Minna J. Kemppainen, Alejandro G. Pardo Microbial Biotechnology 3: , 2010

Size: px
Start display at page:

Download "Minna J. Kemppainen, Alejandro G. Pardo Microbial Biotechnology 3: , 2010"

Transcription

1 phg/psilbaγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihprna triggering in the mycorrhizal fungus Laccaria bicolor Minna J. Kemppainen, Alejandro G. Pardo Microbial Biotechnology 3: , 2010 Speaker:Chih-Jui Cheng Adviser: Ching-Tsan Huang, PhD Date :

2 2 Plant-fungi Symbiosis Nutrient acquisition Resistance to environmental stress and pathogens Soil aggregation Soil water retention Ectomycorrhiza Endomycorrhiza Mycorrhizal networks help ecosystems Plants with mycorrhizal fungi have higher capability to survive long-term

3 3 Laccaria bicolor Ectomycorrhiza Mutually beneficial Partner tree: conifers Favorite species for research L. bicolor genome is sequenced (Martin et al., 2008.) Martin et al., 2008 Kingdom: Fungi Division: Basidiomycota Class: Agaricomycetes Order: Agaricales Family: Hydnangiaceae Genus: Laccaria Species: L. bicolor

4 4 Homologous recombination knock out Filamentous fungi show low homologous recombination frequency.

5 5 RNA interference (RNAi) Gene down-regulation mediated by small RNAs microrna (mirna) Small interference RNA (sirna) He and Hannon, 2004

6 6 RNAi trigger Silencing vector Transformation Host Transformant with gene knock-down 5' 3' Promoter target intron inverted target terminator Intronic spacer hairpin RNA (ihprna) Incorporation of an intronic sequence as hprna spacer increasing silencing efficiency. (Smith et al., 2000; Wesley et al., 2001; Lee and Carthew, 2003)

7 7 RNAi trigger Transcription Transformant with gene knock-down Gene silencing

8 8 Applications of RNAi Medicine RNA interference Genetic study Biotechnology

9 9 Flowchart Vector construction ihprna of nitrate reductase (NR) Agrobacterium tumefaciens-mediated transformation (ATMT) Transformants analysis phenotypic evaluation semi-quantitative RT-PCR methylation analysis T-DNA copy number analysis integrated site analysis

10 10 Nitrate reductase (NR) Nitrate reductase NO - 3 NO - 2 Nitrite reductase NH 4 +

11 11 Factor of silencing strength Optimized intronic spacer size Chad A. et al., 2004 CpG methylation reduces gene transcription Susan E. Cottrell, Wälti et al., Kemppainen et al., 2009.

12 12 Vector construction M. oryzae CUT intron Pgpd Pgpd Intron of M. oryzae cutinase is 147 bp L. bicolor NR intron Pgpd Pgpd Intron of L. bicolor NR is 52 bp Pgpd L. bicolor NR intron Pgpd SC: silencing cassette HRC: hygromycin resistance cassette Pgpd: glyceraldehide-3-phosphate dehydrogenase promoter of Agaricus bisporus

13 13 Two-step cloning of the hairpin trigger Ti plasmid Silencing vector ATMT can be used in many homobasidiomycetes Suiable for many homobasidiomycetes

14 phenotypic evaluation 14

15 15 Methylation of gpdii promoter 555 bp 249 bp 511 bp 327 bp H, HpaII (methylation sensitive) phg/psilbaγ show minimum Isoschizomer CpG M, MspI (methylation insensitive)

16 16 NR knockdown correlate to growth Trasformants of phg/psilbaγ wt N A S

17 17 Silencing strength variation (SSV) Strains carrying the same silencing vector show variant silencing effects. Possible factors: Transgene copy number Transgene integration site (euchromatin versus heterochromatin)

18 18 T-DNA copy number and silencing strength No correlation was observed between T-DNA copy number and silencing strength

19 19 T-DNA integrated site Strongly affected category (S) integrated in protein-coding region. Growht phenotype category Genomic T-DNA integration site Integration type Protein ID EST support Proposed protein function Silencing casette orientation strain 62 N scaffold 6: intergenic integration strain 32 A scaffold 59: intergenic integration (repetitive sequence ReconFam374.db.fa.best20.malign ) strain 30 S scaffold 3: intron integration yes not known opposite to the gene transcription strain 26 S scaffold 25: intron integration no calsium ion binding opposite strain 26 S scaffold 11: Putative promoter integration (133bp upstream of the start codon) yes Mucin-like protein 1 precursor opposite strain 21 S scaffold 9: integration in the 3`UTR sequence yes Histone 2ª in gene transcription orientation Strain 26 has two T-DNA integrations.

20 20 Flowchart Vector construction ihprna of inositol-1,4,5-triphosphate 5-phosphatase (5-Pase) Agrobacterium tumefaciens-mediated transformation (ATMT) Transformants analysis phenotypic evaluation semi-quantitative RT-PCR

21 21 Inositol-1,4,5-triphosphate 5-phosphatase (5-Pase) Phosphoinositide control several cellular processes including cell growth. Sanjive Qazi, Barry A. Trimmer, 1999.

22 5-Pase knockdown 22

23 23 Summary psγ shows best silencing efficiency 5-Pase gene knockdown NR gene knockdown Lower methylation level in psγ

24 24 Populus trichocarpa Laccaria bicolor

25 25 Thanks for your attention

Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics

Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics CONTENTS Preface Acknowledgements Lists of Commonly Used Abbreviations Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics Introduction Enzymes involved in DNA

More information

Control of Eukaryotic Gene Expression (Learning Objectives)

Control of Eukaryotic Gene Expression (Learning Objectives) Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of

More information

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above 1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex

More information

RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)

RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 3, 2007 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense

More information

Methods for Reverse genetics References:

Methods for Reverse genetics References: Methods for Reverse genetics References: 1. Alonso JM, Ecker JR. Moving forward in reverse: genetic technologies to enable genomewide phenomic screens in Arabidopsis. Nat Rev Genet. 2006 Jul;7(7):524-36.

More information

Concepts and Methods in Developmental Biology

Concepts and Methods in Developmental Biology Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

New Plant Breeding Techniques Group 3 Transgenic construct driven breeding

New Plant Breeding Techniques Group 3 Transgenic construct driven breeding WORKSHOP COMPERATIVE SITUATION OF NEW PLANT BREEDING TECHNIQUES 12-13 SEPTEMBER 2011 SEVILLE, SPAIN 1 New Plant Breeding Techniques Group 3 Transgenic construct driven breeding Maria Lusser Joint Research

More information

Genome research in eukaryotes

Genome research in eukaryotes Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

More information

RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)

RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 4, 2006 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense

More information

RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.)

RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.) Biochemistry 412 RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.) April 8, 2008 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

A Survey of Genetic Methods

A Survey of Genetic Methods IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA

More information

Chapter 19 Genetic Regulation of the Eukaryotic Genome. A. Bergeron AP Biology PCHS

Chapter 19 Genetic Regulation of the Eukaryotic Genome. A. Bergeron AP Biology PCHS Chapter 19 Genetic Regulation of the Eukaryotic Genome A. Bergeron AP Biology PCHS 2 Do Now - Eukaryotic Transcription Regulation The diagram below shows five genes (with their enhancers) from the genome

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

Genetic analysis - mutants

Genetic analysis - mutants Genetic analysis - mutants Forward genetics From mutant phenotype to gene, from gene to protein function Reverse genetics From gene to mutant phenotype, to function Forward genetics 1. Screen for mutants

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Materials and Methods Transgenic Plant Materials and DNA Constructs. VEX1::H2B-GFP, ACA3::H2B-GFP, KRP6::H2B-GFP, KRP6::mock21ts-GFP, KRP6::TE21ts- GFP and KRP6::miR161ts-GFP constructs were generated

More information

Characterization of RNA silencing components in the plant

Characterization of RNA silencing components in the plant 1 2 3 4 5 6 Supplementary data Characterization of RNA silencing components in the plant pathogenic fungus Fusarium graminearum Yun Chen, Qixun Gao, Mengmeng Huang, Ye Liu, Zunyong Liu, Xin Liu, Zhonghua

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University

Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU

More information

Investigating the Role of RNA Polymerase II in RNAi-dependent Heterochromatin Assembly at Centromeric Repeats

Investigating the Role of RNA Polymerase II in RNAi-dependent Heterochromatin Assembly at Centromeric Repeats Investigating the Role of RNA Polymerase II in RNAi-dependent Heterochromatin Assembly at Centromeric Repeats Abstract In Schizosaccharomyces pombe, a fission yeast, large domains of heterochromatin are

More information

RNA Structure and the Versatility of RNA. Mitesh Shrestha

RNA Structure and the Versatility of RNA. Mitesh Shrestha RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis

More information

Biotechnology and DNA Technology

Biotechnology and DNA Technology 11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare

More information

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna

More information

BCH Graduate Survey of Biochemistry

BCH Graduate Survey of Biochemistry BCH 5045 Graduate Survey of Biochemistry Instructor: Charles Guy Producer: Ron Thomas Director: Glen Graham Lecture 30 Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bch5045/index.html

More information

Construct Design and Cloning Guide for Cas9-triggered homologous recombination

Construct Design and Cloning Guide for Cas9-triggered homologous recombination Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner

More information

Genetic Characterization of Production Cell Lines

Genetic Characterization of Production Cell Lines Genetic Characterization of Production Cell Lines Luhong He and Christopher Frye 2017 CMC Strategy Forum Outlines Overview Genetic characterization strategy and case studies Transgene characterization

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing

Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing I LOVE YOU Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing Over expression of Chalcone synthase gene to get Purple Petunias Napoli, Lemieux & Jorgensen,1990 Desired Effect

More information

A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology

A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology How Are Large DNA Molecules Analyzed? Naturally occurring enzymes that cleave and repair DNA are used in the laboratory to manipulate

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

Genome Biology and Biotechnology

Genome Biology and Biotechnology Genome Biology and Biotechnology Functional Genomics Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course

More information

Supporting Information

Supporting Information Supporting Information Kilian et al. 10.1073/pnas.1105861108 SI Materials and Methods Determination of the Electric Field Strength Required for Successful Electroporation. The transformation construct

More information

sirna Overview and Technical Tips

sirna Overview and Technical Tips 1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

More information

Department of Genetics

Department of Genetics Department of Genetics Program Specific Outcomes (PSO) Program- MSc. Genetics (404) The course prepares students for pursuing further research and teaching. Key features: Students have high success rate

More information

Genetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology

Genetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology 1 Biotechnology is defined as the technology that involves the use of living organisms

More information

The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.

The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might

More information

A Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo.

A Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo. Gus Frangou, Stephanie Palmer & Mark Groudine Fred Hutchinson Cancer Research Center, Seattle- USA A Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo. During mammalian development and differentiation

More information

Supplementary

Supplementary Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

Introduction to Genomic Medicine Exeter Expert Series: Cardiology

Introduction to Genomic Medicine Exeter Expert Series: Cardiology Introduction to Genomic Medicine Exeter Expert Series: Cardiology 2-3 November, 2017 Session I. Introductory concepts of genomics: gene, genome and variants Presented by Júlia Baptista PhD Clinical Scientist

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes

More information

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.

More information

Prof. Fahd M. Nasr. Faculty of Sciences Lebanese University Beirut, Lebanon.

Prof. Fahd M. Nasr. Faculty of Sciences Lebanese University Beirut, Lebanon. Prof. Fahd M. Nasr Faculty of Sciences Lebanese University Beirut, Lebanon https://yeastwonderfulworld.wordpress.com/ Biol328 - B3212 Molecular Biotechnology Partial Exam Question I Explain the procedure

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

UTR Reporter Vectors and Viruses

UTR Reporter Vectors and Viruses UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for

More information

Experimental genetics - 2 Partha Roy

Experimental genetics - 2 Partha Roy Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Intro to RNA-seq. July 13, 2015

Intro to RNA-seq. July 13, 2015 Intro to RNA-seq July 13, 2015 Goal of the course To be able to effectively design, and interpret genomic studies of gene expression. We will focus on RNA-seq, but the class will provide a foothold into

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177

More information

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY. BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human

More information

RNA folding and its importance. Mitesh Shrestha

RNA folding and its importance. Mitesh Shrestha RNA folding and its importance Mitesh Shrestha Diseases Caused due to Protein Misfolding Alzheimer s Disease Parkinson s Disease Cataracts Sickle Cell Disease Prion Diseases Cystic Fibrosis Ribozymes Ribonucleic

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

BBF RFC #: Categorization of non-coding RNA In Part Registry

BBF RFC #: Categorization of non-coding RNA In Part Registry BBF RFC # Categorization of non-coding RNA BBF RFC #: Categorization of non-coding RNA In Part Registry Eric Ming Fung CHEUNG, Raul Guillermo MEDINA CUELLAR and King L. CHOW 1. Purpose July 18, 2015 Over

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Document S1. Supplemental Experimental Procedures and Three Figures (see next page)

Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas

More information

Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse

Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse Karin Fleischhanderl; Martina Fondi Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse 108 - Biotechnologie Abstract --- Keywords: Alternative

More information

EUKARYOTIC GENE CONTROL

EUKARYOTIC GENE CONTROL EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION

More information

New Plant Breeding Technologies

New Plant Breeding Technologies New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations

More information

Edexcel (B) Biology A-level

Edexcel (B) Biology A-level Edexcel (B) Biology A-level Topic 7: Modern Genetics Notes Using Gene Sequencing Genome = all of an organism s DNA, including mitochondrial/chloroplast DNA. Polymerase chain reaction (PCR) is used to amplify

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary figure 1: List of primers/oligonucleotides used in this study. 1 Supplementary figure 2: Sequences and mirna-targets of i) mcherry expresses in transgenic fish used

More information

Researchers use genetic engineering to manipulate DNA.

Researchers use genetic engineering to manipulate DNA. Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic

More information

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Reprogramming of the Genome by Toxic Injury Ken Ramos, MD, PhD, ATS

Reprogramming of the Genome by Toxic Injury Ken Ramos, MD, PhD, ATS Reprogramming of the Genome by Toxic Injury Ken Ramos, MD, PhD, ATS Professor of dicine, University of Arizona Health Sciences Center & Associate Vice President for Precision Health Sciences Office of

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter

Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA

More information

Trends in Medical Research -

Trends in Medical Research - RNA Interference Tel : 02-2267-1740 / E-mail : kimys@inje.ac.kr, RNAi (RNA or RNA silencing) ( ) DNA small RNA (srnas) mrna,. DNA small RNA. DNA RNA small RNA. small RNA mirna (microrna), RNA RNAi. 1993

More information

Genetics Biology 331 Exam 3B Spring 2015

Genetics Biology 331 Exam 3B Spring 2015 Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation

More information

MISSION shrna Library: Next Generation RNA Interference

MISSION shrna Library: Next Generation RNA Interference Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology

More information

Concept 13.1 Recombinant DNA Can Be Made in the Laboratory

Concept 13.1 Recombinant DNA Can Be Made in the Laboratory 13 Biotechnology Concept 13.1 Recombinant DNA Can Be Made in the Laboratory It is possible to modify organisms with genes from other, distantly related organisms. Recombinant DNA is a DNA molecule made

More information

Research Advances in the Development of Transgenic and Gene Edited Products in Sri Lanka

Research Advances in the Development of Transgenic and Gene Edited Products in Sri Lanka Research Advances in the Development of Transgenic and Gene Edited Products in Sri Lanka Dr. Pradeepa C.G. Bandaranayake Director, Agricultural Biotechnology Centre Faculty of Agriculture University of

More information

Gene Regulation Biology

Gene Regulation Biology Gene Regulation Biology Potential and Limitations of Cell Re-programming in Cancer Research Eric Blanc KCL April 13, 2010 Eric Blanc (KCL) Gene Regulation Biology April 13, 2010 1 / 21 Outline 1 The Central

More information

Supplemental Materials. Zhu et al. RNAi suppression of DDM1 in poplar

Supplemental Materials. Zhu et al. RNAi suppression of DDM1 in poplar %mc Supplemental Materials Zhu et al. RNAi suppression of in poplar Supplemental Fig. S1 Total cellular cytosine methylation for selected events determined by HPLC. The association between methylcytosine

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist

More information

GTTCGGGTTCC TTTTGAGCAG

GTTCGGGTTCC TTTTGAGCAG Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA

More information

DESIGNER GENES - BIOTECHNOLOGY

DESIGNER GENES - BIOTECHNOLOGY DESIGNER GENES - BIOTECHNOLOGY Technology to manipulate DNA techniques often called genetic engineering or Recombinant DNA Technology-Technology used to manipulate DNA Procedures often called genetic engineering

More information

microrna Shifra Ben-Dor March 2010

microrna Shifra Ben-Dor March 2010 microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target

More information

This pedigree shows a family affected by an autosomal dominant genetic disease. Genotypes for five markers, A through E, are shown

This pedigree shows a family affected by an autosomal dominant genetic disease. Genotypes for five markers, A through E, are shown Molecular Genetics Exam 3 Key page 1 of 5 This pedigree shows a family affected by an autosomal dominant genetic disease. Genotypes for five markers, A through E, are shown I 1 2 II 1 2 III The genotypes

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Biotechnology and its Applications

Biotechnology and its Applications Biotechnology and its Applications Very Short Answers Questions: 1. Give different types of cry genes and pests which are controlled by the proteins encoded by these genes? A: cryiac, cryiiab and cry IAb

More information

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information