Gene Editing Tool with

Size: px
Start display at page:

Download "Gene Editing Tool with"

Transcription

1 Gene Editing Tool with CRISPR-Cas9 System NFLS NANJING

2 INTRODUCTION & INSPIRATION

3 EASSILY Assembled Reassembled Replaced

4 CONNECTORS

5 REMOVE REPLACE REPAIR

6 CRISPR-Cas9 System

7 ACRISPR-Cas9 offers greater flexibility with custom designed Guide RNAs.

8

9 TOOL KIT Recognition site grna Upstream homologous arms Downstream homologous arms

10

11

12 grna, CRISPR and new sequence are transfected in nucleus as plasmid grna transcripts, CRISPR transcripts Cas9 transcripts, CRISPR transcripts and translates

13

14

15

16

17 THE

18 grna-a grna-b grna-c thaf thbf thcf thar thbr thcr ENZYME

19 Upstream Homologous Arm with Target Gene Identifying sequence A Identifying sequence C Identifying sequence B

20 Downstream Homologous Arm with Target Gene Identifying sequence A Identifying sequence B Identifying sequence C

21 grna-a grna-b grna-c thaf thbf thcf thar thbr thcr ENZYME

22 grna-a (BBa_K ) Identifying sequence A TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACC AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATAC GATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGAT ATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTT TAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTC GATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTAGAATTGATCAG AGGAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAA CTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTAC AAAGTTGGCATTA

23 grna-b (BBa_K ) Identifying sequence B TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCA AGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGA TACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATT AGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAA AATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATT TCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAGGAACCGGATCTTATA ATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTT GGCATTA

24 grna-c (BBa_K ) Identifying sequence C TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACC AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATAC GATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGAT ATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTT TTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTT CGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACGCACCAC GTGTGATTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT TCTAGACCCAGCTTTCTT GTACAAAGTTGGCATTA

25 thaf (BBa_K ) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAAT CGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTG TCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGA AATCAGTGTAGAATTGATCAGAGGAACCGG thbf (BBa_K ) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAAT CGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTG TCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGA AATCAGTGAGGAACCGGATCTTATAATCGG thcf (BBa_K ) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAAT CGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTG TCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGA AATCAGTGTACGCACCACGTGTGATTACGG

26 thar (BBa_K ) GTAGAATTGATCAGAGGAACCGGTTCAAACACAACAAGCTCGAACTGTCGTTC AAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCC CTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCA CAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT thbr (BBa_K ) GAGGAACCGGATCTTATAATCGGTTCAAACACAACAAGCTCGAACTGTCGTTC AAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCC CTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCA CAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT thcr (BBa_K ) GTACGCACCACGTGTGATTACGGTTCAAACACAACAAGCTCGAACTGTCGTTC AAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCC CTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCA CAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT

27 TOOL KIT Recycle And Reuse Unlimited Times Of Replacement Unlimited Sets Of Components

28 Basic Plasmid Backbone Psb1c3 Add Prefix And Suffix

29 BLAST Identify REPETITION Specificity & Accuracy

30 ADVANTAGES

31 Flexibility Precisely And Accurately Targeting Genetic Diseases Pro. Daniel Anderson

32

33 WHY NOT RESTRICTION ENZYMES? Limitations Inside The Nuclei ToPerform Post-translational Modifications Recognitions Site

34 WHY FROM GFP TO RFP? Replace a mutated or mis-inserted part without the need to reconstruct the entire sequence. Inserting a blank part to delete a certain malfunctioning part.

35 FUTURE PROSPECT

36 Inserting acertain for certain condition Inserting the arms on both side of the pathogen genome Replace or silence it in vivo Multiple sets of components Multiple replace at one time or multiple replaces at multiple times.

37

38 感謝聆聽 THANK YOU

39 Guide-RNA grna Specific Recognition Sequence Transcription Vectors BioBrick cloning site prefix(ecor I,Xba I)and suffix(spe I,Pst I) Basic plasmid backbone psb1c3(bba_j04450)

40 thdna Target Recombinant Sequences of Vectors Upstream and Downstream Homologous Arm with Target Gene BioBrick cloning site prefix(ecor I,Xba I)and suffix(spe I,Pst I) basic plasmid backbone psb1c3(bba_j04450)

41 Greater flexibility in silencing Enhancing or repairing gene expression The ability to introduce larger gene fragments

42 Compatibility With igem database in mind, the kit follows a modular design and aims to facilitate future igem projects with greater flexibility and compatibility in gene editing. BioBrick cloning site prefix(ecor I,Xba I)and suffix (Spe I,Pst I) Basic plasmid backbone psb1c3(bba_j04450)

43 Promoter Start editing spontaneously

44 Build-up of the Parts

45 Proof of Principle Experiments

46

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research

More information

Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary

Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological

More information

Genome editing. Knock-ins

Genome editing. Knock-ins Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in

More information

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein

More information

BBF RFC 44 - Bioscaffold-Linker. Mina Petros & Savery Nigel. 18 October 2009

BBF RFC 44 - Bioscaffold-Linker. Mina Petros & Savery Nigel. 18 October 2009 BBF RFC 44 Bioscaffold-Linker BBF RFC 44 - Bioscaffold-Linker Mina Petros & Savery Nigel 18 October 2009 1. Purpose Protein fusions are currently not supported by most assembly standards. This assembly

More information

Page 70 Monday December 8, 2014

Page 70 Monday December 8, 2014 replication and Monday December 8, 0 Notebook check 8: Page 69, DNA Technology Introduction Worksheet. The process by which a foreign gene is replicated by insertion into a bacterium is called genetic

More information

Allele-specific locus binding and genome editing by CRISPR at the

Allele-specific locus binding and genome editing by CRISPR at the Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure

More information

A Guide to CRISPR/Cas9

A Guide to CRISPR/Cas9 Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse

More information

File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References.

File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References. 1 2 File name: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References. 3 1 4 Supplementary Figures 5 6 7 Figure S1 Comparison of the One-Step-Assembly

More information

CRISPR/Cas9 Genome Editing: Transfection Methods

CRISPR/Cas9 Genome Editing: Transfection Methods CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the

More information

CRISPR/Cas9 engineering and bioinformatics. Leopold Parts 10/05/2018

CRISPR/Cas9 engineering and bioinformatics. Leopold Parts 10/05/2018 CRISPR/Cas9 engineering and bioinformatics Leopold Parts 10/05/2018 CRISPR/Cas9 engineering and bioinformatics CRISPR/Cas9 background Genome engineering in olden days: RE and HR DNA break repair as a basic

More information

New Plant Breeding Technologies

New Plant Breeding Technologies New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations

More information

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up

More information

UTR Reporter Vectors and Viruses

UTR Reporter Vectors and Viruses UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for

More information

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb

More information

C A T T A G C nitrogenous complimentary G T A A T C G to each other

C A T T A G C nitrogenous complimentary G T A A T C G to each other Name DNA RNA Review Worksheet Date 1. What does DNA stand for? Deoxyribonucleic acid 2. What is DNA s primary function? - Provides a pattern for protein manufacture - Provides a pattern for replication

More information

Supplementary Information

Supplementary Information Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen

More information

B.Sc V Semester Question Bank. B.Sc V Semester Question Bank. Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6

B.Sc V Semester Question Bank. B.Sc V Semester Question Bank. Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6 B.Sc V Semester Question Bank Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6 UNIT I Genetic Material Different forms of DNA (DNA topology):- B-form, Z-form, D-form; Gene structure-introns,exons

More information

Introduction to Synthetic Biology. Standard for Physical DNA Composition. Vincent Rouilly Bioengineering Department Imperial College London

Introduction to Synthetic Biology. Standard for Physical DNA Composition. Vincent Rouilly Bioengineering Department Imperial College London Introduction to Synthetic Biology Topic 1 Topic 2 Topic 3 Topic 4 Topic 5 Standard for Physical DNA Composition Vincent Rouilly Bioengineering Department Imperial College London A Programming Language

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster

ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs

More information

Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments

Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Adam Clore, PhD Manager, Synthetic Biology Design Integrated DNA technology Typical CRISPR timeline in Mammalian cell lines Design

More information

Construct Design and Cloning Guide for Cas9-triggered homologous recombination

Construct Design and Cloning Guide for Cas9-triggered homologous recombination Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner

More information

BBF RFC 25: Fusion Protein (Freiburg) Biobrick assembly standard

BBF RFC 25: Fusion Protein (Freiburg) Biobrick assembly standard BBF RFC 25 Fusionprotein Assembly BBF RFC 25: Fusion Protein (Freiburg) Biobrick assembly standard Kristian M. Müller, Katja M. Arndt, igem 2007 Team Freiburg, Raik Grünberg 1. Purpose 31.3.2009 This Request

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Protocols for cell lines using CRISPR/CAS

Protocols for cell lines using CRISPR/CAS Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable

More information

Pre-AP Biology DNA and Biotechnology Study Guide #1

Pre-AP Biology DNA and Biotechnology Study Guide #1 Last Name: First Name: Per. Pre-AP Biology DNA and Biotechnology Study Guide #1 Structure of DNA: Number of strands. Parallel or antiparallel?. Rosalind Franklin s x-ray crystallography image indicated

More information

Standard Sequence Assembly of Biobricks. Tom Knight MIT Artificial Intelligence Laboratory

Standard Sequence Assembly of Biobricks. Tom Knight MIT Artificial Intelligence Laboratory Standard Sequence Assembly of Biobricks Tom Knight MIT Artificial Intelligence Laboratory 1 0.1 Motivation The lack of standards in the assembly of DNA sequences leads to a situation in which each assembly

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression

More information

Phosphorothioate-based BioBrick cloning (Potsdam) Standard

Phosphorothioate-based BioBrick cloning (Potsdam) Standard BBF RFC 91: phosphorothioate-based BioBrick cloning 1 Document Version 1.0, October 26, 2012 Phosphorothioate-based BioBrick cloning (Potsdam) Standard igem Team Potsdam 2012 1, Tobias Baumann 1, Kristian

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Getting started with CRISPR: A review of gene knockout and homology-directed repair

Getting started with CRISPR: A review of gene knockout and homology-directed repair Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1 Agenda: Getting started with CRISPR Background

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a

More information

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for

More information

Biological Engineering at USU. Student enrollment Research igem BE careers BE club (get involved!)

Biological Engineering at USU. Student enrollment Research igem BE careers BE club (get involved!) Biological Engineering at USU Student enrollment Research igem BE careers BE club (get involved!) BE student enrollment BE Total Undergrad Enrollment (2013 projected) 200 180 186 160 140 154 137 120 117

More information

Return to Web Version

Return to Web Version Page 1 of 7 Page 1 of 7 Return to Web Version ZFN Technology Biowire Volume 10 Article 1 Have your genomic work cut out for you The genomes of several organisms, including humans, have been sequenced,

More information

Bio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery!

Bio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery! Bio-Reagent Services Custom Gene Services Gateway to Smooth Molecular Biology! Gene Synthesis Mutagenesis Mutant Libraries Plasmid Preparation sirna and mirna Services Large-scale DNA Sequencing GenPool

More information

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version

More information

CRISPR GENOMIC SERVICES PRODUCT CATALOG

CRISPR GENOMIC SERVICES PRODUCT CATALOG CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

BBF RFC 98: GenBrick A Rapid Multi-Part Assembly Method for BioBricks

BBF RFC 98: GenBrick A Rapid Multi-Part Assembly Method for BioBricks BBF RFC 98 GenBrick Assembly BBF RFC 98: GenBrick A Rapid Multi-Part Assembly Method for BioBricks Lina Gasiūnaitė, Aleksandra Lewicka, Hristiana Pashkuleva, Hugo Villanueva, Harry Thornton, Maryia Trubitsyna,

More information

MID-TERM EXAMINATION

MID-TERM EXAMINATION PLNT3140 INTRODUCTORY CYTOGENETICS MID-TERM EXAMINATION 1 p.m. to 2:15 p.m. Thursday, October 18, 2012 Answer any combination of questions totalling to exactly 100 points. If you answer questions totalling

More information

Large scale genome editing for. Senior Scientist, GenScript

Large scale genome editing for. Senior Scientist, GenScript Large scale genome editing for metabolic engineering of E. coli YifanLi Li, Ph.D PhD Senior Scientist, GenScript Metabolic engineering Cell factory Remove inhibition Substrate Overexpressing pathway genes

More information

12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule

12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,

More information

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, Problem Set 8 MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Bart Williams, PhD Van Andel Research Center

Bart Williams, PhD Van Andel Research Center A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:

More information

Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444

Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444 Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0

More information

! Intended Learning Outcomes:

! Intended Learning Outcomes: Introduction to Part Assembly: Building with BioBrick TM Objective: To simulate a standard method for assembling biological parts. Intended Learning Outcomes: 1. Students will be able to distinguish and

More information

Technology. offer: New. method

Technology. offer: New. method Technology offer: New method to detect spacer acquisition in CRISPR structures Technology offer: New method to detect spacer acquisition in CRISPR structures. SUMMARY CRISPR structures are a component

More information

BBF RFC 57: Assembly of BioBricks by the Gibson Method

BBF RFC 57: Assembly of BioBricks by the Gibson Method BBF RFC 57: Assembly of BioBricks by the Gibson Method Bill Collins, Hannah Copley, Peter Emmrich, Will Handley, Anja Hohmann, Emily Knott, Paul Masset, Ben Reeve and Theo Sanderson October 28, 2010 1

More information

Genome Reassembly From Fragments. 28 March 2013 OSU CSE 1

Genome Reassembly From Fragments. 28 March 2013 OSU CSE 1 Genome Reassembly From Fragments 28 March 2013 OSU CSE 1 Genome A genome is the encoding of hereditary information for an organism in its DNA The mathematical model of a genome is a string of character,

More information

Introducing Your Students To Gene Editing With CRISPR

Introducing Your Students To Gene Editing With CRISPR Introducing Your Students To Gene Editing With CRISPR Brian Ell, Ph.D. Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education!

More information

BBF RFC 36: Fusion protein BioBrick assembly standard with optional linker extension

BBF RFC 36: Fusion protein BioBrick assembly standard with optional linker extension BBF RFC 36: Fusion protein BioBrick assembly standard with optional linker extension 1 Purpose This RFC 36 describes an extension of the original BioBrick assembly standard (BBF RFC10) and Freiburg assembly

More information

CHAPTERS 16 & 17: DNA Technology

CHAPTERS 16 & 17: DNA Technology CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make

More information

Barley as a model for cereal engineering and genome editing. Wendy Harwood

Barley as a model for cereal engineering and genome editing. Wendy Harwood Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter

More information

IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS

IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS YONGLUN LUO (ALUN) ALUN@BIOMED.AU.DK VIB, NOV. 21. 2017 Associate Professor, Department of Biomedicine, Aarhus University, Denmark Executive Director,

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

Module 6 Microbial Genetics. Chapter 8

Module 6 Microbial Genetics. Chapter 8 Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry

More information

Adding CRISPR to Your Bio-ARROW Protocol

Adding CRISPR to Your Bio-ARROW Protocol Adding CRISPR to Your Bio-ARROW Protocol Table of Contents Work Covered by this Guidance Document... 2 Background... 2 VI. Materials and Activities... 3 VI. Materials and Activities - Recombinant Materials...

More information

Recombinant protein production in Eukaryotic cells. Dr. W. McLaughlin BC35C

Recombinant protein production in Eukaryotic cells. Dr. W. McLaughlin BC35C Recombinant protein production in Eukaryotic cells Dr. W. McLaughlin BC35C Recombinant protein production in Eukaryotic cells! rhuman protein must be identical to the natural protein! Prokaryotes are generally

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Genetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology

Genetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology 1 Biotechnology is defined as the technology that involves the use of living organisms

More information

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of

More information

Easi CRISPR for conditional and insertional alleles

Easi CRISPR for conditional and insertional alleles Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome

More information

chapter eight: microbial genetics

chapter eight: microbial genetics chapter eight: microbial genetics Revised 9/15/2016 the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material

More information

Quick reference guide

Quick reference guide Quick reference guide Our Invitrogen GeneArt CRISPR Search and Design Tool allows you to search our database of >600,000 predesigned CRISPR guide RNA (grna) sequences or analyze your sequence of interest

More information

Genetic Engineering in Agriculture

Genetic Engineering in Agriculture Details Utah State University Engineering in This is a project resulting from the Engineering Workshop for Teachers to provide teaching materials for genetic engineering topics. Please direct any feedback

More information

produces an RNA copy of the coding region of a gene

produces an RNA copy of the coding region of a gene 1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the

More information

Final Review: Biotech Section

Final Review: Biotech Section Name: attempt# Final Review: Biotech Section GENE MUTATIONS 1. Define mutation: 2. Define gene mutation: 3. What are the two categories of gene mutations? 4. Label the diagram with the different types

More information

In-Fusion HD Cloning Plus System

In-Fusion HD Cloning Plus System In-Fusion HD Cloning Plus System One trustworthy solution for all your cloning and mutagenesis projects Seamless 15-30 Directional Any vector GOI + Any insert Anywhere Large & small inserts or vectors

More information

Image adapted from: National Human Genome Research Institute

Image adapted from: National Human Genome Research Institute Jargon buster Image 1: The structure of DNA A double helix with base pairing 1 Image adapted from: National Human Genome Research Institute Allele An allele is one of two or more versions of a gene. An

More information

B. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.

B. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA. MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

Biology Warm Up. 1. Complete the entrance ticket you received at the door.

Biology Warm Up. 1. Complete the entrance ticket you received at the door. Biology Warm Up Monday, February 8 1. Complete the entrance ticket you received at the door. NOTE: This is not a grade. I want to see what you know/remember. Once you finish, place in front blue basket.

More information

Enhanced Arginase production: rocf

Enhanced Arginase production: rocf Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria

More information

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

DESIGNER GENES - BIOTECHNOLOGY

DESIGNER GENES - BIOTECHNOLOGY DESIGNER GENES - BIOTECHNOLOGY Technology to manipulate DNA techniques often called genetic engineering or Recombinant DNA Technology-Technology used to manipulate DNA Procedures often called genetic engineering

More information

number Done by Corrected by Doctor Hamed Al Zoubi

number Done by Corrected by Doctor Hamed Al Zoubi number 3 Done by Neda a Baniata Corrected by Waseem Abu Obeida Doctor Hamed Al Zoubi Note: it is important to refer to slides. Bacterial genetics *The main concepts we will talk about in this lecture:

More information

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009 MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose

More information

User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption

User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)

More information

CRISPR-Cas9 Genome Editing. New Era of Agricultural Biotechnology

CRISPR-Cas9 Genome Editing. New Era of Agricultural Biotechnology 2017 Grains Research Update - CRISPR-Cas9 Genome Editing New Era of Agricultural Biotechnology Yong Han & Chengdao Li y.han@murdoch.edu.au Western Barley Genetics Alliance 28 Feb,2017 One of the ten breakthrough

More information

Expression Testing and Bioproduct Development

Expression Testing and Bioproduct Development Expression Testing and Overview Luciferase Bioproducts Conclusions Team USU Overview Cyanobacteria Luciferase Overview Expression Testing Testing Results CyanoBricks Customization Bioproduct Production

More information

Plasmid Loss Genetic Safeguards. igem Giant Jamboree 2014

Plasmid Loss Genetic Safeguards. igem Giant Jamboree 2014 Plasmid Loss Genetic Safeguards igem Giant Jamboree 2014 1. Introduction 2. Modelling 3. Wet lab 4. Human Practices Agenda First up: Introduction Imagine this scenario Massive oil spill! Image credits:

More information

Application Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors

Application Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors Application Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors Table of Contents: I. Background Pg. 1 II. Analysis of Gene Target

More information

CRISPR/Cas9 Gene Editing Tools

CRISPR/Cas9 Gene Editing Tools CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t

More information

CRISPR/Cas9 Gene Editing Tools

CRISPR/Cas9 Gene Editing Tools CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection

More information

Units 4: How Does Life Change and Respond to Challenges Over Time?

Units 4: How Does Life Change and Respond to Challenges Over Time? Units 4: How Does Life Change and Respond to Challenges Over Time? Area of Study 1: How Are Species Related? Area of Study 2: How Do Humans Impact on Biological Processes? Area of Study 3: Practical Investigation

More information

Supplementary Methods pcfd5 cloning protocol

Supplementary Methods pcfd5 cloning protocol Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

Biotechnology and DNA Technology

Biotechnology and DNA Technology 11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

A Survey of Genetic Methods

A Survey of Genetic Methods IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA

More information

DNA RNA Protein. THE DISCOVERY AND STRUCTURE OF DNA (SB2a) What is DNA? SCIENTISTS WHEN? IMPORTANT DISCOVERY

DNA RNA Protein. THE DISCOVERY AND STRUCTURE OF DNA (SB2a) What is DNA? SCIENTISTS WHEN? IMPORTANT DISCOVERY DNA RNA Protein Notes THE DISCOVERY AND STRUCTURE OF DNA (SB2a) SCIENTISTS WHEN? IMPORTANT DISCOVERY Frederick Mieshcer Discovered in the white blood cells Phoebus Levene Oswald Avery Erwin Chargaff Alfred

More information

Concepts and Methods in Developmental Biology

Concepts and Methods in Developmental Biology Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information