Minna J. Kemppainen, Alejandro G. Pardo Microbial Biotechnology 3: , 2010
|
|
- Ethel Shepherd
- 5 years ago
- Views:
Transcription
1 phg/psilbaγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihprna triggering in the mycorrhizal fungus Laccaria bicolor Minna J. Kemppainen, Alejandro G. Pardo Microbial Biotechnology 3: , 2010 Speaker:Chih-Jui Cheng Adviser: Ching-Tsan Huang, PhD Date :
2 2 Plant-fungi Symbiosis Nutrient acquisition Resistance to environmental stress and pathogens Soil aggregation Soil water retention Ectomycorrhiza Endomycorrhiza Mycorrhizal networks help ecosystems Plants with mycorrhizal fungi have higher capability to survive long-term
3 3 Laccaria bicolor Ectomycorrhiza Mutually beneficial Partner tree: conifers Favorite species for research L. bicolor genome is sequenced (Martin et al., 2008.) Martin et al., 2008 Kingdom: Fungi Division: Basidiomycota Class: Agaricomycetes Order: Agaricales Family: Hydnangiaceae Genus: Laccaria Species: L. bicolor
4 4 Homologous recombination knock out Filamentous fungi show low homologous recombination frequency.
5 5 RNA interference (RNAi) Gene down-regulation mediated by small RNAs microrna (mirna) Small interference RNA (sirna) He and Hannon, 2004
6 6 RNAi trigger Silencing vector Transformation Host Transformant with gene knock-down 5' 3' Promoter target intron inverted target terminator Intronic spacer hairpin RNA (ihprna) Incorporation of an intronic sequence as hprna spacer increasing silencing efficiency. (Smith et al., 2000; Wesley et al., 2001; Lee and Carthew, 2003)
7 7 RNAi trigger Transcription Transformant with gene knock-down Gene silencing
8 8 Applications of RNAi Medicine RNA interference Genetic study Biotechnology
9 9 Flowchart Vector construction ihprna of nitrate reductase (NR) Agrobacterium tumefaciens-mediated transformation (ATMT) Transformants analysis phenotypic evaluation semi-quantitative RT-PCR methylation analysis T-DNA copy number analysis integrated site analysis
10 10 Nitrate reductase (NR) Nitrate reductase NO - 3 NO - 2 Nitrite reductase NH 4 +
11 11 Factor of silencing strength Optimized intronic spacer size Chad A. et al., 2004 CpG methylation reduces gene transcription Susan E. Cottrell, Wälti et al., Kemppainen et al., 2009.
12 12 Vector construction M. oryzae CUT intron Pgpd Pgpd Intron of M. oryzae cutinase is 147 bp L. bicolor NR intron Pgpd Pgpd Intron of L. bicolor NR is 52 bp Pgpd L. bicolor NR intron Pgpd SC: silencing cassette HRC: hygromycin resistance cassette Pgpd: glyceraldehide-3-phosphate dehydrogenase promoter of Agaricus bisporus
13 13 Two-step cloning of the hairpin trigger Ti plasmid Silencing vector ATMT can be used in many homobasidiomycetes Suiable for many homobasidiomycetes
14 phenotypic evaluation 14
15 15 Methylation of gpdii promoter 555 bp 249 bp 511 bp 327 bp H, HpaII (methylation sensitive) phg/psilbaγ show minimum Isoschizomer CpG M, MspI (methylation insensitive)
16 16 NR knockdown correlate to growth Trasformants of phg/psilbaγ wt N A S
17 17 Silencing strength variation (SSV) Strains carrying the same silencing vector show variant silencing effects. Possible factors: Transgene copy number Transgene integration site (euchromatin versus heterochromatin)
18 18 T-DNA copy number and silencing strength No correlation was observed between T-DNA copy number and silencing strength
19 19 T-DNA integrated site Strongly affected category (S) integrated in protein-coding region. Growht phenotype category Genomic T-DNA integration site Integration type Protein ID EST support Proposed protein function Silencing casette orientation strain 62 N scaffold 6: intergenic integration strain 32 A scaffold 59: intergenic integration (repetitive sequence ReconFam374.db.fa.best20.malign ) strain 30 S scaffold 3: intron integration yes not known opposite to the gene transcription strain 26 S scaffold 25: intron integration no calsium ion binding opposite strain 26 S scaffold 11: Putative promoter integration (133bp upstream of the start codon) yes Mucin-like protein 1 precursor opposite strain 21 S scaffold 9: integration in the 3`UTR sequence yes Histone 2ª in gene transcription orientation Strain 26 has two T-DNA integrations.
20 20 Flowchart Vector construction ihprna of inositol-1,4,5-triphosphate 5-phosphatase (5-Pase) Agrobacterium tumefaciens-mediated transformation (ATMT) Transformants analysis phenotypic evaluation semi-quantitative RT-PCR
21 21 Inositol-1,4,5-triphosphate 5-phosphatase (5-Pase) Phosphoinositide control several cellular processes including cell growth. Sanjive Qazi, Barry A. Trimmer, 1999.
22 5-Pase knockdown 22
23 23 Summary psγ shows best silencing efficiency 5-Pase gene knockdown NR gene knockdown Lower methylation level in psγ
24 24 Populus trichocarpa Laccaria bicolor
25 25 Thanks for your attention
Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics
CONTENTS Preface Acknowledgements Lists of Commonly Used Abbreviations Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics Introduction Enzymes involved in DNA
More informationControl of Eukaryotic Gene Expression (Learning Objectives)
Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of
More informationValue Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above
1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex
More informationRNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 3, 2007 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense
More informationMethods for Reverse genetics References:
Methods for Reverse genetics References: 1. Alonso JM, Ecker JR. Moving forward in reverse: genetic technologies to enable genomewide phenomic screens in Arabidopsis. Nat Rev Genet. 2006 Jul;7(7):524-36.
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationNew Plant Breeding Techniques Group 3 Transgenic construct driven breeding
WORKSHOP COMPERATIVE SITUATION OF NEW PLANT BREEDING TECHNIQUES 12-13 SEPTEMBER 2011 SEVILLE, SPAIN 1 New Plant Breeding Techniques Group 3 Transgenic construct driven breeding Maria Lusser Joint Research
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationRNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 4, 2006 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense
More informationRNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.) April 8, 2008 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationA Survey of Genetic Methods
IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA
More informationChapter 19 Genetic Regulation of the Eukaryotic Genome. A. Bergeron AP Biology PCHS
Chapter 19 Genetic Regulation of the Eukaryotic Genome A. Bergeron AP Biology PCHS 2 Do Now - Eukaryotic Transcription Regulation The diagram below shows five genes (with their enhancers) from the genome
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationGenetic analysis - mutants
Genetic analysis - mutants Forward genetics From mutant phenotype to gene, from gene to protein function Reverse genetics From gene to mutant phenotype, to function Forward genetics 1. Screen for mutants
More informationSUPPLEMENTARY INFORMATION
Materials and Methods Transgenic Plant Materials and DNA Constructs. VEX1::H2B-GFP, ACA3::H2B-GFP, KRP6::H2B-GFP, KRP6::mock21ts-GFP, KRP6::TE21ts- GFP and KRP6::miR161ts-GFP constructs were generated
More informationCharacterization of RNA silencing components in the plant
1 2 3 4 5 6 Supplementary data Characterization of RNA silencing components in the plant pathogenic fungus Fusarium graminearum Yun Chen, Qixun Gao, Mengmeng Huang, Ye Liu, Zunyong Liu, Xin Liu, Zhonghua
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationOptimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University
Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU
More informationInvestigating the Role of RNA Polymerase II in RNAi-dependent Heterochromatin Assembly at Centromeric Repeats
Investigating the Role of RNA Polymerase II in RNAi-dependent Heterochromatin Assembly at Centromeric Repeats Abstract In Schizosaccharomyces pombe, a fission yeast, large domains of heterochromatin are
More informationRNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
More informationBiotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationBCH Graduate Survey of Biochemistry
BCH 5045 Graduate Survey of Biochemistry Instructor: Charles Guy Producer: Ron Thomas Director: Glen Graham Lecture 30 Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bch5045/index.html
More informationConstruct Design and Cloning Guide for Cas9-triggered homologous recombination
Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner
More informationGenetic Characterization of Production Cell Lines
Genetic Characterization of Production Cell Lines Luhong He and Christopher Frye 2017 CMC Strategy Forum Outlines Overview Genetic characterization strategy and case studies Transgene characterization
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationPlants Fight it out Intrinsic defence mechanism The magic world of Gene silencing
I LOVE YOU Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing Over expression of Chalcone synthase gene to get Purple Petunias Napoli, Lemieux & Jorgensen,1990 Desired Effect
More informationA Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology
A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology How Are Large DNA Molecules Analyzed? Naturally occurring enzymes that cleave and repair DNA are used in the laboratory to manipulate
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationGenome Biology and Biotechnology
Genome Biology and Biotechnology Functional Genomics Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course
More informationSupporting Information
Supporting Information Kilian et al. 10.1073/pnas.1105861108 SI Materials and Methods Determination of the Electric Field Strength Required for Successful Electroporation. The transformation construct
More informationsirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationDepartment of Genetics
Department of Genetics Program Specific Outcomes (PSO) Program- MSc. Genetics (404) The course prepares students for pursuing further research and teaching. Key features: Students have high success rate
More informationGenetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology
Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology 1 Biotechnology is defined as the technology that involves the use of living organisms
More informationThe demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
More informationA Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo.
Gus Frangou, Stephanie Palmer & Mark Groudine Fred Hutchinson Cancer Research Center, Seattle- USA A Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo. During mammalian development and differentiation
More informationSupplementary
Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationIntroduction to Genomic Medicine Exeter Expert Series: Cardiology
Introduction to Genomic Medicine Exeter Expert Series: Cardiology 2-3 November, 2017 Session I. Introductory concepts of genomics: gene, genome and variants Presented by Júlia Baptista PhD Clinical Scientist
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationGene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory
Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes
More informationCELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationSupplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
More informationProf. Fahd M. Nasr. Faculty of Sciences Lebanese University Beirut, Lebanon.
Prof. Fahd M. Nasr Faculty of Sciences Lebanese University Beirut, Lebanon https://yeastwonderfulworld.wordpress.com/ Biol328 - B3212 Molecular Biotechnology Partial Exam Question I Explain the procedure
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationUTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
More informationExperimental genetics - 2 Partha Roy
Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationIntro to RNA-seq. July 13, 2015
Intro to RNA-seq July 13, 2015 Goal of the course To be able to effectively design, and interpret genomic studies of gene expression. We will focus on RNA-seq, but the class will provide a foothold into
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationBIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.
BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human
More informationRNA folding and its importance. Mitesh Shrestha
RNA folding and its importance Mitesh Shrestha Diseases Caused due to Protein Misfolding Alzheimer s Disease Parkinson s Disease Cataracts Sickle Cell Disease Prion Diseases Cystic Fibrosis Ribozymes Ribonucleic
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationBBF RFC #: Categorization of non-coding RNA In Part Registry
BBF RFC # Categorization of non-coding RNA BBF RFC #: Categorization of non-coding RNA In Part Registry Eric Ming Fung CHEUNG, Raul Guillermo MEDINA CUELLAR and King L. CHOW 1. Purpose July 18, 2015 Over
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationExperimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse
Karin Fleischhanderl; Martina Fondi Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse 108 - Biotechnologie Abstract --- Keywords: Alternative
More informationEUKARYOTIC GENE CONTROL
EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION
More informationNew Plant Breeding Technologies
New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations
More informationEdexcel (B) Biology A-level
Edexcel (B) Biology A-level Topic 7: Modern Genetics Notes Using Gene Sequencing Genome = all of an organism s DNA, including mitochondrial/chloroplast DNA. Polymerase chain reaction (PCR) is used to amplify
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figure 1: List of primers/oligonucleotides used in this study. 1 Supplementary figure 2: Sequences and mirna-targets of i) mcherry expresses in transgenic fish used
More informationResearchers use genetic engineering to manipulate DNA.
Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationBiosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationReprogramming of the Genome by Toxic Injury Ken Ramos, MD, PhD, ATS
Reprogramming of the Genome by Toxic Injury Ken Ramos, MD, PhD, ATS Professor of dicine, University of Arizona Health Sciences Center & Associate Vice President for Precision Health Sciences Office of
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationPlant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter
Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA
More informationTrends in Medical Research -
RNA Interference Tel : 02-2267-1740 / E-mail : kimys@inje.ac.kr, RNAi (RNA or RNA silencing) ( ) DNA small RNA (srnas) mrna,. DNA small RNA. DNA RNA small RNA. small RNA mirna (microrna), RNA RNAi. 1993
More informationGenetics Biology 331 Exam 3B Spring 2015
Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation
More informationMISSION shrna Library: Next Generation RNA Interference
Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology
More informationConcept 13.1 Recombinant DNA Can Be Made in the Laboratory
13 Biotechnology Concept 13.1 Recombinant DNA Can Be Made in the Laboratory It is possible to modify organisms with genes from other, distantly related organisms. Recombinant DNA is a DNA molecule made
More informationResearch Advances in the Development of Transgenic and Gene Edited Products in Sri Lanka
Research Advances in the Development of Transgenic and Gene Edited Products in Sri Lanka Dr. Pradeepa C.G. Bandaranayake Director, Agricultural Biotechnology Centre Faculty of Agriculture University of
More informationGene Regulation Biology
Gene Regulation Biology Potential and Limitations of Cell Re-programming in Cancer Research Eric Blanc KCL April 13, 2010 Eric Blanc (KCL) Gene Regulation Biology April 13, 2010 1 / 21 Outline 1 The Central
More informationSupplemental Materials. Zhu et al. RNAi suppression of DDM1 in poplar
%mc Supplemental Materials Zhu et al. RNAi suppression of in poplar Supplemental Fig. S1 Total cellular cytosine methylation for selected events determined by HPLC. The association between methylcytosine
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist
More informationGTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
More informationDESIGNER GENES - BIOTECHNOLOGY
DESIGNER GENES - BIOTECHNOLOGY Technology to manipulate DNA techniques often called genetic engineering or Recombinant DNA Technology-Technology used to manipulate DNA Procedures often called genetic engineering
More informationmicrorna Shifra Ben-Dor March 2010
microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target
More informationThis pedigree shows a family affected by an autosomal dominant genetic disease. Genotypes for five markers, A through E, are shown
Molecular Genetics Exam 3 Key page 1 of 5 This pedigree shows a family affected by an autosomal dominant genetic disease. Genotypes for five markers, A through E, are shown I 1 2 II 1 2 III The genotypes
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationBiotechnology and its Applications
Biotechnology and its Applications Very Short Answers Questions: 1. Give different types of cry genes and pests which are controlled by the proteins encoded by these genes? A: cryiac, cryiiab and cry IAb
More informationTranscriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More information