Multiple choice questions (numbers in brackets indicate the number of correct answers)
|
|
- Ashlynn Mitchell
- 6 years ago
- Views:
Transcription
1 1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist of proteins The genetic code includes 3 termination codons DNA chips contain oligonucleotides Transcriptomes can be characterized by serial analysis of gene expression (SAGE) The yeast genome contains about 6000 genes RNA interference is not possible in prokaryotes Homologous recombination can be used to disrupt genes Transposons can be directed to disrupt specific genes A northern hybridization identifies genes that are transcribed Exon-intron boundaries can be easily located by a computer Open reading frames are only found in protein-coding genes Ribosomal RNAs are translated into proteins (3) 2. Protein-coding genes can be identified by Transposon tagging ORF scanning Zoo-blotting Nuclease S1 mapping (1) 3. The function of genes can be determined by Gene inactivation Homology search Exon trapping Zoo-blotting Northern analysis (2) 4. Dideoxynucleotides are used in PCR Southern hybridization Transformation Cloning DNA sequencing Culturing of bacteria (1)
2 2 5. Polypeptides Can fold into a double helix Can have a tertiary structure Can contain phosphate Can contain sulfur Consist of nucleotides Are synthesized in the nucleus (2) 6. Reporter genes Indicate the presence of stress conditions Are used to characterize proteomes Are all of bacterial origin Are used to delineate regulatory sequence elements Can often be detected by histochemical assays (2) 7. Microarrays Are used for analysis of transcriptomes Are made of glass Contain RNA sequences Contain DNA sequences Are smaller than DNA chips (2) 8. ORF scanning Is used to find exons Is used to find intergenic sequences Is used to find gene homologies Is used to find protein-coding genes (1) 9. Chromosome walking Is used in genetic mapping Can be used to close physical sequence gaps Occurs in mitosis Requires a genomic DNA library Can be done by PCR Is used in fluorescent in situ hybridization (FISH) (2) 10. A codon bias Is used in genome mapping Is found in intergenic regions Is found in functional RNAs Is not found in prokaryotes Is used to identify genes (1)
3 3 11. Expression of genes can be analyzed by Northern analysis Southern analysis Comparative genomics RNA interference (1) 12. Clone fingerprinting Is a cloning technique Identifies overlapping DNA sequences Is used in physical mapping of genomes Is used in sequence assembly (2) 13. Fluorescent in situ hybridization (FISH) requires deoxynucleotides requires a labeled probe is used in physical mapping of genomes is used in genetic mapping of genomes requires a DNA polymerase (2) 14. Genes can be altered or replaced by Transposon tagging RNA interference Homologous recombination (1) 15. An α-helix is a DNA structure is a protein structure winds to the left winds to the right is stabilized by hydrogen bonds is stabilized by disulfide bonds (3) 16. Ribosomal RNAs code for ribosomal proteins function in transcription of genes are the most abundant ribonucleic acids in cells are not found in mitochondria (1)
4 4 17. DNA is a polypeptide contains ribose contains guanine is always double-stranded is stabilized by base stacking (2) 18. Partial linkage was discovered in the eighteenth century was discovered by Gregor Mendel is used in physical mapping is only found for sequences that are on the same chromosome (1) 19. All template-dependent DNA polymerases use DNA as template synthesize DNA in 3 -> 5 direction require a primer to initiate DNA synthesis have also 5 -> 3 exonuclease activity (1) 20. β-sheets are stabilized by hydrophobic bonds ionic bonds hydrogen bonds covalent bonds all of the above none of the above (1) Total number of correct answers: 32 Try also to answer the multiple choice questions of chapters 1 to 5 in the Genomes 3 textbook. The answers to these questions can be found in a separate file (MCQ Chapters 1-9 Genomes3.pdf) in the Colloquia folder.
5 5 Home work (to copy and paste sequences and URLs please use the file that will be posted in the "Colloquia" folder on the MBV2010 web site) Annotating a genome sequence is mostly done by computers. Many of the annotation programs are freely available on the internet. Try to annotate the sequence below (5054 bp) from the chloroplast genome of the unicellular green alga Chlamydomonas reinhardtii. aaaaacacgccctgtaggaattgaacccacgacatcaggttttggaaacctgcgttctaccgactgaac taaggacgtaaaatttgttattataatttttatcatggtattattttaatgtcaatcagagtatttcac tacaaattgattttattgatatagttgttaatcatgggttaatttgtcttgaatttagtgattttatat taagggataccttgtagtgatatcccttaatataaaaacgaatatatatgtaactgcggtcaagctata gaccagttagagtaatacttatgcaagctacacaactaaaagatgaattccatattactaactattact ttcttgcgtttgtgtactatcacctactaaactagctcgactttctaataaacgttcttgtttactatc atgataactccaaacttgatttgtcatttctacaatactatgcattacttcatttgttgcaatttcatc agctaaaccataataaattgtttccattgcagttaaataaaaatcacgatctaaatcacgtaaaatttt atgtcttggtcggtacgttgataaagaataaatttctgctacatctaaacgaattttcataatttcttg actatcaatccaaatatctgaagcttgtccatttaaaccaccttcaggttggtgaatcatagtatgaca accttcagtaacataacgttcaccaattgtaccaccagctaaagctaaagaagcagcagatgcagctac acctaatgctaacgttaaagaacctgctttaataaattgtaaagcatcatgtacagtaataccattacc tacagaaccgccaaatgagttaataatcatgaacactttcttagattcttcttcttgaataacgcgttc tgtttgtttacgatataaagaacgacctgattcattatttaatgcaccttgatcaaggtaattataagc ttttaaagctttactattcgataatccaccagaacctaaacgttcttgaacataacgttgttttaaacg acgtcgacctaatgctttttcagacgaagctacaagcttttcagggctttgtaatctattcattaattc tttgtgtgataaattatcaattaatttttttgtaaaaggttggtttgtattttgtgtactagtttttaa tagtgaataaatttctgctaaattttgattagggtgttctaaattataattttgaggtgcaaaattagc taataatctaaatggagaatatacatctaaattttgttttacattttttgaccctgttgaaaaattttt tagattttttaaatttttaattaattttgtcatttcagcaggattttgaaaagcttgtttattcgcaga agatttagcaaaatttaaattagcagaatctttgtcttgattaggtgaaaaatctttagataaaatatc agctaaatagtataaataaggttcatcagaataatcaaaaaactgtgcgttccagtttaaccattccgt tgtaattttttgtaaagtatattgttctaacaggtgattttcttcaataccaaaatcattatctgaagt taataaatcttccacagattgacgttttgcactagcgccgccagataaattttctttttttactgtatc ttttccttttgtttttgcggtgccacttttaaataatccacttttttccatttcttttttttccaactc tttagaacgatcttccatatggatattaattaataaaccacaaatttggttacataattcatcatctaa atattgcattaaaaataccatacgacgacggaaaataaagttataaatatcagtccactgtgcaggtaa ttcttcaccccaacaataaataatacgaggtactccaatcggcataaattactttgttaataaaatgtt gtgttttattaatactagtctaatatcctagtagatagagcttttatttgcacgtaaataagctctgcg agtgctactgtaaaaattaaagtaccgtttacaggctcctttgaagcaaataaaaattttaaaccaaaa tggtttaaaaaatagataaattcaaacaaatattggctctacgttaaacttaaaatgccttcggccgga tttgaaccggcacgcctttcagcactggttcctaaaaccaggatgtctaccagttccatcacgaaggct aaaaaatattacttttataatatcatacttaattttttttgtctagttaaaaacactaaatgtgttaaa tgcatacacaattttttgtttagactagagacttggggttagttccgatcctttaaccagaatataact atggttaatttatagctaccccttatcaatgggccaacgggggatctggcagaaaccgccttgtcgaaa taaatagcacactcttgcatatctatattttaagatgtcagctttttgattcattgagttgtatatttt atttactttactagggtgtttatatattcctttttggggttgcccagatagttatataaccaatcacaa caacagtaaaaattgaagtttatttacccaaaggggtgtatcccctttgggtaaataaacttcaatggc caactgccttggaaacttacgtagcagcctaaaaaaagctagtcttatatccgaagcaagtaaaagaaa tggatattaaatattatagaggacctgaaataccttgtttacgaatcattaagaagtgcattaacatga aaacagctgttaaaagtggtaatacgaaagtgtgtaaactgtagaaacgtgttaaagttgcttgaccaa caccaacaccaccacgtaataactcaacaatgaaaccaccaacacctgggattgcatcaggaacacctg ttacaattttaaccgcccagtaaccaacttggtcccatggtaatgaataacctgttacaccaaaagaaa ctgtacatacagccatgattacacctgtaacccatgttaattcacgtggacgtttgaaaccacctgtta aatatacacggaaaacgtgtaaaaccatcataagaaccatcatactagctgaccaacggtgaattgaac gaattaaccaaccaaagttaacatcagtcataatgtattgtactgatgcgaaagcttctgctactgttg gacggtagtagaaagtcatagcaaaaccagtagctacttgcacaaggaaacatgtaaaagtaataccac caatacagtagaaaatatttacgtgtggtggaacatatttacttgtaatatcatcagcaattgcttgaa tttctaaacgttcttcaaaccaatcgtatactttactcatataaaatttttataagattgtgacatgac cattaggctttcttaagactaaaaaaatgtgtagcttaattatttaaagtttaaattaaagttataata
6 6 tatattatatataaaataaaaaaaacgttagtaattcaaaagttttaatattatacaattgaactatta tgtattaaatataagaatgtcacctcttaccatatttctatactccaaagtaactttttacataaatgt cccctctggggctgcctccttccccttccccttcggtatataaatatagggcaagtaaacttagcataa actttagttgcccgaaggggtttacatactccgaaggaggacaaatttatttattgtggtacaataaat aaattgtatgtaaacccctttcgggtaactaaagtttatcacggcaataagtttctgcttacgcagtat tatatctgacgcagtattatataagaagttggcaggataaaaatgtgtaagtatggcaatcttttaaaa tagtgttcaattcatttaaggcagataaaaagaaaaaagtccacaggatttaattttgaatagttctct atcaaaaaaaggtttgccgaacaatgtttttattcctggagtttgattttatgaaattagctgtttacg gaaaaggtggtattggaaaatcaacgacaagttgtaatatttcgattgctttacgaaaacgtggtaaaa aagtgttacaaattggttgtgatcctaaacatgatagtacttttacattgacagggtttttaattccaa ccattattgatacattaagttctaaagattatcattatgaagatatttggcccgaagatgttatttacg gaggttatgggggtgtagattgtgttgaagctggaggaccacctgccggtgcggggtgtggtggttatg ttgtaggtgaaacggtaaaacttttaaaagagttaaatgcttttttcgaatacgatgttattttatttg atgttttaggtgatgttgtttgtggtggctttgctgctccattaaactacgctgattattgtattattg taactgataatggttttgatgctttatttgctgcaaatcgtattgcagcttcagttcgtgaaaaagcac gtacacatccattgcgtttagcgggtttaatcggaaatcgtacatcaaaacgtgatttaattgataaat atgtagaagcttgtcctatgccagtattagaagttttaccattaattgaagaaattcgtatttcacgtg ttaaaggcaaaactttatttgaaatgtcaaataaaaataatatgacttcggctcatatggatggctcta aaggtgacaattctacagtaggagtgtcagaaactccatcggaagattatatttgtaatttttatttaa atattgctgatcaattattaacagaaccagaaggagttattccacgtgaattagcagataaagaacttt ttactcttttatcagatttctatcttaaaatttaataagaataaagcagctttaaatactttcctgttt ataatttaggaaattaaatggatatttgttgaaactaatccccagttggatacccattggtagttaatt gccactgcctgcttcaccttacaaaatgtatggacacaaaacggctaataaatacagactcccggtggc atttgttggctgcttcg Try to answer the following questions: 1. How many protein-coding genes are in the sequence? (you can use the following server to identify open reading frames: ) There are 3 coding regions in the sequence: #1 in 5'->3' frame 3 (coding for a protein of 302 aa) #2 in 3'->5' frame 2 (coding for a protein of 215 aa) #3 in 3'->5' frame 3 (coding for a protein of 524 aa) 2. Are the genes located on the same DNA strand? No. One gene is on the sequence shown, the other two genes are on the complementary strand. 3. What are the functions of the proteins encoded by the genes? (use the BLAST server (protein BLAST) to identify the function of the genes: S=blastp&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=bl asthome #1 is a protochlorophyllide reductase (involved in chlorophyll synthesis) #2 is cytochrome b6 (functions in the photosynthetic electron transport chain) #3 is the proteolytyic subunit of an ATP-dependent Clp protease (a serine protease)
7 7 4. Do the proteins contain any conserved domains that are also found in other proteins? Yes. All three proteins contain conserved domains that are also found in other proteins.
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationPROTEIN SYNTHESIS. Higher Level
PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationResources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationExam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationIntroduction to Cellular Biology and Bioinformatics. Farzaneh Salari
Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationMBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationExam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationBIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life
BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationTranscription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationDNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More information9/3/2009. DNA RNA Proteins. DNA Genetic program RNAs Ensure synthesis of proteins Proteins Ensure all cellular functions Carbohydrates (sugars) Energy
Structure Properties Functions of the cell Chemical organization of the cell Based on molecular substrate : DNA contains information RNA ensures protein synthesis Proteins ensure vitality Relations between
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationSection 3: DNA Replication
Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication
More informationFind this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationChapter 3.5. Protein Synthesis
Chapter 3.5 Protein Synthesis Summary of Protein Synthesis How chemical Information is transfer during protein synthesis DNA mrna protein transcription the step from DNA to mrna occurs in the nucleus where
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationStudent name ID # Second Mid Term Exam, Biology 2020, Spring 2002 Scores Total
Second Mid Term Exam, Biology 2020, Spring 2002 Scores 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Total 1 1. Matching (7 pts). Each answer is used exactly once Helicase
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationUNIT 3 GENETICS LESSON #41: Transcription
UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationRegulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationHow to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationBiology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationPrinciple 2. Overview of Central. 3. Nucleic Acid Structure 4. The Organization of
Central dogma I and II the flow of genetic information 1. The Transforming Principle 2. Overview of Central Dogma 3. Nucleic Acid Structure 4. The Organization of DNA in Cells 5. DNA Replication 6. Gene
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationUnit 1. DNA and the Genome
Unit 1 DNA and the Genome Gene Expression Key Area 3 Vocabulary 1: Transcription Translation Phenotype RNA (mrna, trna, rrna) Codon Anticodon Ribosome RNA polymerase RNA splicing Introns Extrons Gene Expression
More informationDNA, RNA, and PROTEIN SYNTHESIS
DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationAdvanced Algorithms and Models for Computational Biology
10-810 Advanced Algorithms and Models for Computational Biology Ziv Bar-Joseph zivbj@cs.cmu.edu WeH 4107 Eric Xing epxing@cs.cmu.edu WeH 4127 http://www.cs.cmu.edu/~epxing/class/10810-06/ Topics Introduction
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationDNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?
DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationM1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationDNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationPRINCIPLES OF BIOINFORMATICS
PRINCIPLES OF BIOINFORMATICS BIO540/STA569/CSI660, Fall 2010 Lecture 3 (Sep-13-2010) Primer on Molecular Biology/Genomics Igor Kuznetsov Department of Epidemiology & Biostatistics Cancer Research Center
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More information