Supplemental Data. Chromosomal Translocation Mechanisms. at Intronic Alu Elements in Mammalian Cells

Transcription

1 Supplemental Data Chromosomal Translocation Mechanisms at Intronic Alu Elements in Mammalian Cells Beth Elliott, Christine Richardson, and Maria Jasin Supplemental Experimental Procedures DNA manipulations and cell line constructions For the p5 allele, the MLL intron 1 Alu element was PCR amplified from genomic DNA from 293 cells (ATCC) using primers AluF2 (5 CCGCTCGAGACTGTAGTCTGTGTTCCTTAA) and AluR2 (5 GCATTACCCTGTTATCCCTATTTTTTTTGAGACGGAG). For the pf allele, the MLL intron 1 Alu element was PCR amplified using primers AluF3 (5 CGTAGGGATAACAGGGTAATGGCTGGGCACAGTGGT) and AluR3.5 (5 AAGCTAGCGGCTGAAATTCTCCTCTTC). For the Rb allele in the Hom Alu cell line, the intron 1 Alu element was amplified with primers HomAluF (5 CGATTACCCTGTTATCCCTAGGCTGGGCACAGTGGT) and AluR3.5. For the Rb allele in the Het Alu cell line, the intron 6 Alu element was amplified with primers AluEx9F (5 AGTGGCTCCCCGCCCAAGTATCCCTGT) and AluEx10R (5 TTCTCCTGCTTATTGACCGGAGGTGG). Then the PCR product from this reaction was used as the template in a second PCR reaction with the primers Alu-In9F (5 AAGCTAGCTTTTTTTTGGGATGGAGTC) and Alu-In9R (5 CGTAGGGATAACAGGGTAATGGCAAGGCGCAG). Targeting vectors were introduced in the murine hprt- ES cell line E14TG2a, as described previously (Richardson et al., 1998). The PimI translocation substrate was made in 5 steps and constructs were labelled p1 to p5. p1 was made by cloning a XhoI fragment from p-i-neo into the XhoI site in plitmus 28. p2 was made by inserting a PCR fragment into the SalI and I-SceI-digested p1. This PCR fragment was amplified using the primer AluF2 and AluR2 and human 293 genomic DNA (ATCC) as the template, and then was digested with XhoI and I-SceI. p3 was made by cloning the XhoI fragment of p2 into the SalI site of the PimI/hyg gene targeting vector (Richardson et al., 1998). p4 was made by cloning the LPF2/R2 linker into p3 digested with I-SceI and NotI. This linker was made by annealing the LPF2 oligo (5

2 CAGGGTAATATCGATGATATCGC) and the LPR2 oligo (5 GGCCGCGATATCATCGATATTACCCTGTTAT). p5 was made by cloning the AccI/PvuII fragment of pgkpuro into p4 digested with ClaI and RV. The Rb translocation substrate was made in 6 steps and constructs were labelled pa to pf. pa was made by cloning the SalI fragment of p-i-neo into pbs digested with XhoI and SalI. pb was made by cloning the palink2f/2r linker into pa digested with XhoI and ClaI. This linker was made by annealling the palink2f oligo (5 CGATAGGCCTTAGGGATAACAGGGTAATGCTAGCC) and the palink2r oligo (5 TCGAGGCTAGCATTACCCTGTTATCCCTAAGGCCTAT). pc was made by inserting a PCR fragment into the I-SceI and NheI-digested pb. This PCR fragment which was digested with I-SceI and NheI was amplified using the primers AluF3 and AluR3.5. pd was made by cloning the ClaI/BalI fragment of pgkpuro into ClaI and StuI-digested pc. pe was made by cloning the pelinkerf/r into the ApaI site of pd. This linker was made by annealing the pelink oligo (5 CTCTAGAGGGCC) to itself. pf was made by inserting the XbaI fragment of pe into a modified Rb vector, prb-d. prb-d was made in 4 steps and the constructs were labelled prb-a to prb-d. prb-a was made by inserting the Rb-ALinkerF/R into the NheI site of plitmus 39. This linker consisted of Rb-ALinkF oligo (5 CTAGCTCTAGAAGATCTG) annealed to the Rb-ALinkR oligo (5 CTAGCAGATCTTCTAGAG). prb-b was made by inserting the BglII fragment of pgkhprt into the BglII-digested prb-a. prb-c was made by cloning the Rb-BLinkF/R into the ClaI site of prb-b. This linker was made by annealing the Rb-BLink oligo (5 CGATTCTAGAAT) to itself. prb-d was constructed by cloning the NheI/XbaI fragment of prb-c into a previously modified Rb vector (te Riele et al., 1990). The Rb translocation substrate was modified to contain an I-SceI site in the reverse orientation. This construct, pf51#8(rev-i-scei), was made by digesting pf with I-SceI and inserting the Rb-RvF/R linker. This linker consisted of annealing the Rb-RvF oligo (5 ATTACCCTGTTATCCCTAATAA) to the Rb-RvR oligo (5 TAGGGATAACAGGGTAATTTAT). The modified Rb translocation substrate, pf51#8(rev-i-scei), was further modified to make the construct phomalurb#26 by digestion with I- SceI and NheI, and inserting a PCR product. The PCR product was made using the primers HomAluF and AluR3.5, with the template pc, and then digestion with I-SceI and NheI. The modified Rb translocation substrate, pf51#8(rev-i-scei) was further changed to make the construct HetAluRb-J.

3 This was done by cloning the Alu element in intron 6 of the MLL gene. The first PCR reaction was performed using the primers AluEx9F and AluEx10R and the template human 293 genomic DNA. Then the PCR product from this reaction was used as the template in a second PCR reaction with the primers Alu-In9F and Alu-In9R. This PCR product was cloned into a TA vector (Stratagene) to create the vector, phetalu-g. A third PCR reaction was done with primers HetAlu-F (5 CGATTACCCTGTTATCCCTAGGCAAGGCGCAG) and Alu-In9F and the template phetalu-g. This PCR product was digested with I-SceI and NheI and cloned into pf51#8(rev-i-scei) which had been digested with I-SceI and NheI. Five cell lines were constructed for translocation recombination assays. The first cell line, p5aa36, was made by electroporating the p5 substrate digested with XhoI into the murine ES cell line E14GT2a. hyg R colonies were isolated and Southern blot analysis (which was also done on all subsequent cell lines) showed that the p5 substrate was correctly targeted as a single copy to the PimI locus in clone p5aa36. The new PimI allele was referred to as the p5 allele. The second cell line, p5pf, was constructed by electroporation of NotI-digested pf substrate into the p5aa36 cell line to create the new Rb allele, pf. HAT R colonies were isolated and 3 independent clones, p5pf #5, 6 and 18, were selected for further use. The third cell line, Rev48, was the same as the p5pf cell line except that the I-SceI site was in the reverse orientation. This cell line was constructed by transfecting NotIdigested pf51#8(rev-i-scei) into the p5aa36 cell line. Colonies which were HAT R were isolated and the Rev48 clone were chosen since the construct had been correctly targeted. The fourth cell line, Hom Alu, was the same as Rev48 cell line, except that 13 bp of the former forward I-SceI site had been removed by cloning. This cell line was made by electroporating the NotI-digested phomalurb-26 substrate into p5aa36 cell line. HAT R colonies were selected and two clones, Hom Alu 3-3 and 6-9, were correctly integrated. The fifth cell line, Het Alu, was the same as the Hom Alu cell line, except that the Alu element from intron 6 of MLL gene replaced the Alu element from intron 1. For construction of this cell line, the NotI fragment of phetalurb-j was electroporated into the p5aa36 cell line. Three clones, Het Alu 1-20, 2-17, and 5-9, which were HAT R had all correctly integrated the targeted substrate. Southern blot analysis of genomic DNA was performed on putative targeted clones and neo + and puro + recombinant clones. For targeting at the PimI locus, the p22 probe (a HincII-BstXI PimI fragment)

4 was used for hybridization to HincII-digested DNA (te Riele et al., 1990). For targeting at the Rb locus, probe A (a PstI-PvuII Rb fragment was used for hybridization to PstI-digested DNA (te Riele et al., 1992). Translocation analysis To characterize neo + clones by Southern analysis, genomic DNA was digested with EcoRI and HincII, and probed with either a 5 neo probe (XhoI/SphI neo fragment), or a 3 neo probe (NcoI/BamHI neo fragment). The der(17) chromosome had a different sized EcoRI/HincII fragment from the parental 3.8 kb fragment derived from the chr. 17 translocation substrate (Fig. 2B, C). A der(17) arising by SSA contained one Alu element at the breakpoint junction, detected as a 1.9 kb fragment (e.g., clone 18G-13; Fig. 2C), while a der(17) chromosome arising by precise NHEJ or by NHEJ with a small deletion or insertion contained two fused Alu elements, giving rise to a 2.2 kb fragment (e.g., clone 6G-7). Larger deletions or insertions (e.g., clone 18G-3) gave fragments less than or greater than 2.2 kb, respectively. For puro + recombinant clones, EcoRI and HindIII genomic digests were performed and hybridized with either a 5 puro probe (EcoRI/SalI puro fragment) or an internal puro probe (SalI/NcoI puro fragment). Southern blot analysis gave two puro gene fragments of 1.3 and 2.2 kb from chrs. 14 and 17, respectively, in the parental cell line. By contrast, der(14) gave a single puro gene fragment as a result of the translocation (Figure 2B). A functional puro gene formed by the SSA translocation pathway gave a 1.8 kb band (e.g., clone 5G-23; Figure 2C), whereas fusion of 5 puro and 3 puro by NHEJ without significant sequence loss or addition gave a 2.0 kb fragment (e.g., clone 6G-11). Deletion or insertion of a significant number of nucleotides at the breakpoint junction during NHEJ resulted in a fragment of greater than 2.0 kb (e.g., clone 18G-3) or less than 2.0 kb (data not shown), respectively. PCR analysis was done on all neo + clones to examine the neo and puro loci. For the neo locus, clones were PCR amplified with neosd and SAneo primers (see arrows Fig. 2B): CAR-A (5 GTCGATCAGGATGATCGGA) and 3 N (5 CCTCAGAAGAACTCGTCAAGA). Amplification was performed by denaturation at 94 o C for 3 min, followed by 30 cycles of 94 o C for 1 min, 58 o C for 1

5 min, 68 o C for 2 min, and then extension at 68 o C for 15 min. Since the primer sequences are on separate chromosomes in the parental cell line, no product is obtained (Fig. 2D). For clones that had undergone SSA at the Alu element, a PCR product of 1.0 kb is obtained (e.g., clones 5G-10 and 5G- 27); for clones that undergone precise or nearly precise NHEJ, a product of 1.3 kb is obtained (e.g., clone 5G-11). Large deletions of insertions would give rise to products less than or greater than 1.3 kb (data not shown). For the puro locus clones were PCR amplfied with primers purof (5 ATGACCGAGTACAAGCCCACGGTG) and puror (5 TCATGCACCAGGTGCGCGGTCCTT). Amplification was performed by denaturation at 95 o C for 3 min, followed by 30 cycles of 95 o C for 30 sec, 60 o C for 30 sec, and 67 o C for 1 min, and then extension at 72 o C for 15 min. For clones that had undergone an SSA event at the puro repeat, a 0.6 kb fragment was obtained (e.g., clones 5G-6 and 5G- 11), whereas a 0.8 kb fragment was obtained from a der(14) arising by NHEJ of the puro sequences (e.g., clone 5G-29) (Fig. 2B). Southern and PCR analyses were in complete agreement for all clones tested by both methods and indicated that all derivative chromosomes were formed by either SSA or NHEJ rather than HR. In one additional test, neo+ clones were screened for puromycin resistance. As expected, puro+ clones were determined to have undergone SSA at der(14) resulting in a full length puro+ gene, whereas puroclones had undergone NHEJ. DNA sequencing was performed by the Bio Resource Center, Cornell University, Ithaca, NY. PCR products of neo + clones were sequenced at the neo and puro loci with the same primers that were used in PCR amplification. FISH was performed by the Molecular Cytogenetics Core Facility at Sloan-Kettering Institute. Chromosome metaphase spreads were made from individual clones using standard procedures. For visualization of translocations the FITC (green) probe (Cambio # MF-01) was hybridized to mouse chromosome 14, and the Cy3 (red) probe (Cambio # MCy3-01) was hybridized to mouse chomosome 17. Images were captured using a digital FISH work station (Metasystems). FISH

6 analysis included 14 p5pf clones (6 Class 1 clones and all of the Class 2, 3, and 4 clones) and 12 Het Alu clones for which breakpoint junction sequences were shown (Fig. 4B). Supplemental References Richardson, C., Moynahan, M. E., and Jasin, M. (1998). Double-strand break repair by interchromosomal recombination: suppression of chromosomal translocations. Genes Dev 12, So, C. W., Ma, Z. G., Price, C. M., Dong, S., Chen, S. J., Gu, L. J., So, C. K., Wiedemann, L. M., and Chan, L. C. (1997). MLL self fusion mediated by Alu repeat homologous recombination and prognosis of AML-M4/M5 subtypes. Cancer Res 57, Strout, M. P., Marcucci, G., Bloomfield, C. D., and Caligiuri, M. A. (1998). The partial tandem duplication of ALL1 (MLL) is consistently generated by Alu-mediated homologous recombination in acute myeloid leukemia. Proc Natl Acad Sci USA 95, te Riele, H., Maandag, E. R., and Berns, A. (1992). Highly efficient gene targeting in embryonic stem cells through homologous recombination with isogenic DNA constructs. Proc Natl Acad Sci USA 89, te Riele, H., Maandag, E. R., Clarke, A., Hooper, M., and Berns, A. (1990). Consecutive inactivation of both alleles of the pim-1 proto-oncogene by homologous recombination in embryonic stem cells. Nature 348, Figure S1. Incorporation of Alu elements from MLL into the translocation substrates (A) In the p5pf, Rev48, and Hom Alu cell lines, the Alu lements on both the chr. 17 and chr. 14 substrates are identical, being derived from ntron 1 of MLL. In the Het Alu cell lines, the chr. 17 substrate contains the Alu element rom intron 1, and the chr. 14 substrate contains the Alu element from intron 6 of MLL. n the p5pf cell lines the I-SceI sites are in the same relative orientation on chr. 17 and 4, whereas for the Rev48, Hom Alu, and Het Alu cell lines the I-SceI sites are in opposite orientation. Because the Het Alu cell lines contained sequence changes near the -SceI site as compared with Rev48, we recloned the intron 1 Alu element into the chr. 14 argeting vector in an identical

7 manner as in the Het Alu cell lines to construct two Hom lu cell lines (see Supplemental Data). Thus, the Hom Alu and Het Alu cell lines are identical except for the Alu elements themselves. The Hom Alu cell lines had an average frequency of x 10-5 of neo+ colonies, which were found to contain reciprocal chromosomal translocations. We analyzed a number of neo+ clones from the Hom Alu cell lines and found that, as with the p5pf and Rev48 cell lines, SSA predominated as the translocation pathway for both derivative chromosomes (data not shown). (B) Recombination in the MLL gene between an intron 1 Alu element and an intron 6 Alu element, which leads to a partial tandem duplication of the gene (shown by the bracket), as seen occurred in AML patients #20 (So et al., 1997) and #300 (Strout et al., 1998) (Fig. 4D). Arrows with jagged tails indicate breakpoints, and the straight arrow at the hybrid Alu element indicates the breakpoint junction. The start of the intron 1 Alu element is located 1679 bp upstream of exon 2 in MLL; the start of the intron 6 Alu element is located 457 bp downstream of exon 6. bcr, breakpoint cluster region; thin vertical bars, exons; thick horizontal bars, intronic Alu elements.