Welcome to the Future: Global Wheat Genome Sequencing Efforts
|
|
|
- Gervase Hopkins
- 6 years ago
- Views:
Transcription
1 Welcome to the Future: Global Wheat Genome Sequencing Efforts Crop Development Centre Durum Wheat Breeding and Genetics Program Dr. Curtis J. Pozniak Use and/or distribution of these slides is prohibited unless approval by the author is granted
2 What Does a Wheat Genome Sequence Offer? Unlimited source of DNA markers for MAS/Genomic Selection Reduce the time and improve the success of resolving traits under complex genetic control Candidate genes for traits = perfect markers Discovery and exploitation of new alleles 2
3 A Wheat genome sequence large and complex! allohexaploid: three diploid-like (2n = 6x = 42) ~17Gb genome size; >75% repeat content Ta AA Ta BB Ta DD K. Mayer
4 The IWGSC WGA Project: Chinese Spring IWGSC coordinated: led by Nils Stein, Curtis Pozniak, Jesse Poland with NRGene and Illumina Whole genome shotgun with Illumina technology: pair end and mate pair libraries (>250x coverage). Scaffolds anchored to a high-density genetic map, and merged into superscaffolds using Chromosome conformation capture (Hi-C ).
5 The IWGSC WGA Project: Chinese Spring V Gb assembled 50% of the assembly into 566 scaffolds, > 7.4 Mb
6 The IWGSC WGA Project: Chinese Spring V0.2- Analysis of Genic / Intergenic Space >97% of the CSS coding exons are present on a single scaffold >98% of ISBP markers map to the IWGSC-WGA IWGSC-CSS Gene Models TE junction-based markers 93,553 * Gene Models 62,631 ISBP Markers Chrom 1B. Full length 1 Scaffold Partial Sequence >1 Scaffold Missing Genes *99% identity, 90% coverage Mapped ISBPs Unmapped ISBPs
7 Phase 3 Phase 2 Phase 1 Towards V1.0 - An Integrated Approach Nov: Sequencing Dec: v0.1 Jan: v0.2 Illumnia generated (200X) PE and MP data and NRGene Assembly pipline. Quality Control Build 21 pseudomolecules HiC 96% anchored Genetic Maps - GBS June: v0.4 public November: Annotation 2017: Publication/ Public Improvement, data integration Superscaffolding Gap Filling BACseq WGP tags Physical maps Bionano maps RH maps Automated/Manual Curation -RNASeq, ISOSeq
8 A Post-Genome Sequence Era
9 Other Wheat Genome Sequences Diploid --- Tetraploid Hexaploid Parameter Ae. tauschii (DD) Wild emmer Zavitan (AABB) Durum Wheat Svevo (AABB) Chinese Spring Bread Wheat (AABBDD) Canadian Bread Wheat (AABBDD) Canadian Bread Wheat (AABBDD) Fold coverage x200 x180 x210 X X 200X Scaffold L50 (No. of scaffolds) Scaffold L90 (No. of scaffolds) Total assembly size Unfilled gaps (=n) 11.4 Mbp (106) 2.27 Mbp (405) 4.09 Gbp 7.0 Mbp (414) 1.15 Mbp (1,827) Gbp 6.0 Mbp (493) 1 Mbp (2,013) Gbp 7.1 Mbp (566) 1.26 Mbp (2,363) Gbp 5.9Mbp (721) 1.1Mbp (2,879) 14.44Gbp 5.1Mbp (796) 1Mbp (3,194) Gbp 1.39% 1.63% 1.42% 1.80% 1.92% 1.64% 2015 All rights reserved to Energin.R Technologies 2009 Ltd
10 Towards a Wheat Pan Genome Country No. Committed Canada 2 Germany 1 USA 1(2) China 2 Switerland (1) Australia 2 TOTAL 8 (3)
11 SEQUENCE OF TWO CANADIAN WHEAT CULTIVARS Allelic diversity, founders, lines carrying high-priority genes, No IP concerns CDC Stanley CDC Teal//EE8/Kenyon35//AC Barrie CDC Landmark Unity/Waskada//Alsen/Superb Fhb1 Sm1 SSt1 Oviposition deterrence CDC Landmark USA-derived EE8= VPM-1 2N Introgression CDC Stanley VPM-1= Aegilops ventricosa/triticum persicum (T. turgidum var. carthlicum)//3* Marne (T. aestivum)
12 V0.1 assemblies
13 Summary of V0.1 Assemblies CDC Stanley CDC Landmark Chrom Mbp # scaffolds %oriented Mbp # scaffolds %oriented 1A % % 1B % % 1D % (3% 2A % % 2B % % 2D % % 3A % % 3B % % 3D % % 4A % % 4B % % 4D % % 5A % % 5B % % 5D % % 6A % % 6B % % 6D % % 7A % % 7B % % 7D % %
14 CDC Stanley 2N Introgression in CDC Stanley 20 Mbp Lr37, Yr17, Sr38, Cre5 CDC Landmark Cruz et al The 2NS Translocation from Aegilops ventricosa Confers Resistance to the Triticum Pathotype of Magnaporthe oryzae Crop Sci., Vol. 56 No. 3, p
15 How are we using these Sequences? Cloning of the SSt1 locus Saint Pierre et al. 2010; Functional Plant Biology, 37, 166.
16 Stem Solidness Score Large phenotypic variation for pith expression is evident in both hexaploid and tetraploid wheat Hexaploid Wheat Tetraploid Wheat MT1016 Choteau Duclair Lillian AC Eatonia Mckenzie Unity Glenlea AC Barrie
17 QTL analysis suggests a common genetic mechanism between hexaploid and tetraploid wheat HEXAPLOID TETRAPLOID barc77 Xgwm114 Controlled by several genes with one gene exerting a major effect Xgwm Controlled by a single dominant gene in durum wheat SSt1 Expression influenced by environment Xgwm547 SSt1 Little environmental influence on expression 6.9 *Cook et al.(2004) Crop Sci. 44:1397 Xgwm247 Xgwm Xgwm247 Xgwm340 Xgwm181 *Houshmand et al. (2007) Mol Breeding 20:261
18 High Density Genetic Mapping Confirms Collinear Relationship of SSt1 3B-KxW 3B-Consensus Durum Wheat 3B-wangconsensus 3B-LxV Hexaploid Wheat gwm114 Tdurum_contig97388_456 Tdurum_contig83096_345 Tdurum_contig47292_309 BS _51 Kukri_c21041_263 BobWhite_c2486_239 Tdurum_contig31097_254 RAC875_c13406_65 RAC875_c35955_210 Tdurum_contig72057_254 RAC875_c13406_329 RAC875_c3417_405 BS _51 Kukri_c38065_217 Tdurum_contig42150_3198 Tdurum_contig42150_3440 Kukri_c37097_1849 Kukri_c37097_1791 Tdurum_contig12530_278 Tdurum_contig42150_3190 Tdurum_contig100787_79 Tdurum_contig51355_470 wsnp_rfl_contig3524_ BS _51 Tdurum_contig51355_601 Tdurum_contig51355_456 BS _51 Tdurum_contig93524_791 RAC875_c13425_393 Excalibur_c45326_479 Jagger_c3814_160 BS _51 tplb0048c20_2437 wsnp_ku_c35632_ RAC875_c5222_290 Excalibur_c29314_719 RAC875_c48860_106 RAC875_c58399_104 Kukri_c86043_197 TA TA EK_ EK_ BF200774R SSt Tdurum_contig47292_302 Tdurum_contig97388_456 BS _51 Tdurum_contig47292_309 Tdurum_contig83096_345 RAC875_c35955_210 BobWhite_c2486_239 Kukri_c21041_263 RAC875_c13406_65 RAC875_c13406_329 Tdurum_contig31097_254 Tdurum_contig72057_254 Kukri_c9895_1325 Tdurum_contig12530_278 Kukri_c37097_1791 Kukri_c37097_1849 Excalibur_c63009_102 RAC875_c56516_786 Tdurum_contig42150_3198 Kukri_c38065_217 IWB48069b BS _51 Tdurum_contig42150_3190 RAC875_c3417_405 Tdurum_contig42150_3440 Cap3_ B wsnp_be444579b_ta_2_2 Excalibur_c55096_613 wsnp_be444579b_ta_2_1 RAC875_c14830_305 BS _51 RAC875_c26839_63 RAC875_c15873_273 Kukri_c50837_251 Kukri_c23354_369 BS _51 BS _51 Kukri_rep_c103205_101 BS _51 BS _51 Excalibur_c4417_823 Tdurum_contig100787_79 BS _51 Kukri_c45513_83 RAC875_c13256_1359 BS _51 Kukri_c89530_189 Kukri_c42197_634 Excalibur_c63859_401 Excalibur_c63859_285 Kukri_rep_c107896_90 Jagger_c3292_145 Ra_c106454_621 Kukri_c39915_386 Kukri_c39915_340 Kukri_rep_c92293_249 Tdurum_contig51355_456 Tdurum_contig51355_470 wsnp_rfl_contig3524_ TA BS _51 Tdurum_contig51355_601 Kukri_c7860_911 BS _51 GENE-4458_709 Kukri_c19331_440 Excalibur_c766_705 Kukri_c4230_398 Kukri_c28747_790 D_GDRF1KQ02HMMTS_315 RAC875_c32864_205 RAC875_c53037_181 wsnp_ex_c16569_ GENE-1925_447 GENE-1925_118 Excalibur_c45326_479 RAC875_c13425_393 Jagger_c3814_160 Tdurum_contig93524_791 Kukri_c60556_132 Kukri_c60556_155 BS _51 usw66_psp3001 EI_05_46657 Excalibur_c4803_830 Excalibur_c16569_535 wsnp_ex_c16569_ Tdurum_contig10458_140 IWB11049a BS _51 BobWhite_c45118_495 BS _51 Kukri_rep_c110544_52 Excalibur_c52023_321 Kukri_rep_c110544_497 Excalibur_c20309_539 Kukri_c49220_167 BobWhite_c11000_806 Kukri_rep_c110544_248 RAC875_c2106_882 wsnp_ex_c12369_ RAC875_c33083_451 BobWhite_c11000_1049 RAC875_c5222_290 wsnp_ex_c45877_ tplb0048c20_2437 BS _51 Kukri_c60447_186 wsnp_ex_c45877_ Excalibur_c212_1553 Excalibur_c30013_580 wsnp_ku_c35632_ RAC875_c37741_476 RAC875_c37741_218 Kukri_c11944_436 Kukri_rep_c114164_106 GENE-1925_310 IWB11049b Kukri_rep_c106948_103 Kukri_c29615_377 Excalibur_c23620_167 RAC875_c58399_104 Kukri_c11944_2358 RAC875_c5222_245 D_GBF1XID01AKUNX_151 Excalibur_c23620_560 RAC875_c5222_411 RAC875_c48860_106 Excalibur_c29314_719 Kukri_rep_c106027_464 TA BobWhite_c9277_295 wsnp_ex_c13284_ BS _51 BobWhite_rep_c58425_117 BobWhite_rep_c49306_196 BS _51 Tdurum_contig43646_147 BS _51 BS _51 Kukri_c48601_98 wsnp_ra_rep_c75740_ Excalibur_c6906_2385 Kukri_c2164_1856 IAAV1595 IAAV8659 BS _51 RFL_Contig3495_534 tplb0021f23_738 wsnp_ku_c2562_ Kukri_c32139_2473 BobWhite_rep_c50492_500 Excalibur_c10508_1597 gwm247-3b wsnp_ex_c16569_ Kukri_c29615_377 BobWhite_c45118_495 Excalibur_c23620_560 Excalibur_c16569_535 BS _51 BS _51 TA RAC875_c5222_245 RAC875_c37741_218 Kukri_c11944_2358 GENE-1925_118 GENE-1618_780 RAC875_rep_c105727_262 BS _51 BS _51 wsnp_jd_c18509_ Tdurum_contig59566_4435 Tdurum_contig59566_2309 Tdurum_contig59566_1534 Tdurum_contig51605_194 Tdurum_contig42131_1300 Tdurum_contig10458_460 Tdurum_contig10458_140 TA RAC875_c5222_411 RAC875_c37741_476 Kukri_rep_c106027_464 Kukri_c55981_194 Kukri_c38174_656 Kukri_c11944_1316 Ku_c25527_773 GENE-1925_447 Excalibur_c4803_830 BobWhite_c11000_1049 BS _51 wsnp_ex_c13284_ BobWhite_rep_c58425_117 Tdurum_contig51605_857 Tdurum_contig51605_542 Tdurum_contig11114_335 Kukri_rep_c71747_150 Kukri_c2164_1856 BS _51 BS _51 BS _51 wsnp_ku_c2562_ Ra_c9347_163 BS _51 BS _51 wsnp_ra_rep_c75740_ BS _51 BS _51 tplb0021f23_738 tplb0021f23_305 TA RFL_Contig3495_534 RAC875_c61824_194 BS _51 RAC875_c48860_106 BobWhite_s64174_52 Kukri_rep_c106948_103 BobWhite_rep_c50492_500 Kukri_c48601_98 Kukri_c40275_229 IAAV8659 IAAV1595 GENE-2885_304 GENE-1910_358 Excalibur_c76695_71 Excalibur_c6906_2385 Excalibur_c3821_893 Excalibur_c212_1553 Excalibur_c16569_765 D_GDEEGVY02F0MHM_250 BS _51 BS _51 BS _51 BS _51 BS _51 BS _51 BS _51 Ku_c2164_ BobWhite_c45118_495 wsnp_ex_c16569_ Excalibur_c16569_535 BS _51 BS _51 Tdurum_contig10408_1548 Tdurum_contig59566_2309 wsnp_jd_c18509_ Tdurum_contig59566_1534 Tdurum_contig59566_4435 Kukri_c55981_194 GENE-1910_358 Kukri_rep_c71747_150 TA Kukri_c29615_377 BS _51 BS _51 BobWhite_c8852_62 BS _51 wsnp_ex_c13284_ BS _51 Excalibur_c29314_719 BobWhite_rep_c58425_117 BS _51 TA BobWhite_rep_c50492_500 Kukri_c2164_1856 Kukri_c32139_2473 BS _51 BS _51 Kukri_c11944_2358 RAC875_c48860_106 RAC875_c5222_245 RAC875_c37741_218 wsnp_ku_c2562_ Ku_c25527_773 Kukri_c11944_1316 BobWhite_s64174_52 RAC875_c37741_476 Tdurum_contig31375_374 GENE-1925_447
19 Fine mapping of SSt1 in tetraploid wheat reveals a 0.48 Mb interval on 3B 1
20 The solid stem phenotype is associated with active cell division in stem internodes of tetraploid wheat RNASeq for Pith Expression Solid Hollow 10 cultivars 3 biological replications
21 Kofa vs Dt570 Kofa vs W9262 Kofa vs LGB3B Kofa vs Lillian Vesper vs Dt570 Vesper vs W9262 Vesper vs LGB3B Vesper vs Lillian LDN vs Dt570 LDN vs W9262 LDN vs LGB3B LDN vs Lillian 2324 vs Dt570 RNASeq of Pith Expression in durum and hexaploid wheat Mutant Family 6 differentially expressed genes between M and CDC Fortitude on 3B Only 1 (DOF-ZF) is consistently upregulated in solids vs. hollows Gene Log2 Fold Change undescribed protein S ribosomal protein S S ribosomal protein S19 5 unknown function 4.6 Very-long-chain (3R)-3- hydroxyacyl-coa dehydratase DOF zinc finger protein undescribed protein 30S ribosomal protein S17 30S ribosomal protein S19 unknown function Very-long-chain (3R)-3- hydroxyacyl- CoA dehydratase 2 DOF zinc finger protein 2
22 CDC Landmark CDC Landmark CDC Landmark (SSt1+) shows poor sequence similarity in the SSt1 fine mapping interval on Chrom. 3B Region of poor sequence alignment Region of poor sequence alignment DOF ZF Gene Region of poor sequence alignment Deletion in CDC Stanley? Is this responsible for the phenotype? Chinese Spring ta3b* *Choulet et al Science Jul 18;345(6194): CDC Stanley
23 CDC Landmark (Sm1+) CDC Landmark (Sm1+) shows low homology to CDC Stanley in the Sm1 Interval on Chrom. 2BS 2BS Sm Sm CDC Stanley (Sm1-) Kassa et al. 2016
24 Summary In 1 year multiple genome sequences at all ploidy levels IWGSC - Chinese Spring Gold Standard will pave the way to understand the pan genome in wheat support gene cloning/marker discovery Preliminary evidence (ie V0.1) suggests 5-6% of the genes are absent in one Canadain cultivar, but present in another. Functional gene annotation is the next bottle neck 24
25 Acknowledgments Pierre Hucl Kirby Nilsen Aron Cory Sean Walkowiak Nils Stein* Martin Mascher* Jesse Poland* Kellye Eversole* Jane Rogers* Andrew Sharpe* Kevin Koh Fred Choulet* Gabriel Keenle-Gagnere* Richard Cuthbert Ron Knox Colin Hiebert Harpinder Randhawa Yuefeng Ruan Brain Beres Curt McCartney Rob Graf Assaf Distelfeld* Gary Muehlbauer* Raju Datla Sateesh Kagale Gil Ronen Mike Thompson* *PI of IWGSC-led WGA v0.2 Alvaro Hernandez*
26 Thanks to our Funders
Utilization of the IWGSC Resources: Application to Wheat Breeding
Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these
Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds.
Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds. Kellye Eversole IWGSC Executive Director Plant Genomics and Gene Editing Congress Amsterdam,
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO Luigi Cattivelli, The International Durum Wheat Genome Sequencing Consortium 31/01/2017 1 Durum wheat Durum wheat with a total production of about
Excerpts from a Seminar at Bayer CropScience February 2015
Excerpts from a Seminar at Bayer CropScience February 2015 Kellye Eversole IWGSC Executive Director Seminar Ghent, Belgium 12 February 2015 Update on the International Wheat Genome Sequencing Consortium
MAGIC wheat Multi-parent populations for the genetic dissection of agronomic traits
MAGIC wheat Multi-parent populations for the genetic dissection of agronomic traits Alison Bentley, R Horsnell, P Howell, N Gosman, R Howells, G Rose, T Barber, J Cockram, A Greenland and I Mackay The
The international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director ACPFG Seminar University of Adelaide 1st May 2014 The International Wheat Genome Sequencing
Identifying and exploiting natural variation
Identifying and exploiting natural variation New methods of fine mapping: association mapping MAGIC Methods for increasing diversity: synthetic wheat Advantages of new methods for fine mapping More efficient
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
A Whole Genome Assembly of Rye (Secale cereale)
A Whole Genome Assembly of Rye (Secale cereale) M. Timothy Rabanus-Wallace Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Why rye? QTL analysis for Survival After Winter (SAW) scores
FHB Resistance in Durum -Progress and Challenge
FHB Resistance in Durum -Progress and Challenge Elias Elias, Shahryar Kianian, Shaobin Zhong, and Xiwen Cai North Dakota State University, Fargo, ND Steven Xu USDA-ARS, Fargo, ND Outline Sources of resistance
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ)
Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ) Martin Mascher IPK Gatersleben PAG XXII January 14, 2012 slide 1 Proof-of-principle in barley Diploid model for wheat 5 Gb
Structure and Dynamics of the Hexaploid Wheat Genome
TGAC 2016 March 30 th Structure and Dynamics of the Hexaploid Wheat Genome Frédéric CHOULET Genetics Diversity Ecophysiology of Cereals INRA U. Clermont-Ferrand, France Structure, evolution of wheat genome
Improving barley and wheat germplasm for changing environments
AWARD NUMBER: 2011-68002-30029 Improving barley and wheat germplasm for changing environments Triticeae CAP (T-CAP) 56 participants, 28 institutions, 21 states Integration of wheat and barley research
Analysis of QTL for High Grain Protein Content in Canadian Durum Wheat
Analysis of QTL for High Grain Protein Content in Canadian Durum Wheat Suprayogi 1, C.J. Pozniak 1, J.M. Clarke 2, F.R. Clarke2 and R.E. Knox 2 1 Dept. of Plant Science and Crop Development Centre, University
Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.
Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after
Durum Wheat Genomics and Breeding EWG Annual report and action plan
Coordinating global research for wheat Durum Wheat Genomics and Breeding EWG Annual report and action plan NAME OF EXPERT WORKING GROUP EWG on DURUM WHEAT GENOMICS AND BREEDING LEADERSHIP & AUTHORSHIP
Functional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group
Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated
The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience
Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk
Determination of solid stem gene location of durum wheat using double haploid and recombinant inbred line populations
Proceedings of The Fourth International Iran & Russia Conference 148 Determination of solid stem gene location of durum wheat using double haploid and recombinant inbred line populations Saadollah Houshmand
A high density GBS map of bread wheat and its application for genetic improvement of the crop
A high density GBS map of bread wheat and its application for genetic improvement of the crop Sukhwinder-Singh Wheat-Lead Seeds of Discovery (suk.singh@cgiar.org) International Maize and Wheat Improvement
The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$
The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$ Kellye$A.$Eversole! IWGSC!Execu,ve!Director! &$ The$IWGSC$ Wheat$Breeding$2014:$$Tools,$Targets,$&$Progress$ Harpenden,$United$Kingdom$
Wheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes
Wheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes Prospects in Wheat Genomics -- what is needed from a research perspective Rudi Appels,
NGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
Cereal endosperm; lessons learnt from molecular biology, cell biology, genomics and transcriptomics analysis.
Cereal endosperm; lessons learnt from molecular biology, cell biology, genomics and transcriptomics analysis. Odd-Arne Olsen Department of plant sciences Norwegian university of life sciences The cereal
Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan
Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan Yasunari Ogihara 1, Kanako Kawaura 1, Shuhei Nasuda 2, Takashi R. Endo 2, Katsuyuki Hayakawa 3, Jaroslav Dolezel 4,Hirokazu Handa
Wheat Chromosome Engineering and Breeding Jianli Chen
Wheat Chromosome Engineering and Breeding Jianli Chen Chromosome Engineering A process to transfer favorable alleles through inter-specific hybridization and interchange of chromatin using aneupolids Aneuploids?
Designing Future Wheat A coordinated UK wheat programme
Designing Future Wheat A coordinated UK wheat programme The emergence of modern wheat has left a trail of untapped variation for UK agriculture Modern varieties Artificial selection Wild relatives Triticum
Registration of a hard red winter wheat genetic stock homozygous for ph1b for facilitating alien introgression for crop improvement
This is the author s final, peer-reviewed manuscript as accepted for publication. The publisher-formatted version may be available through the publisher s web site or your institution s library. Registration
Wide Hybridization in Plant Breeding
Wide Hybridization in Plant Breeding Wide hybridization - a cross of two individuals belonging to different species (also called interspecific hybridization) - Such a cross can be (rarely) realized in
Synthetic wheat. an underutilized genetic resource in Nordic wheat breeding. Morten Lillemo, IPM, UMB
an underutilized genetic resource in Nordic wheat breeding Morten Lillemo, IPM, UMB 2111 2005 Wheat evolution There is a huge genetic diversity in Ae. tauschii Genetic diversity of bread wheat is low,
Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics
Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014
Sequence-based assembly of chromosome 7A and comparison to diploid progenitors
Sequence-based assembly of chromosome 7A and comparison to diploid progenitors Gabriel Keeble-Gagnere1 J Nystrom-Persson1, C Cavanagh2, D Fleury3, H Webster1, R Appels1 1 Veterinary and Life Sciences,
Triticeae Gene Nomenclature
A Wheat Initiative workshop Triticeae Gene Nomenclature 11-13 October 2016, Munich (Germany) Report 1 Background A number of high quality genome sequences have been completed in recent years for species
Analysis of the expression of homoeologous genes in polyploid cereals using fluorescence cdna-sscp
Analysis of the expression of homoeologous genes in polyploid cereals using fluorescence cdna-sscp De Bustos A., Perez R., Jouve N. in Molina-Cano J.L. (ed.), Christou P. (ed.), Graner A. (ed.), Hammer
Discovery and development of exome-based, co-dominant single nucleotide polymorphism markers in hexaploid wheat (Triticum aestivum L.
Application note GAPP-0001 Discovery and development of exome-based, co-dominant single nucleotide polymorphism markers in hexaploid wheat (Triticum aestivum L.) Keith J. Edwards, University of Bristol,
Plant Science into Practice: the Pre-Breeding Revolution
Plant Science into Practice: the Pre-Breeding Revolution Alison Bentley, Ian Mackay, Richard Horsnell, Phil Howell & Emma Wallington @AlisonRBentley NIAB is active at every point of the crop improvement
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*
Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato
Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Sanjeev K Sharma Cell and Molecular Sciences The 3 rd Plant Genomics Congress, London 12 th May 2015 Potato
USWBSI Barley CP Milestone Matrix Updated
USWBSI Barley CP Milestone Matrix Updated 10-10-13 RA: Variety Development and Host Resistance (VDHR) CP Objective 2: Map Novel QTL for resistance to FHB in barley BS, KS Dec 2013 Make initial crosses
TABLE OF CONTENTS. SECTION 01 The History of Wheat Breeding in Canada. SECTION 04 The Team. SECTION 05 Funding Support. SECTION 02 Project Overview
TABLE OF CONTENTS SECTION 01 The History of Wheat Breeding in Canada SECTION 04 The Team SECTION 02 Project Overview SECTION 05 Funding Support SECTION 03 Benefits of Plant Breeding SECTION 06 Future of
Chapter 11 Development of the BAC Physical Maps of Wheat Chromosome 6B for Its Genomic Sequencing
Chapter 11 Development of the BAC Physical Maps of Wheat Chromosome 6B for Its Genomic Sequencing Fuminori Kobayashi, Satoshi Katagiri, Wataru Karasawa, Yumiko Hanawa, Hiroyuki Kanamori, Yukiyo Ito, Hiroko
Whole genome sequencing in the UK Biobank
Whole genome sequencing in the UK Biobank Part of the UK Government s Industrial Strategy Challenge Fund (ISCF) for the Data to Early Diagnosis and Precision Medicine initiative Aim to produce deep characterisation
Mapping by sequencing in complex polyploid genomes using genic sequence capture: a case study to map yellow rust resistance in hexaploid wheat
Mapping by sequencing in complex polyploid genomes using genic sequence capture: a case study to map yellow rust resistance in hexaploid wheat Article Published Version Creative Commons: Attribution 4.0
Identifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
Strength in Numbers: Resistance Gene Cassettes for Durable Disease Control in Cereals
Strength in Numbers: Resistance Gene Cassettes for Durable Disease Control in Cereals Brian J. Steffenson Department of Plant Pathology University of Minnesota St. Paul 42 nd Barley Improvement Conference
Conifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 2 Genes, Genomes, and Mendel Nicholas Wheeler & David Harry
CHAPTER 14 Genetics and Propagation
CHAPTER 14 Genetics and Propagation BASIC GENETIC CONCEPTS IN PLANT SCIENCE The plants we cultivate for our survival and pleasure all originated from wild plants. However, most of our domesticated plants
Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach
Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach Hélène BERGES Director of the Plant Genomic Center Global warming effects,
This is a closed book, closed note exam. No calculators, phones or any electronic device are allowed.
MCB 104 MIDTERM #2 October 23, 2013 ***IMPORTANT REMINDERS*** Print your name and ID# on every page of the exam. You will lose 0.5 point/page if you forget to do this. Name KEY If you need more space than
Glu-1 AND Glu-3 ALLELIC VARIABILITY OF GENUS Triticum GENETIC RESOURCES IN WHEAT BREEDING
Glu-1 AND Glu-3 ALLELIC VARIABILITY OF GENUS Triticum GENETIC RESOURCES IN WHEAT BREEDING D. OBREHT, M. DAVIDOVIC, Lj. VAPA University of Novi Sad, Faculty of Natural Sciences and Mathematics, 21000 Novi
Using LTC Software for Physical Mapping and Assisting in Sequence Assembly
Using LTC Software for Physical Mapping and Assisting in Sequence Assembly Z. Frenkel, V. Glikson, A. Korol Institute of Evolution, University of Haifa See also poster P1194 PAGXXIII, San Diego, January
Whole-genome profiling and shotgun sequencing delivers an anchored, gene-decorated, physical map assembly of bread wheat chromosome 6A
The Plant Journal (2014) 79, 334 347 doi: 10.1111/tpj.12550 TECHNICAL ADVANCE Whole-genome profiling and shotgun sequencing delivers an anchored, gene-decorated, physical map assembly of bread wheat chromosome
A single meiotic gene, ZIP4, is responsible for the Ph1 locus effect on recombination. Azahara C. Martín John Innes Centre, Norwich, UK
A single meiotic gene, ZIP4, is responsible for the Ph1 locus effect on recombination Azahara C. Martín John Innes Centre, Norwich, UK How to make a better use of the genetic variability within crop species
Supplementary Data 1.
Supplementary Data 1. Evaluation of the effects of number of F2 progeny to be bulked (n) and average sequencing coverage (depth) of the genome (G) on the levels of false positive SNPs (SNP index = 1).
Chapter 22 Next Generation Sequencing Enabled Genetics in Hexaploid Wheat
Chapter 22 Next Generation Sequencing Enabled Genetics in Hexaploid Wheat Ricardo H. Ramirez-Gonzalez, Vanesa Segovia, Nicholas Bird, Mario Caccamo, and Cristobal Uauy Abstract Next Generation Sequencing
The tomato genome re-seq project
The tomato genome re-seq project http://www.tomatogenome.net 5 February 2013, Richard Finkers & Sjaak van Heusden Rationale Genetic diversity in commercial tomato germplasm relatively narrow Unexploited
SNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
Association Mapping in Wheat: Issues and Trends
Association Mapping in Wheat: Issues and Trends Dr. Pawan L. Kulwal Mahatma Phule Agricultural University, Rahuri-413 722 (MS), India Contents Status of AM studies in wheat Comparison with other important
Rust Resistance Gene Cloning
University of Minnesota Rust Resistance Gene Cloning perfect markers and cassette development Peter Dodds BGRI technical workshop March 2014 Outlook: R gene pyramids via GM gene cassettes Stacking of multiple
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Céline CHANTRY-DARMON 1 CNRGV The French Plant Genomic Center Created
Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
GBS Usage Cases: Non-model Organisms. Katie E. Hyma, PhD Bioinformatics Core Institute for Genomic Diversity Cornell University
GBS Usage Cases: Non-model Organisms Katie E. Hyma, PhD Bioinformatics Core Institute for Genomic Diversity Cornell University Q: How many SNPs will I get? A: 42. What question do you really want to ask?
The carotenoid biosynthetic and catabolic genes in wheat and their association with yellow pigments
Colasuonno et al. BMC Genomics (2017) 18:122 DOI 10.1186/s12864-016-3395-6 RESEARCH ARTICLE The carotenoid biosynthetic and catabolic genes in wheat and their association with yellow pigments Pasqualina
DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing
TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence
High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae
High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae within the powdery mildew resistance locus QPm.tut-4A Miroslav Valárik Institute of Experimental
Map-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
Chapter 32 Enlargement of the Genetic Diversity for Grain Quality in Bread Wheat Through Alien Introgression
Chapter 32 Enlargement of the Genetic Diversity for Grain Quality in Bread Wheat Through Alien Introgression Tatyana A. Pshenichnikova, Alexander V. Simonov, Ludmila V. Shchukina, Evgeniya V. Morozova,
Statistical Methods for Quantitative Trait Loci (QTL) Mapping
Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
GDMS Templates Documentation GDMS Templates Release 1.0
GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..
Molecular and Phenotypic Characterization of Advanced Backcross Lines Derived from Interspecific Hybridization of Durum Wheat
Biotechnology & Biotechnological Equipment ISSN: 1310-2818 (Print) 1314-3530 (Online) Journal homepage: https://www.tandfonline.com/loi/tbeq20 Molecular and Phenotypic Characterization of Advanced Backcross
Improving yield and quality traits of durum wheat by introgressing chromosome segments from hexaploid wheat
Improving yield and quality traits of durum wheat by introgressing chromosome segments from hexaploid wheat J. Ma 1,3 *, C.Y. Zhang 2 *, G.J. Yan 2,3 and C.J. Liu 1,2,3 1 Plant Industry, CSIRO, Brisbane,
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
Wheat pre-breeding at NIAB: from germplasm to genomics. Alison Bentley
Wheat pre-breeding at NIAB: from germplasm to genomics Alison Bentley NIAB wheat pre-breeding 1. Flowering time 2. Re-synthesis 3. MAGIC 4. Mapping/GS @AlisonRBentley @NIABTAG NIAB wheat pre-breeding 1.
Evolutionary Genetics: Part 1 Polymorphism in DNA
Evolutionary Genetics: Part 1 Polymorphism in DNA S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Color code Color code: Red = Important result or definition
Towards Personal Genomics
Towards Personal Genomics Tools for Navigating the Genome of an Individual Saul A. Kravitz J. Craig Venter Institute Rockville, MD Bio-IT World 2008 Introduce yourself Relate our experience with individual
Recombinant DNA Libraries and Forensics
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 A. Library construction Recombinant DNA Libraries and Forensics Recitation Section 18 Answer Key April 13-14, 2005 Recall that earlier
Bio5488 Practice Midterm (2018) 1. Next-gen sequencing
1. Next-gen sequencing 1. You have found a new strain of yeast that makes fantastic wine. You d like to sequence this strain to ascertain the differences from S. cerevisiae. To accurately call a base pair,
Triticeae genome MIPS PlantsDB. Manuel Spannagl transplant workshop Versailles Nov 2012
Triticeae genome resources @ MIPS PlantsDB Manuel Spannagl transplant workshop Versailles Nov 2012 What is MIPS PlantsDB? Generic database schema+system for the integration, management and (comparative)
100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES
Nanopore Community Meeting 2018 100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES Michael Schatz Johns Hopkins University, Baltimore, MD @mike_schatz @NanoporeConf #NanoporeConf
Enzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
Genetics or Genomics?
Genetics or Genomics? genetics: study single genes or a few genes first identify mutant organism with change of interest characterize effects of mutation but only a fraction of 30k human genes directly
Chapter 15 The Human Genome Project and Genomics. Chapter 15 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning
Chapter 15 The Human Genome Project and Genomics Genomics Is the study of all genes in a genome Relies on interconnected databases and software to analyze sequenced genomes and to identify genes Impacts
Before starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s) 7/26/2017
USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, 2017 Cover Page Principle Investigator (PI): Guihua Bai Institution: USDA-ARS E-mail: gbai@ksu.edu Phone:
Climate change and the estate. the opportunities for science and technology May 2015
Climate change and the estate the opportunities for science and technology May 2015 Gregor Johann Mendel (1822 1884) History John Innes Horticultural Institute 1910 Impact - wheat Wheat dependence Wheat
Single cell genomic sequencing in plants: current possibilities and limitations
Single cell genomic sequencing in plants: current possibilities and limitations Sateesh Kagale December 2015 Canola Innovation Day Genomic sequencing one cell as a time Genome Information by organism The
Add 2016 GBS Poster As Slide One
Add 2016 GBS Poster As Slide One GBS Adapters and Enzymes Barcode Adapter P1 Sticky Ends Common Adapter P2 Illumina Sequencing Primer 2 Barcode (4 8 bp) Restriction Enzymes Illumina Sequencing Primer 1
Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1
Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1 Barbara Steiner, Simone Zimmerl, Marc Lemmens, Gerhard Adam, Bradley Till, Wolfgang
PROJECT CODE BRE1010
1 TITLE Implementation of Markers for Pulses (imap) PROJECT CODE BRE1010 INVESTIGATORS Co-Principal Investigators: Bunyamin Tar an and Kirstin Bett, Department of Plant Sciences, University of Saskatchewan
Genome sequencing in Senecio squalidus
Genome sequencing in Senecio squalidus Outline of project A new NERC funded grant, the genomic basis of adaptation and species divergence in Senecio in collaboration with Richard Abbott and Dmitry Filatov
Current Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding
Current Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding Hermann Buerstmayr, Barbara Steiner, Marc Lemmens BOKU-University of Natural Resources
Genome evolution on the allotetraploid Xenopus laevis
Genome evolution on the allotetraploid Xenopus laevis Taejoon Kwon Department of Biomedical Engineering, School of Life Sciences Ulsan National Institute of Science & Technology (UNIST) Xenopus Bioinformatics
Nature Biotechnology: doi: /nbt.3943
Supplementary Figure 1. Distribution of sequence depth across the bacterial artificial chromosomes (BACs). The x-axis denotes the sequencing depth (X) of each BAC and y-axis denotes the number of BACs
RNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS