international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director ACPFG Seminar University of Adelaide 1st May 2014 The International Wheat Genome Sequencing
The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$
The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$ Kellye$A.$Eversole! IWGSC!Execu,ve!Director! &$ The$IWGSC$ Wheat$Breeding$2014:$$Tools,$Targets,$&$Progress$ Harpenden,$United$Kingdom$
Cereal endosperm; lessons learnt from molecular biology, cell biology, genomics and transcriptomics analysis.
Cereal endosperm; lessons learnt from molecular biology, cell biology, genomics and transcriptomics analysis. Odd-Arne Olsen Department of plant sciences Norwegian university of life sciences The cereal
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
Utilization of the IWGSC Resources: Application to Wheat Breeding
Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these
A Whole Genome Assembly of Rye (Secale cereale)
A Whole Genome Assembly of Rye (Secale cereale) M. Timothy Rabanus-Wallace Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Why rye? QTL analysis for Survival After Winter (SAW) scores
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO Luigi Cattivelli, The International Durum Wheat Genome Sequencing Consortium 31/01/2017 1 Durum wheat Durum wheat with a total production of about
Using LTC Software for Physical Mapping and Assisting in Sequence Assembly
Using LTC Software for Physical Mapping and Assisting in Sequence Assembly Z. Frenkel, V. Glikson, A. Korol Institute of Evolution, University of Haifa See also poster P1194 PAGXXIII, San Diego, January
Sequence-based assembly of chromosome 7A and comparison to diploid progenitors
Sequence-based assembly of chromosome 7A and comparison to diploid progenitors Gabriel Keeble-Gagnere1 J Nystrom-Persson1, C Cavanagh2, D Fleury3, H Webster1, R Appels1 1 Veterinary and Life Sciences,
Welcome to the Future: Global Wheat Genome Sequencing Efforts
Welcome to the Future: Global Wheat Genome Sequencing Efforts Crop Development Centre Durum Wheat Breeding and Genetics Program Dr. Curtis J. Pozniak Use and/or distribution of these slides is prohibited
Structure and Dynamics of the Hexaploid Wheat Genome
TGAC 2016 March 30 th Structure and Dynamics of the Hexaploid Wheat Genome Frédéric CHOULET Genetics Diversity Ecophysiology of Cereals INRA U. Clermont-Ferrand, France Structure, evolution of wheat genome
The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience
Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ)
Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ) Martin Mascher IPK Gatersleben PAG XXII January 14, 2012 slide 1 Proof-of-principle in barley Diploid model for wheat 5 Gb
Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan
Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan Yasunari Ogihara 1, Kanako Kawaura 1, Shuhei Nasuda 2, Takashi R. Endo 2, Katsuyuki Hayakawa 3, Jaroslav Dolezel 4,Hirokazu Handa
Wheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes
Wheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes Prospects in Wheat Genomics -- what is needed from a research perspective Rudi Appels,
Draft White Paper on the International Wheat Genome Sequencing Consortium May 2005
Page 1 Draft White Paper on the International Wheat Genome Sequencing Consortium May 2005 Rudi Appels 1, Catherine Feuillet 2, and Bikram Gill 3, WGSC Co-Chairs Robin Buell 4, Forrest Chumley 5, Kellye
Whole Genome Profiling provides a robust framework for physical mapping and sequencing in the highly complex and repetitive wheat genome
BMC Genomics This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Whole Genome Profiling provides
IWGSC IBSC. Sequencing Technologies Workshop
International Wheat Genome Sequencing Consortium IWGSC IBSC NTERNATIONAL ARLEY EQUENCING ONSORTIUM Sequencing Technologies Workshop Genoscope, National Sequencing Center Evry, France September 11-12 2008
Triticeae genome MIPS PlantsDB. Manuel Spannagl transplant workshop Versailles Nov 2012
Triticeae genome resources @ MIPS PlantsDB Manuel Spannagl transplant workshop Versailles Nov 2012 What is MIPS PlantsDB? Generic database schema+system for the integration, management and (comparative)
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
NGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
Improving genome assemblies and capturing genome variation data for applied crop improvement.
Improving genome assemblies and capturing genome variation data for applied crop improvement. David Edwards University of Western Australia, Australia Dave.Edwards@uwa.edu.au 1 Outline Sequencing wheat
The Irys System. Rapid Genome Wide Mapping for de novo Assembly and Structural Variation Analysis. Jack Peart, Ph.D. Director of Sales EMEA
The Irys System Rapid Genome Wide Mapping for de novo Assembly and Structural Variation Analysis Jack Peart, Ph.D. Director of Sales EMEA BioNano Snapshot Developed & Commercialized the Irys System for
Chapter 11 Development of the BAC Physical Maps of Wheat Chromosome 6B for Its Genomic Sequencing
Chapter 11 Development of the BAC Physical Maps of Wheat Chromosome 6B for Its Genomic Sequencing Fuminori Kobayashi, Satoshi Katagiri, Wataru Karasawa, Yumiko Hanawa, Hiroyuki Kanamori, Yukiyo Ito, Hiroko
High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae
High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae within the powdery mildew resistance locus QPm.tut-4A Miroslav Valárik Institute of Experimental
Whole-genome profiling and shotgun sequencing delivers an anchored, gene-decorated, physical map assembly of bread wheat chromosome 6A
The Plant Journal (2014) 79, 334 347 doi: 10.1111/tpj.12550 TECHNICAL ADVANCE Whole-genome profiling and shotgun sequencing delivers an anchored, gene-decorated, physical map assembly of bread wheat chromosome
Durum Wheat Genomics and Breeding EWG Annual report and action plan
Coordinating global research for wheat Durum Wheat Genomics and Breeding EWG Annual report and action plan NAME OF EXPERT WORKING GROUP EWG on DURUM WHEAT GENOMICS AND BREEDING LEADERSHIP & AUTHORSHIP
Genome Sequencing-- Strategies
Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that
Genome Projects. Part III. Assembly and sequencing of human genomes
Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics Dario Copetti, PhD Arizona Genomics Institute The University of Arizona International
BENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach
Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach Hélène BERGES Director of the Plant Genomic Center Global warming effects,
Usage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager
Usage Cases of GBS Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell CBSU Workshop Sept 15 16, 2011 Some potential applications
Functional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group
Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated
Genome evolution on the allotetraploid Xenopus laevis
Genome evolution on the allotetraploid Xenopus laevis Taejoon Kwon Department of Biomedical Engineering, School of Life Sciences Ulsan National Institute of Science & Technology (UNIST) Xenopus Bioinformatics
De novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Céline CHANTRY-DARMON 1 CNRGV The French Plant Genomic Center Created
Genome sequencing in Senecio squalidus
Genome sequencing in Senecio squalidus Outline of project A new NERC funded grant, the genomic basis of adaptation and species divergence in Senecio in collaboration with Richard Abbott and Dmitry Filatov
Genomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics
Genomic Technologies Michael Schatz Feb 1, 2018 Lecture 2: Applied Comparative Genomics Welcome! The primary goal of the course is for students to be grounded in theory and leave the course empowered to
Connect-A-Contig Paper version
Teacher Guide Connect-A-Contig Paper version Abstract Students align pieces of paper DNA strips based on the distance between markers to generate a DNA consensus sequence. The activity helps students see
Mate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
Frequent Gene Movement and Pseudogene Evolution Is Common to the Large and Complex Genomes of Wheat, Barley, and Their Relatives W OA
This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been edited and the authors have corrected proofs,
Application of next generation sequencing of a begomovirusresistant. KASPar assay for SNP detection of the Ty1-Ty3 region
Application of next generation sequencing of a begomovirusresistant inbred to design a KASPar assay for SNP detection of the Ty1-Ty3 region Menda, N. 1, S. Strickler 1, D.M. Dunham 1, D.P. Maxwell 2, L.
de novo sequencing of the sunflower genome
de novo sequencing of the sunflower genome Stéphane Muños LIPM INRA Toulouse stephane.munos@toulouse.inra.fr @stephane_munos @SUNRISE_France 39 Sunflower, an important cropfor Europe Million tons of seed
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora Jerry Jenkins 1, Xiaohan Yang 2, Hengfu Yin 2, Gerald A. Tuskan 2, John C. Cushman 3, Won Cheol Yim 3, Jason
Sequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
Sequencing and assembly of the sheep genome reference sequence
Sequencing and assembly of the sheep genome reference sequence Yu Jiang Kunming Institute of Zoology, CAS, China the International Sheep Genomics Consortium (ISGC) ISGC Presentations Yu Jiang, Kunming
NGS 101 Panel Design and Quality. Adam Hauge Development Manager University of Minnesota Genomics Center
NGS 101 Panel Design and Quality Adam Hauge Development Manager University of Minnesota Genomics Center Disclaimer SureSelect products are research use only SureSelect has not been validated by Agilent
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
USWBSI Barley CP Milestone Matrix Updated
USWBSI Barley CP Milestone Matrix Updated 10-10-13 RA: Variety Development and Host Resistance (VDHR) CP Objective 2: Map Novel QTL for resistance to FHB in barley BS, KS Dec 2013 Make initial crosses
Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping
Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,
Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
Title: High-quality genome assembly of channel catfish, Ictalurus punctatus
Author s response to reviews Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Authors: Qiong Shi (shiqiong@genomics.cn) Xiaohui Chen (xhchenffri@hotmail.com) Liqiang Zhong (lqzhongffri@hotmail.com)
Get to Know Your DNA. Every Single Fragment.
HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS
The Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
Goat genome assembly, Availability of an international 50K SNP chip and RH panel: an update of the International Goat Genome Consortium projects
Goat genome assembly, Availability of an international 50K SNP chip and RH panel: an update of the International Goat Genome Consortium projects Gwenola Tosser-Klopp on behalf of IGGC Outline IGGC presentation
High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR
High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR Nils Stein, Joel Kuon, Uwe Scholz, Martin Mascher, Benjamin Kilian, Kerstin Neumann,
University of Michigan Eco-Driving Index (EDI) Latest data: August 2017
University of Michigan Eco-Driving Index () http://www.ecodrivingindex.org Latest data: August 2017 Developed and issued monthly by Michael Sivak and Brandon Schoettle Sustainable Worldwide Transportation
From the genome to the field : how to improve the isolation of genomic regions of interest for plant breeding.
From the genome to the field : how to improve the isolation of genomic regions of interest for plant breeding. Hélène BERGES Director of the French Plant Genomic Center INRA Toulouse The French Plant Genomic
Biol 478/595 Intro to Bioinformatics
Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12
Genome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA.
Genome Assembly Software for Different Technology Platforms PacBio Canu Falcon 10x SuperNova Illumina Soap Denovo Discovar Platinus MaSuRCA Experimental design using Illumina Platform Estimate genome size:
Contact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
Technologies, resources and tools for the exploitation of the sheep and goat genomes.
Technologies, resources and tools for the exploitation of the sheep and goat genomes. B. P. Dalrymple, G. Tosser-Klopp, N. Cockett, A. Archibald, W. Zhang and J. Kijas. The plan The current state of the
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
NGS-based innovations within the Leiden Network
NGS-based innovations within the Leiden Network A strong bridge between two partners Dr. Mark de Jong 2017-09-29 Design accurate and robust NGS tests and generate data sets essential for Diagnostics &
Anker P Sørensen Crop innovation through novel NGS applications
nker P Sørensen Crop innovation through novel NGS applications Session 1: NGS / Omic Technologies for Plant Research 19 e March 2015, Kuala Lumpur Malaysia KeyGene s corporate profile Wageningen NL Rockville
Sunday, June 24 8:00 am 6:00 pm: Registration open 9:00 am 5:30 pm: IWGSC workshop. 6:00 9:00 pm: ITMI-NWGC Reception on the Patio
Sunday, June 24 9:00 am 5:30 pm: IWGSC workshop Joint 22 nd ITMI Summer Workshop and 4 th U.S. National Wheat Genomics Workshop Ramada Plaza Suites and Conference Center, Fargo, North Dakota, USA June
De novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
Evogene - Bayer CropScience Multi-year Collaboration to Improve Wheat Seed. December 13, 2010
Evogene - Bayer CropScience Multi-year Collaboration to Improve Wheat Seed December 13, 2010 1 2 Agenda Evogene Bayer CropScience Collaboration Wheat Background Complementary Capabilities Create Opportunity
Genomics in the Barossa. ITMI Workshop 3rd Annual ACPFG Research Symposium.
ITMI Workshop 3rd Annual ACPFG Research Symposium www.acpfg.com.au 3rd Annual ACPFG Research Symposium The International Triticeae Mapping Initiative and the Australian Centre for Plant Functional Genomics
Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
Human genome sequence February, 2001
Computational Molecular Biology Symposium March 12 th, 2003 Carnegie Mellon University Organizer: Dannie Durand Sponsored by the Department of Biological Sciences and the Howard Hughes Medical Institute
Workflow of de novo assembly
Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:
Electric Forward Market Report
Mar-01 Mar-02 Jun-02 Sep-02 Dec-02 Mar-03 Jun-03 Sep-03 Dec-03 Mar-04 Jun-04 Sep-04 Dec-04 Mar-05 May-05 Aug-05 Nov-05 Feb-06 Jun-06 Sep-06 Dec-06 Mar-07 Jun-07 Sep-07 Dec-07 Apr-08 Jun-08 Sep-08 Dec-08
A high density GBS map of bread wheat and its application for genetic improvement of the crop
A high density GBS map of bread wheat and its application for genetic improvement of the crop Sukhwinder-Singh Wheat-Lead Seeds of Discovery (suk.singh@cgiar.org) International Maize and Wheat Improvement
Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.
Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after
Deep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
AP 2010 Biotechnologie-Bioressources
AP 2010 Biotechnologie-Bioressources Développer de nouvelles variétés de blé pour une agriculture durable: une approche intégrée de la génomique à la sélection Breeding for economically and environmentally
user s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
Administration Division Public Works Department Anchorage: Performance. Value. Results.
Administration Division Anchorage: Performance. Value. Results. Mission Provide administrative, budgetary, fiscal, and personnel support to ensure departmental compliance with Municipal policies and procedures,
Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010!
Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010! buell@msu.edu! 1 Whole Genome Shotgun Sequencing 2 New Technologies Revolutionize
Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]
![Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]](/thumbs/77/74807071.jpg "Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]")
1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make
Targeted resequencing
Targeted resequencing Sarah Calvo, Ph.D. Computational Biologist Vamsi Mootha laboratory Snapshots of Genome Wide Analysis in Human Disease (MPG), 4/20/2010 Vamsi Mootha, PI How can I assess a small genomic
CDASH Clinical Data Acquisition Standards Harmonization
CDISC Italian User Group Meeting 16 November 2007 CDASH Clinical Data Acquisition Standards Harmonization 1 Outline Background Organization Goals Timelinesand Process Review of progress Results Future
Matthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
Traffic Department Anchorage: Performance. Value. Results.
Traffic Department Anchorage: Performance. Value. Results. Mission Promote safe and efficient area-wide transportation that meets the needs of the community and the Anchorage Municipal Traffic Code requirements.
Waterlogging tolerance at germination in pea
Waterlogging tolerance at germination in pea Md Shahin Uz Zaman PhD Candidate School of Agriculture and Environment Professor William Erskine Dr Imran Malik Dr Parwinder Kaur Acknowledgements ACIAR UWA
From Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
The goal of this project was to prepare the DEUG contig which covers the
Prakash 1 Jaya Prakash Dr. Elgin, Dr. Shaffer Biology 434W 10 February 2017 Finishing of DEUG4927010 Abstract The goal of this project was to prepare the DEUG4927010 contig which covers the terminal 99,279
Barrie Bonsal, Elaine Wheaton, Virginia Wittrock, Evan Siemens, Nick Nicolichuk DRI Workshop, Winnipeg, May 11 th, 2010
Barrie Bonsal, Elaine Wheaton, Virginia Wittrock, Evan Siemens, Nick Nicolichuk DRI Workshop, Winnipeg, May 11 th, 2010 A preliminary analysis of the 2001 and 2002 drought years in Canada suggests the
OIT DIGITAL CHAT F E B R U A R Y 1 0,
OIT DIGITAL CHAT F E B R U A R Y 1 0, 2 0 1 7 AGENDA GT360 Update ITSM/ITIL Andrew Dietz OneIT Mark Juliano General Announcements Q&A GT360 UPDATE M A R K H O E T I N G GT360: LOOKING FORWARD GT360 Enterprise