The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$
|
|
- Georgia Lawson
- 6 years ago
- Views:
Transcription
1 The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$ Kellye$A.$Eversole! IWGSC!Execu,ve!Director! &$ The$IWGSC$ Wheat$Breeding$2014:$$Tools,$Targets,$&$Progress$ Harpenden,$United$Kingdom$ 29$January$2014$ The!Interna,onal!Wheat!Genome!Sequencing! Consor,um! Launched)in)2005)on)the)ini0a0ve)of)Kansas)Growers)) CoMchairs$ R.$Appels$ J.$Dvorak$ C.$Feuillet$ B.$Gill$ B.$Keller$ Y.$Ogihara$ Execu,ve!director! K.$Eversole$ General!members!! Coordina,ng! Commi:ee! Sponsors!
2 Why! Vision! Lay!a!founda,on!to!accelerate!wheat!improvement! Increase!profitability!throughout!the!industry! High!quality!annotated!genome!sequence,! comparable!to!rice!genome!sequence! Physical!mapJbased,!integrated!and!ordered! sequence! $Wheat$Improvement$is$Complex!! Yield potential and yield stability! Adaptation to climate change! Durable resistance to biotic stress! Quality of grain and co-products
3 Training, capacity building -> expertise and critical mass Complexity!Requires!an!Integrated!Toolbox! Improved wheat varieties Managing!the!17!Gb,!Hexaploid!Genome! AA BB Triticum aestivum (2n = 6x = 42) 1C ~ 17,000 Mbp DD Dissection of the genome into single chromosomes (arms) Sheath fluid D Flow chamber Fluorescence emission Laser Excitation light B A Deflection plates Scattered light ; Waste Doležel et al., Chromosome Res. 15: 51, 2007 " Chromosomes: Mbp ( % of the genome) " Chromosome arms: Mbp ( % of the genome) Chromosome genomics! Chromosome specific BAC libraries and sequencing IEB
4 Faster!and!cheaper!methods!to!tackle!the!wheat!genome! h:p://flxlexblog.wordpress.com/2012/12/03/ developmentsjinjnextjgenera,onjsequencingjaj visualisa,on/! We:erstrand!KA.!DNA!Sequencing!Costs:!Data!from!the!NHGRI!! A!sequence!for!whom!&!for!what!purposes! Feuillet)et)al,)TIPS,)2010)
5 BAC!by!BAC!vs!WGS) BAC by BAC (physical map)! TEs Genes 500 kb Whole genome shotgun IWGSC!Strategy!for!a!Reference!Wheat!Genome!Sequence! 1. BAC library construction 2. BAC fingerprinting (HICF/WGP) 3. Contig assembly by FPC/LTC GAATTCTTGGTCAGCAATAAGGACAAAGAA! GAATTCCTCCTGTGCGGCCGTTTTA! GAATTCATGCTCCAGCCAACTCATCCAAAA! GAATTCAACAATATAAATATCACCTAAAGC! GAATTCCATCAGTATGGAGTTTCTTCATGC! GAATTCAAGCTTGAGTATTCTATAGTGTCA! GAATTCAATATGTAGAAATTATAGGATGGC! GAATTCACCGGAAGGGGTTCCGGGTGTTTC! GAATTCCGGAACGCTTCCGGAGACCAAACA! GAATTCTGGAATCACTTGATGATGAATCAG! GAATTCTGGAGTCTTCCTTTCCGCAGCGAA! GAATTCAACGAAATAGTTATGAAATAGAAG! GAATTCTGGGGTAACGATGGAATCCTACAC! GAATTCTGTCAACGACACTATCATCAGGAA! GAATTCTTCGATGCACTGAGTCGCACGGTT! GAATTCTTGTGTGAGGTCCGCGTCCTAGAT! 4. MTP sequencing /Scaffold assembly 5. Pseudomolecule construction (meiotic/ld/rh mapping) 6. Automated and curated annotation
6 Roadmap!to!the!Wheat!Genome!Sequence) Physical$mapping$of$individual$ chromosomes$ Survey$sequencing$of$individual$ chromosomes$ Short term Gene catalog Virtual order Markers MTP$sequencing$ Long term A$reference$sequence$anchored$to$the$gene4c$and$ phenotypic$maps$ Current$status$of$individual$projects$ Physical$ maps$ Illumina$ Survey$ sequences$ PseudoM molecules$
7 IWGSC$Chromosome$Survey$Sequencing$Ini4a4ve! Amplified$ DNAM$sorted$ individual$ chromosomes$ A,$S,$D,$$&$ AB$genomes$ (7)$ ~50X$ Illumina$ sequence$ >30X$ Illumina$ sequence$ Chromosome$ arm$sequence$ assemblies$ Read/assembly$ alignment$to$ chromosome$ arms! Gene$modeling,$ virtual$ordering$ (GZ),$ annota4on,$ func4onal,$ structural$ analyses$ Composi4on$ and$evolu4on$ of$the$21$bread$ Wheat$ Chromosomes$ IWGSC!Chromosome!Survey!Sequencing!J!Summary!!) Summary$ Almost!full!wheat!gene!complement!iden,fied!and! allocated!to!chromosome!arms! On!average,!53%!of!genes!virtually!ordered!along! chromosomes! High!level!of!interJ!and!intrachromosomal!duplica,on! Over!3.5!M!markers!mapped!to!con,gs!(1.3M!wheat! markers!+!2.3m!snps)!j!ssr,!est,!dart,!snp!(90k)! markers...! 13.2!million!SNPs!from!POPSeq!aligned!to!con,gs!
8 IWGSC!CSS!Resources!are!Facilita,ng) New!phylogene,c!analyses!of!wheat!genome! evolu,on!! Defini,on!of!core!and!pan!gene!sets!for! Tri0ceae!by!comparing!diJtetraJ!and!hexaploid! genomes!! HomoeologueJspecific!gene!expression!analyses! Wheat!haplotype!map!!E.!Akhunov!! TILLING!projects!in!T.)durum)and!bread!wheat!! UC,!Davis,!JIC,!Rres! Establishment!of!WheatNet!!UC,!Davis! 3B!SEQuencing!Project! Chr$3B$physical$map$ 1,282!BACJcon,gs! 8,441!BACs! Pool!of!10!BACs! 922!pools!!(Roche!454!GSFLX!Titanium,!8!Kb!MP)!! (~35X)!! Sorted$chr.$3B$ Sanger!!!Illumina!(82X)!! (2*600!bp)! (2*108!bp)!! PE!0.5!kb! Catherine!Feuillet!&!Fred!Choulet! 3B$pseudomolecule$assembly$ and$analyses$
9 An!integrated!and!ordered!3B!reference!sequence!) MetaQTL analysis 3B consensus map (5000 markers) 3B Physical map 3B pseudomolecule MapJbased!cloning!projects!on!3B! 40 genes and QTL mapped on 3B # 4722 markers on 3B consensus map, 3102 in 964 SC (679 Mb =82 % of the sequence) # 13 map-based cloning projects! Disease resistance genes (Sr, Lr, Yr, Stb )! Solid stem (saw fly)! Yield! Drought tolerance! Boron transporter! Flowering time! NUE! Chromosome pairing
10 Cur%s!Pozniak! A$Breeder s$perspec4ve! 3B Physical SSt1 3BL Xgwm114 XBE XPSP3001 SSt1 Xgpw4513 Xgwm340 Xgwm247 Xgwm181 Xgwm114 Xfba217 XBE ctg580 ctg854 Xgwm4703 ctg668 Xwmc274 ctg165 Xgwm247 Xgwm340 Xtam63 Xfba310 Xfba133.2 Xfbb293 Xdarts149 Xgwm181 Xgwm547 Xbarc68.2 Xgpw4513 1$year$ J 1!!EST!marker,!not!closer! J!ascertainment!bias! 3$weeks$ J 12!cosegrega,ng!markers!(SNPs)! J!no!phenotyping!in!the!fields! J!No!ascertainment!bias! $$$Speed$Gene$Discovery:$!!!!!!!!!!!!!!!Towards!Cloning!SSt1! 2.8!cM! Approx.!2.2!Mb! 13.3$
11 Power!of!A!High!Quality!Reference!Sequence! Number!of!QTLs!Cloned! Rice$ Wheat$ Feuillet)et)al,)Trends)in)Plant)Sciences,)2010;)Rey)et)al,)unpublished)update)) Wheat!Sequences!Available!Now) WGS$ WCS$ MTP$ CS$WGS$5x$ (2012)$ A$and$D$genome$$ related$ancestors$ (2013)$ CS$chromosome$ survey$sequences$$ (2013)$ Max!50%!!using!synteny!and!gene,c!mapping!(GZ):!«!virtual!order!»!!CS$3BSEQ$ (2013)$ 94%!real!order! completeness$of$informa4on$ Gold$ standard$
12 $$$$$Applica4ons$ 5X$CS$ Ae.$ tausc hii$ T.$ urartu$ $CS$ CSS$ MTP$ based$(3b)$!«!blind!»!snp!marker! development! x$ x$ x$ x$ Targeted!SNP!marker! development! x$ x$ Conversion!rate!in! genotyping!!for!breeding! 45%$ 95%$ MapJbased!cloning!!,me! (years)! 10$ 10$ 10$ 8$ $2$ Fundamental!studies! $$$$$$$$$$$$$$$limited$to$genes$ $complete$ IWGSC!Projects! The$Annotated$Reference$Sequence$ of$the$bread$wheat$genome$ Pseudomolecules$ (1$of$21$completed)$ Chromosome$Shotgun$Sequences$ and$marker$alignment$ (completed)$ Physical$Maps$with$markers$ (12$of$21$completed)$
13 Cur%s!Pozniak! IWGSC!Resources!in!Breeding! BAC Libraries Physical Maps Wheat Survey Sequence 3B Sequence Unlimited!source!of!DNA! markers!for!mas/genomic! Selec,on! Candidate!genes!for!traits!=! perfect!markers! Reduce!the!,me!and!improve! the!success!of!resolving!qtl!! Discovery!and!exploita,on!of! new!alleles! IWGSC!Resource!Access)!!All!resources!accessible!at!URGI,!Versailles! hjp://wheatmurgi.versailles.inra.fr/seqmrepository/$!!raw!sequence!reads!in!the!sra!!!iwgsc!css!assemblies!available!at!urgi!and!ebi!!!iwgsc!css!assemblies!&!gene!models!integrated!into!ensemblplants! hjp://plants.ensembl.org/tri4cum_aes4vum$ $ 272$ins4tu4ons$ $ 40$countries$ $ 52,000$BLAST$searches$ $ 2.500$downloads$
14 Thank!you!for!your!a:en,on!!
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director ACPFG Seminar University of Adelaide 1st May 2014 The International Wheat Genome Sequencing
More informationUtilization of the IWGSC Resources: Application to Wheat Breeding
Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these
More informationThe Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience
Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk
More informationBENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
More informationGenome Sequencing-- Strategies
Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that
More informationCSE182-L16. LW statistics/assembly
CSE182-L16 LW statistics/assembly Silly Quiz Who are these people, and what is the occasion? Genome Sequencing and Assembly Sequencing A break at T is shown here. Measuring the lengths using electrophoresis
More informationToward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Céline CHANTRY-DARMON 1 CNRGV The French Plant Genomic Center Created
More informationde novo sequencing of the sunflower genome
de novo sequencing of the sunflower genome Stéphane Muños LIPM INRA Toulouse stephane.munos@toulouse.inra.fr @stephane_munos @SUNRISE_France 39 Sunflower, an important cropfor Europe Million tons of seed
More informationPhysical Mapping and Shotgun Sequencing of Wheat Chromosome 2A
Physical Mapping and Shotgun Sequencing of Wheat Chromosome 2A Kuldeep Singh, Punjab Agril. Univ. Ludhiana India IWGSC, Sept 7 2013 Yokohama Japan Team India Punjab Agricultural University, Ludhiana (Kuldeep
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationRust Resistance Gene Cloning
University of Minnesota Rust Resistance Gene Cloning perfect markers and cassette development Peter Dodds BGRI technical workshop March 2014 Outlook: R gene pyramids via GM gene cassettes Stacking of multiple
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationWheat Chromosome Engineering and Breeding Jianli Chen
Wheat Chromosome Engineering and Breeding Jianli Chen Chromosome Engineering A process to transfer favorable alleles through inter-specific hybridization and interchange of chromatin using aneupolids Aneuploids?
More informationResearch Article A High-Density SNP and SSR Consensus Map Reveals Segregation Distortion Regions in Wheat
BioMed Research International Volume 2015, Article ID 830618, 10 pages http://dx.doi.org/10.1155/2015/830618 Research Article A High-Density SNP and SSR Consensus Map Reveals Segregation Distortion Regions
More informationUsing the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010!
Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010! buell@msu.edu! 1 Whole Genome Shotgun Sequencing 2 New Technologies Revolutionize
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationPhenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.
Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after
More informationGenomics AGRY Michael Gribskov Hock 331
Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will
More informationLocating Sequence on FPC Maps and Selecting a Minimal Tiling Path
Methods Locating Sequence on FPC Maps and Selecting a Minimal Tiling Path Friedrich W. Engler, James Hatfield, William Nelson, and Carol A. Soderlund 1 Arizona Genomics Computational Laboratory, University
More informationWelcome to the Future: Global Wheat Genome Sequencing Efforts
Welcome to the Future: Global Wheat Genome Sequencing Efforts Crop Development Centre Durum Wheat Breeding and Genetics Program Dr. Curtis J. Pozniak Use and/or distribution of these slides is prohibited
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationGap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
More informationUK Wheat Productivity Research Targets and Needs. Commercial Wheat Breeding Perspective. Dr. Richard Summers RAGT Seeds
UK Wheat Productivity Research Targets and Needs Commercial Wheat Breeding Perspective Dr. Richard Summers RAGT Seeds UK Wheat Productivity Research Targets and Needs Global population growth Increased
More informationA high-density consensus map of A and B wheat genomes
Theor Appl Genet (2012) 125:1619 1638 DOI 10.1007/s00122-012-1939-y ORIGINAL PAPER A high-density consensus map of A and B wheat genomes Daniela Marone Giovanni Laidò Agata Gadaleta Pasqualina Colasuonno
More informationGenome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015
Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 From reads to molecules What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and
More informationChapter 2 Conditional QTL Mapping of Major Quality Traits
Chapter 2 Conditional QTL Mapping of Major Quality Traits Abstract Till now many gene/qtl for wheat grain protein content have been previously identified, but the effects of these QTLs belonged to the
More informationA near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge
More informationAssembly of a Complex Genome: Defining Elements of Structure and Function
Assembly of a Complex Genome: Defining Elements of Structure and Function James Breen A Thesis presented for the degree of Doctor of Philosophy Murdoch University, Western Australia September 2009 1 This
More informationgrassgenomics: davidkopecký
grassgenomics: howto portiona mammoth? davidkopecký laboratory of molecular cytogenetics and cytometry centre of the region haná for biotechnological and agricultural research olomouc, czech republic Olomouc
More informationOrganization and evolution of transposable elements along the bread wheat chromosome 3B
Daron et al. Genome Biology 2014, 15:546 RESEARCH Open Access Organization and evolution of transposable elements along the bread wheat chromosome 3B Josquin Daron 1,2, Natasha Glover 1,2, Lise Pingault
More informationMolecular Biology: DNA sequencing
Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationIntegrating and Leveraging Cereal and Grass Genome Resources. David Marshall Information and Computational Sciences Group
Integrating and Leveraging Cereal and Grass Genome Resources David Marshall Information and Computational Sciences Group David.Marshall@hutton.ac.uk What I m going to cover Brief overview of the new barley
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationYANG ZHANG, MEIPING ZHANG, Yun-Hua Liu, C. Wayne Smith, Steve Hague, David M. Stelly, Hong-Bin Zhang*
Toward Development of Robust Integrated Physical and Genetic Maps for Individual Chromosomes of Upland Cotton (Gossypium hirsutum L.) for Accurately Sequencing Its Genome YANG ZHANG, MEIPING ZHANG, Yun-Hua
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationGenomic resources and gene/qtl discovery in cereals
Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline
More informationDevelopment of Genomic Tools for RKN Resistance Breeding in Cotton
Development of Genomic Tools for RKN Resistance Breeding in Cotton Dr. Hongbin Zhang Department of Soil & Crop Sciences and Institute for Plant Genomics & Biotechnology Texas A&M University, College Station,
More informationThe tomato genome re-seq project
The tomato genome re-seq project http://www.tomatogenome.net 5 February 2013, Richard Finkers & Sjaak van Heusden Rationale Genetic diversity in commercial tomato germplasm relatively narrow Unexploited
More informationCurrent Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding
Current Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding Hermann Buerstmayr, Barbara Steiner, Marc Lemmens BOKU-University of Natural Resources
More informationGenome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007
Genome and DNA Sequence Databases BME 110: CompBio Tools Todd Lowe April 5, 2007 Admin Reading: Chapters 2 & 3 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring07/bme110-calendar.html
More informationDNA sequencing. Course Info
DNA sequencing EECS 458 CWRU Fall 2004 Readings: Pevzner Ch1-4 Adams, Fields & Venter (ISBN:0127170103) Serafim Batzoglou s slides Course Info Instructor: Jing Li 509 Olin Bldg Phone: X0356 Email: jingli@eecs.cwru.edu
More informationContigs Built with Fingerprints, Markers, and FPC V4.7
Methods Contigs Built with Fingerprints, Markers, and FPC V4.7 Carol Soderlund, 1,3 Sean Humphray, 2 Andrew Dunham, 2 and Lisa French 2 1 Clemson University Genomic Institute, Clemson, South Carolina 29634-5808,
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationUC Davis UC Davis Previously Published Works
UC Davis UC Davis Previously Published Works Title Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationWheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes
Wheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes Prospects in Wheat Genomics -- what is needed from a research perspective Rudi Appels,
More informationTitle: High-quality genome assembly of channel catfish, Ictalurus punctatus
Author s response to reviews Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Authors: Qiong Shi (shiqiong@genomics.cn) Xiaohui Chen (xhchenffri@hotmail.com) Liqiang Zhong (lqzhongffri@hotmail.com)
More informationBulked segregant analysis for relative water content to detect quantitative trait loci in wheat under drought stress
Bulked segregant analysis for relative water content to detect quantitative trait loci in wheat under drought stress M.R. Naroui Rad 1,2, M. Abdul Kadir 1, M.Y. Rafii 3, H.Z.E. Jaafar 4 and M.R. Naghavi
More informationProgress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses
Progress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses Dr. Susanne Barth Teagasc Crops Research Centre Oak Park Carlow Irland Global challenges
More informationRe-sequencing and hybrid assembly strategy of two nematode resistant Beta vulgaris translocation lines. Sarah Christina Jäger
Faculty of Agricultural and Nutritional Sciences Re-sequencing and hybrid assembly strategy of two nematode resistant Beta vulgaris translocation lines Plant Breeding Institute Sarah Christina Jäger Plant
More informationA barley root mutant collection for NGS-based fast-forward genetics
A barley root mutant collection for NGS-based fast-forward genetics Roberto Tuberosa Dept. of Agricultural Sciences University of Bologna, Italy 2 nd Plant Genomics Congress Kuala Lumpur, 19-20 March,
More informationConnect-A-Contig Paper version
Teacher Guide Connect-A-Contig Paper version Abstract Students align pieces of paper DNA strips based on the distance between markers to generate a DNA consensus sequence. The activity helps students see
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationIntroduction to Bioinformatics. Genome sequencing & assembly
Introduction to Bioinformatics Genome sequencing & assembly Genome sequencing & assembly p DNA sequencing How do we obtain DNA sequence information from organisms? p Genome assembly What is needed to put
More informationSept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping
Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationMolecular marker redundancy check and construction of a high density genetic map of tetraploid cotton. Jean-Marc Lacape
Molecular marker redundancy check and construction of a high density genetic map of tetraploid cotton Jean-Marc Lacape Raleigh ICGI, October 10, 2012 Background ICGI/2008 Anyang Numerous marker projects
More informationHunting Down the Papaya Transgenes
Hunting Down the Papaya Transgenes Michael Schatz Center for Bioinformatics and Computational Biology University of Maryland January 16, 2008 PAG XVI Papaya Overview Carica papaya from the order Brassicales
More informationThe first generation DNA Sequencing
The first generation DNA Sequencing Slides 3 17 are modified from faperta.ugm.ac.id/newbie/download/pak_tar/.../instrument20072.ppt slides 18 43 are from Chengxiang Zhai at UIUC. The strand direction http://en.wikipedia.org/wiki/dna
More informationApplication of next generation sequencing of a begomovirusresistant. KASPar assay for SNP detection of the Ty1-Ty3 region
Application of next generation sequencing of a begomovirusresistant inbred to design a KASPar assay for SNP detection of the Ty1-Ty3 region Menda, N. 1, S. Strickler 1, D.M. Dunham 1, D.P. Maxwell 2, L.
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationProbes can be designed in an evolutionary hierarchy
Probes can be designed in an evolutionary hierarchy Probes can be designed to be highly redundant to increase the certainly of identification The match between clone counts and hybridization intensity
More informationMethods and Supplementary Information
Howe, Clark et al. 213 Methods and Table of Contents 1 Mapping, Sequencing and Assembly... 3 1.1 SATmap... 5 1.2 FPC Map... 16 1.3 Genome assemblies... 18 1.4 Clone Sequencing... 21 1.5 Whole genome shotgun
More informationSequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
More informationFinishing of DELE Drosophila elegans has been sequenced using Roche 454 pyrosequencing and Illumina
Sarah Swiezy Dr. Elgin, Dr. Shaffer Bio 434W 27 February 2015 Finishing of DELE8596009 Abstract Drosophila elegans has been sequenced using Roche 454 pyrosequencing and Illumina technology. DELE8596009,
More informationFunctional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1
Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1 Barbara Steiner, Simone Zimmerl, Marc Lemmens, Gerhard Adam, Bradley Till, Wolfgang
More informationCarl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life
METAGENOMICS Carl Woese Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary
More information3I03 - Eukaryotic Genetics Repetitive DNA
Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationHeaps of Chromosomes. New Scales and Evolving Paradigms in Genome Assembly
Heaps of Chromosomes New Scales and Evolving Paradigms in Genome Assembly The Who and the What Genome assemblers Library prep and sequencing Full de novo assembly Scaffolding Fully integrated, from sample
More informationFinger Millet Whole Genome Sequencing Project
Finger Millet Whole Genome Sequencing Project Scien&sts: DA Odeny (ICRISAT- Nairobi), Katrien Devos (UGA, USA), Allen van Deynze (UC Davis), F Stomeo (BecA- ILRI), Y Nasser (BecA- ILRI), A Djikeng (BecA-
More informationA. COVER PAGE. Oswaldo Chicaiza, Alicia del Blanco (50%), Xiaoqin Zhang (70%), and Marcelo Soria (20%).
A. COVER PAGE PROJECT TITLE Development of wheat varieties for California 2017-2018 PRINCIPAL INVESTIGATOR Jorge Dubcovsky OTHER INVESTIGATORS Oswaldo Chicaiza, Alicia del Blanco (50%), Xiaoqin Zhang (70%),
More informationChromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions. Supplementary Material
Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions Joshua N. Burton 1, Andrew Adey 1, Rupali P. Patwardhan 1, Ruolan Qiu 1, Jacob O. Kitzman 1, Jay Shendure 1 1 Department
More informationThis is a closed book, closed note exam. No calculators, phones or any electronic device are allowed.
MCB 104 MIDTERM #2 October 23, 2013 ***IMPORTANT REMINDERS*** Print your name and ID# on every page of the exam. You will lose 0.5 point/page if you forget to do this. Name KEY If you need more space than
More informationAP Biology Day 34. Monday, November 14, 2016
AP Biology Day 34 Monday, November 14, 2016 Essen%al knowledge standards 3.A.1: DNA, and in some cases RNA, is the primary source of heritable informa%on 3.A.1.e: Gene%c engineering techniques can manipulate
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationBMC Genomics. Sample. doi: /s
BMC Genomics This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Homologues of potato chromosome
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationFinishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome
Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Ruth Howe Bio 434W 27 February 2010 Abstract The fourth or dot chromosome of Drosophila species is composed primarily of highly condensed,
More informationBioinformatics Support of Genome Sequencing Projects. Seminar in biology
Bioinformatics Support of Genome Sequencing Projects Seminar in biology Introduction The Big Picture Biology reminder Enzyme for DNA manipulation DNA cloning DNA mapping Sequencing genomes Alignment of
More informationEach cell of a living organism contains chromosomes
COVER FEATURE Genome Sequence Assembly: Algorithms and Issues Algorithms that can assemble millions of small DNA fragments into gene sequences underlie the current revolution in biotechnology, helping
More informationHuman genetic variation
Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationGenome-level studies on late maturity alpha amylase and boron tolerance in wheat
Genome-level studies on late maturity alpha amylase and boron tolerance in wheat Meredith Diane Carter BSc (Hons) Sponsored by Grains Research and Development Corporation (GRDC) and Molecular Plant Breeding
More informationRestriction Site Mapping:
Restriction Site Mapping: In making genomic library the DNA is cut with rare cutting enzymes and large fragments of the size of 100,000 to 1000, 000bp. They are ligated to vectors such as Pacmid or YAC
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationHigh-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours
High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As
More informationSANGER SEQUENCING WHITE PAPER
AAAT T C SANGER SEQUENCING WHITE PAPER FACTORS AFFECTING SANGER SEQUENCING ROBUSTNESS AND DATA QUALITY PATRICK WARNER, SHEA ANDERSON, ARCHANA DESHPANDE, DARYL M. GOHL, KENNETH B. BECKMAN UNIVERSITY OF
More informationMHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
More informationAmplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
More informationResearch Finishing a whole-genome shotgun: Release 3 of the Drosophila melanogaster euchromatic genome sequence
http://genomebiology.com/2002/3/12/research/0079.1 Research Finishing a whole-genome shotgun: Release 3 of the Drosophila melanogaster euchromatic genome sequence Susan E Celniker*, David A Wheeler, Brent
More informationRice Structural and Functional Genome Research in ASPGC, Academia Sinica
Journal of Genetics and Molecular Biology Vol. 14, No. 4, 201-206, December 1, 2003 Rice Structural and Functional Genome Research in ASPGC, Academia Sinica Ya-Ting Chao 1, Chin-San Chen 1, Hong-Hwa Chen
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationAgricultural Outlook Forum Presented: February 17, 2006 STRATEGIES IN THE APPLICATION OF BIOTECH TO DROUGHT TOLERANCE
Agricultural Outlook Forum Presented: February 17, 2006 STRATEGIES IN THE APPLICATION OF BIOTECH TO DROUGHT TOLERANCE Marc Albertsen Research Director Pioneer Hi-Bred International Incorporated Strategies
More informationBioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
More informationAssociation Mapping in Wheat: Issues and Trends
Association Mapping in Wheat: Issues and Trends Dr. Pawan L. Kulwal Mahatma Phule Agricultural University, Rahuri-413 722 (MS), India Contents Status of AM studies in wheat Comparison with other important
More information