Gene Editing Tool with
|
|
- Randolph Hopkins
- 5 years ago
- Views:
Transcription
1 Gene Editing Tool with CRISPR-Cas9 System NFLS NANJING
2 INTRODUCTION & INSPIRATION
3 EASSILY Assembled Reassembled Replaced
4 CONNECTORS
5 REMOVE REPLACE REPAIR
6 CRISPR-Cas9 System
7 ACRISPR-Cas9 offers greater flexibility with custom designed Guide RNAs.
8
9 TOOL KIT Recognition site grna Upstream homologous arms Downstream homologous arms
10
11
12 grna, CRISPR and new sequence are transfected in nucleus as plasmid grna transcripts, CRISPR transcripts Cas9 transcripts, CRISPR transcripts and translates
13
14
15
16
17 THE
18 grna-a grna-b grna-c thaf thbf thcf thar thbr thcr ENZYME
19 Upstream Homologous Arm with Target Gene Identifying sequence A Identifying sequence C Identifying sequence B
20 Downstream Homologous Arm with Target Gene Identifying sequence A Identifying sequence B Identifying sequence C
21 grna-a grna-b grna-c thaf thbf thcf thar thbr thcr ENZYME
22 grna-a (BBa_K ) Identifying sequence A TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACC AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATAC GATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGAT ATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTT TAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTC GATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTAGAATTGATCAG AGGAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAA CTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTAC AAAGTTGGCATTA
23 grna-b (BBa_K ) Identifying sequence B TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCA AGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGA TACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATT AGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAA AATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATT TCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAGGAACCGGATCTTATA ATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTT GGCATTA
24 grna-c (BBa_K ) Identifying sequence C TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACC AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATAC GATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGAT ATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTT TTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTT CGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACGCACCAC GTGTGATTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT TCTAGACCCAGCTTTCTT GTACAAAGTTGGCATTA
25 thaf (BBa_K ) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAAT CGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTG TCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGA AATCAGTGTAGAATTGATCAGAGGAACCGG thbf (BBa_K ) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAAT CGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTG TCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGA AATCAGTGAGGAACCGGATCTTATAATCGG thcf (BBa_K ) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAAT CGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTG TCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGA AATCAGTGTACGCACCACGTGTGATTACGG
26 thar (BBa_K ) GTAGAATTGATCAGAGGAACCGGTTCAAACACAACAAGCTCGAACTGTCGTTC AAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCC CTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCA CAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT thbr (BBa_K ) GAGGAACCGGATCTTATAATCGGTTCAAACACAACAAGCTCGAACTGTCGTTC AAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCC CTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCA CAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT thcr (BBa_K ) GTACGCACCACGTGTGATTACGGTTCAAACACAACAAGCTCGAACTGTCGTTC AAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCC CTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCA CAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT
27 TOOL KIT Recycle And Reuse Unlimited Times Of Replacement Unlimited Sets Of Components
28 Basic Plasmid Backbone Psb1c3 Add Prefix And Suffix
29 BLAST Identify REPETITION Specificity & Accuracy
30 ADVANTAGES
31 Flexibility Precisely And Accurately Targeting Genetic Diseases Pro. Daniel Anderson
32
33 WHY NOT RESTRICTION ENZYMES? Limitations Inside The Nuclei ToPerform Post-translational Modifications Recognitions Site
34 WHY FROM GFP TO RFP? Replace a mutated or mis-inserted part without the need to reconstruct the entire sequence. Inserting a blank part to delete a certain malfunctioning part.
35 FUTURE PROSPECT
36 Inserting acertain for certain condition Inserting the arms on both side of the pathogen genome Replace or silence it in vivo Multiple sets of components Multiple replace at one time or multiple replaces at multiple times.
37
38 感謝聆聽 THANK YOU
39 Guide-RNA grna Specific Recognition Sequence Transcription Vectors BioBrick cloning site prefix(ecor I,Xba I)and suffix(spe I,Pst I) Basic plasmid backbone psb1c3(bba_j04450)
40 thdna Target Recombinant Sequences of Vectors Upstream and Downstream Homologous Arm with Target Gene BioBrick cloning site prefix(ecor I,Xba I)and suffix(spe I,Pst I) basic plasmid backbone psb1c3(bba_j04450)
41 Greater flexibility in silencing Enhancing or repairing gene expression The ability to introduce larger gene fragments
42 Compatibility With igem database in mind, the kit follows a modular design and aims to facilitate future igem projects with greater flexibility and compatibility in gene editing. BioBrick cloning site prefix(ecor I,Xba I)and suffix (Spe I,Pst I) Basic plasmid backbone psb1c3(bba_j04450)
43 Promoter Start editing spontaneously
44 Build-up of the Parts
45 Proof of Principle Experiments
46
Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows
Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research
More informationUse of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary
No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More informationChapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes
Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein
More informationBBF RFC 44 - Bioscaffold-Linker. Mina Petros & Savery Nigel. 18 October 2009
BBF RFC 44 Bioscaffold-Linker BBF RFC 44 - Bioscaffold-Linker Mina Petros & Savery Nigel 18 October 2009 1. Purpose Protein fusions are currently not supported by most assembly standards. This assembly
More informationPage 70 Monday December 8, 2014
replication and Monday December 8, 0 Notebook check 8: Page 69, DNA Technology Introduction Worksheet. The process by which a foreign gene is replicated by insertion into a bacterium is called genetic
More informationAllele-specific locus binding and genome editing by CRISPR at the
Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure
More informationA Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
More informationFile name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References.
1 2 File name: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References. 3 1 4 Supplementary Figures 5 6 7 Figure S1 Comparison of the One-Step-Assembly
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationCRISPR/Cas9 engineering and bioinformatics. Leopold Parts 10/05/2018
CRISPR/Cas9 engineering and bioinformatics Leopold Parts 10/05/2018 CRISPR/Cas9 engineering and bioinformatics CRISPR/Cas9 background Genome engineering in olden days: RE and HR DNA break repair as a basic
More informationNew Plant Breeding Technologies
New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations
More informationDNA REPLICATION & BIOTECHNOLOGY Biology Study Review
DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up
More informationUTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
More informationLentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors
Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb
More informationC A T T A G C nitrogenous complimentary G T A A T C G to each other
Name DNA RNA Review Worksheet Date 1. What does DNA stand for? Deoxyribonucleic acid 2. What is DNA s primary function? - Provides a pattern for protein manufacture - Provides a pattern for replication
More informationSupplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
More informationB.Sc V Semester Question Bank. B.Sc V Semester Question Bank. Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6
B.Sc V Semester Question Bank Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6 UNIT I Genetic Material Different forms of DNA (DNA topology):- B-form, Z-form, D-form; Gene structure-introns,exons
More informationIntroduction to Synthetic Biology. Standard for Physical DNA Composition. Vincent Rouilly Bioengineering Department Imperial College London
Introduction to Synthetic Biology Topic 1 Topic 2 Topic 3 Topic 4 Topic 5 Standard for Physical DNA Composition Vincent Rouilly Bioengineering Department Imperial College London A Programming Language
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster
Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs
More informationDesigning CRISPR mediated Gene disruptions with gblocks Gene Fragments
Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Adam Clore, PhD Manager, Synthetic Biology Design Integrated DNA technology Typical CRISPR timeline in Mammalian cell lines Design
More informationConstruct Design and Cloning Guide for Cas9-triggered homologous recombination
Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner
More informationBBF RFC 25: Fusion Protein (Freiburg) Biobrick assembly standard
BBF RFC 25 Fusionprotein Assembly BBF RFC 25: Fusion Protein (Freiburg) Biobrick assembly standard Kristian M. Müller, Katja M. Arndt, igem 2007 Team Freiburg, Raik Grünberg 1. Purpose 31.3.2009 This Request
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationProtocols for cell lines using CRISPR/CAS
Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable
More informationPre-AP Biology DNA and Biotechnology Study Guide #1
Last Name: First Name: Per. Pre-AP Biology DNA and Biotechnology Study Guide #1 Structure of DNA: Number of strands. Parallel or antiparallel?. Rosalind Franklin s x-ray crystallography image indicated
More informationStandard Sequence Assembly of Biobricks. Tom Knight MIT Artificial Intelligence Laboratory
Standard Sequence Assembly of Biobricks Tom Knight MIT Artificial Intelligence Laboratory 1 0.1 Motivation The lack of standards in the assembly of DNA sequences leads to a situation in which each assembly
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationCELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
More informationPhosphorothioate-based BioBrick cloning (Potsdam) Standard
BBF RFC 91: phosphorothioate-based BioBrick cloning 1 Document Version 1.0, October 26, 2012 Phosphorothioate-based BioBrick cloning (Potsdam) Standard igem Team Potsdam 2012 1, Tobias Baumann 1, Kristian
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationGetting started with CRISPR: A review of gene knockout and homology-directed repair
Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1 Agenda: Getting started with CRISPR Background
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationCELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
More informationBiological Engineering at USU. Student enrollment Research igem BE careers BE club (get involved!)
Biological Engineering at USU Student enrollment Research igem BE careers BE club (get involved!) BE student enrollment BE Total Undergrad Enrollment (2013 projected) 200 180 186 160 140 154 137 120 117
More informationReturn to Web Version
Page 1 of 7 Page 1 of 7 Return to Web Version ZFN Technology Biowire Volume 10 Article 1 Have your genomic work cut out for you The genomes of several organisms, including humans, have been sequenced,
More informationBio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery!
Bio-Reagent Services Custom Gene Services Gateway to Smooth Molecular Biology! Gene Synthesis Mutagenesis Mutant Libraries Plasmid Preparation sirna and mirna Services Large-scale DNA Sequencing GenPool
More informationProtocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
More informationCRISPR GENOMIC SERVICES PRODUCT CATALOG
CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationBBF RFC 98: GenBrick A Rapid Multi-Part Assembly Method for BioBricks
BBF RFC 98 GenBrick Assembly BBF RFC 98: GenBrick A Rapid Multi-Part Assembly Method for BioBricks Lina Gasiūnaitė, Aleksandra Lewicka, Hristiana Pashkuleva, Hugo Villanueva, Harry Thornton, Maryia Trubitsyna,
More informationMID-TERM EXAMINATION
PLNT3140 INTRODUCTORY CYTOGENETICS MID-TERM EXAMINATION 1 p.m. to 2:15 p.m. Thursday, October 18, 2012 Answer any combination of questions totalling to exactly 100 points. If you answer questions totalling
More informationLarge scale genome editing for. Senior Scientist, GenScript
Large scale genome editing for metabolic engineering of E. coli YifanLi Li, Ph.D PhD Senior Scientist, GenScript Metabolic engineering Cell factory Remove inhibition Substrate Overexpressing pathway genes
More information12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule
I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationBart Williams, PhD Van Andel Research Center
A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:
More informationSupplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444
Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0
More information! Intended Learning Outcomes:
Introduction to Part Assembly: Building with BioBrick TM Objective: To simulate a standard method for assembling biological parts. Intended Learning Outcomes: 1. Students will be able to distinguish and
More informationTechnology. offer: New. method
Technology offer: New method to detect spacer acquisition in CRISPR structures Technology offer: New method to detect spacer acquisition in CRISPR structures. SUMMARY CRISPR structures are a component
More informationBBF RFC 57: Assembly of BioBricks by the Gibson Method
BBF RFC 57: Assembly of BioBricks by the Gibson Method Bill Collins, Hannah Copley, Peter Emmrich, Will Handley, Anja Hohmann, Emily Knott, Paul Masset, Ben Reeve and Theo Sanderson October 28, 2010 1
More informationGenome Reassembly From Fragments. 28 March 2013 OSU CSE 1
Genome Reassembly From Fragments 28 March 2013 OSU CSE 1 Genome A genome is the encoding of hereditary information for an organism in its DNA The mathematical model of a genome is a string of character,
More informationIntroducing Your Students To Gene Editing With CRISPR
Introducing Your Students To Gene Editing With CRISPR Brian Ell, Ph.D. Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education!
More informationBBF RFC 36: Fusion protein BioBrick assembly standard with optional linker extension
BBF RFC 36: Fusion protein BioBrick assembly standard with optional linker extension 1 Purpose This RFC 36 describes an extension of the original BioBrick assembly standard (BBF RFC10) and Freiburg assembly
More informationCHAPTERS 16 & 17: DNA Technology
CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make
More informationBarley as a model for cereal engineering and genome editing. Wendy Harwood
Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter
More informationIMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS
IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS YONGLUN LUO (ALUN) ALUN@BIOMED.AU.DK VIB, NOV. 21. 2017 Associate Professor, Department of Biomedicine, Aarhus University, Denmark Executive Director,
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationModule 6 Microbial Genetics. Chapter 8
Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry
More informationAdding CRISPR to Your Bio-ARROW Protocol
Adding CRISPR to Your Bio-ARROW Protocol Table of Contents Work Covered by this Guidance Document... 2 Background... 2 VI. Materials and Activities... 3 VI. Materials and Activities - Recombinant Materials...
More informationRecombinant protein production in Eukaryotic cells. Dr. W. McLaughlin BC35C
Recombinant protein production in Eukaryotic cells Dr. W. McLaughlin BC35C Recombinant protein production in Eukaryotic cells! rhuman protein must be identical to the natural protein! Prokaryotes are generally
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationGenetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology
Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology 1 Biotechnology is defined as the technology that involves the use of living organisms
More informationSimple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
More informationEasi CRISPR for conditional and insertional alleles
Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome
More informationchapter eight: microbial genetics
chapter eight: microbial genetics Revised 9/15/2016 the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material
More informationQuick reference guide
Quick reference guide Our Invitrogen GeneArt CRISPR Search and Design Tool allows you to search our database of >600,000 predesigned CRISPR guide RNA (grna) sequences or analyze your sequence of interest
More informationGenetic Engineering in Agriculture
Details Utah State University Engineering in This is a project resulting from the Engineering Workshop for Teachers to provide teaching materials for genetic engineering topics. Please direct any feedback
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationFinal Review: Biotech Section
Name: attempt# Final Review: Biotech Section GENE MUTATIONS 1. Define mutation: 2. Define gene mutation: 3. What are the two categories of gene mutations? 4. Label the diagram with the different types
More informationIn-Fusion HD Cloning Plus System
In-Fusion HD Cloning Plus System One trustworthy solution for all your cloning and mutagenesis projects Seamless 15-30 Directional Any vector GOI + Any insert Anywhere Large & small inserts or vectors
More informationImage adapted from: National Human Genome Research Institute
Jargon buster Image 1: The structure of DNA A double helix with base pairing 1 Image adapted from: National Human Genome Research Institute Allele An allele is one of two or more versions of a gene. An
More informationB. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.
MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric
More informationBiosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
More informationBiology Warm Up. 1. Complete the entrance ticket you received at the door.
Biology Warm Up Monday, February 8 1. Complete the entrance ticket you received at the door. NOTE: This is not a grade. I want to see what you know/remember. Once you finish, place in front blue basket.
More informationEnhanced Arginase production: rocf
Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria
More informationIntroduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the
Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationDESIGNER GENES - BIOTECHNOLOGY
DESIGNER GENES - BIOTECHNOLOGY Technology to manipulate DNA techniques often called genetic engineering or Recombinant DNA Technology-Technology used to manipulate DNA Procedures often called genetic engineering
More informationnumber Done by Corrected by Doctor Hamed Al Zoubi
number 3 Done by Neda a Baniata Corrected by Waseem Abu Obeida Doctor Hamed Al Zoubi Note: it is important to refer to slides. Bacterial genetics *The main concepts we will talk about in this lecture:
More informationName AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009
MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose
More informationUser Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption
User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)
More informationCRISPR-Cas9 Genome Editing. New Era of Agricultural Biotechnology
2017 Grains Research Update - CRISPR-Cas9 Genome Editing New Era of Agricultural Biotechnology Yong Han & Chengdao Li y.han@murdoch.edu.au Western Barley Genetics Alliance 28 Feb,2017 One of the ten breakthrough
More informationExpression Testing and Bioproduct Development
Expression Testing and Overview Luciferase Bioproducts Conclusions Team USU Overview Cyanobacteria Luciferase Overview Expression Testing Testing Results CyanoBricks Customization Bioproduct Production
More informationPlasmid Loss Genetic Safeguards. igem Giant Jamboree 2014
Plasmid Loss Genetic Safeguards igem Giant Jamboree 2014 1. Introduction 2. Modelling 3. Wet lab 4. Human Practices Agenda First up: Introduction Imagine this scenario Massive oil spill! Image credits:
More informationApplication Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors
Application Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors Table of Contents: I. Background Pg. 1 II. Analysis of Gene Target
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationUnits 4: How Does Life Change and Respond to Challenges Over Time?
Units 4: How Does Life Change and Respond to Challenges Over Time? Area of Study 1: How Are Species Related? Area of Study 2: How Do Humans Impact on Biological Processes? Area of Study 3: Practical Investigation
More informationSupplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
More informationHow Do You Clone a Gene?
S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are
More informationBiotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationA Survey of Genetic Methods
IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA
More informationDNA RNA Protein. THE DISCOVERY AND STRUCTURE OF DNA (SB2a) What is DNA? SCIENTISTS WHEN? IMPORTANT DISCOVERY
DNA RNA Protein Notes THE DISCOVERY AND STRUCTURE OF DNA (SB2a) SCIENTISTS WHEN? IMPORTANT DISCOVERY Frederick Mieshcer Discovered in the white blood cells Phoebus Levene Oswald Avery Erwin Chargaff Alfred
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More information