Jing Liao, Chun Cui, Siye Chen, Jiangtao Ren, Jijun Chen, Yuan Gao, Hui Li, Nannan Jia, Lu Cheng, Huasheng Xiao, and Lei Xiao

Size: px
Start display at page:

Download "Jing Liao, Chun Cui, Siye Chen, Jiangtao Ren, Jijun Chen, Yuan Gao, Hui Li, Nannan Jia, Lu Cheng, Huasheng Xiao, and Lei Xiao"

Transcription

1 Cell Stem Cell, Volume 4 Supplemental Data Generation of Induced Pluripotent Stem Cell Lines from Adult Rat Cells Jing Liao, Chun Cui, Siye Chen, Jiangtao Ren, Jijun Chen, Yuan Gao, Hui Li, Nannan Jia, Lu Cheng, Huasheng Xiao, and Lei Xiao Supplemental Experimental Procedures Cell culture. Rat bone marrow cells (BMC) were cultured in αdmem culture medium (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum. Rat primary ear fibroblasts (PEF) were cultured in DMEM culture medium (Invitrogen) supplemented with 10% fetal bovine serum. Rat ips cells were maintained on irradiated mouse embryonic fibroblasts (MEF) in Knockout DMEM supplemented with 10% ES cell qualified fetal bovine serum, 10% KnockOut serum replacer, 0.1 mm non-essential amino acids, 1 mm L-glutamine, and 0.1 mm ß-mercaptoethanol (ES media) (all from Invitrogen, Carlsbad, CA). Rat ips cells were trypsinized into single cells with TTL trypsin and split at a ratio of 1:10 every 3 days. To form embryoid bodies, rat ips cells were trypsinized into single cells and transferred to a Petri dish in differentiation medium consisting of DMEM (Invitrogen) supplemented with 10% fetal bovine serum. Lentiviral transduction and reprogramming culture. The cdna of human gene were inserted downstream of EF-1 alpha promoter and upstream of IRES-EFGP of lenti-vector(liao et al., 2008). Half a million rat PEF or BMC from SD rat were transduced with a lentivirus carrying GFP (negative control) or a cocktail of lentivirus carrying reprogramming factors at day 0. Two days later, cells were dissociated with trypsin and transferred to 6-well plates coated with an MEF feeder and cultured in ES media. On day 10, the ips colonies were picked, dissociated by trypsin digestion, and plated into new culture dishes. Immunostaining. Immunostaining was carried out similarly as described (Xiao et al., 2006). The primary antibodies used were anti-nanog (R&D Systems), anti-ssea1 (Developmental Studies Hybridoma Bank), anti-ssea3 (Developmental Studies Hybridoma Bank) and anti-ssea4 (Developmental Studies Hybridoma Bank), anti-alpha-fetal protein (AFP) (Abcam, ab46799). AFP was used as a marker of gut-like epithelia in teratoma(aleckovic and Simon, 2008). The photo of SSEA1 staining was acquired by confocal microscopy. 1

2 Real-time reverse transcription-polymerase chain reaction. Total RNA was prepared using the RNAeasy kit (Qiagen) and used as a template for reverse transcription-polymerase chain reaction (RT-PCR). Real-time PCR was performed in an Eppendorf Mastercycler ep realplex real-time PCR system using a SYBR Green-based PCR Master mix (TOBOYO). PCR primers are listed in Supplemental Table S2. A standard curve for both the gene of interest and the endogenous control (GAPDH) were acquired. The unit defined by standard curve is copy number. The CT data of the gene of interest and the endogenous control (GAPDH) obtained from the real time PCR were transform into copy number by the standard curve. The expression value of each gene was normalized to the amount of glyceraldehyde-3-phosphate dehydrogenase cdna in order to calculate the relative amount of RNA present in each sample. The copy number of the target gene was defined as copies per 10 6 copies of GAPDH. Microarray Total RNA was extracted with TRIZOL reagent (Invitrogen) and further purified using an RNeasy column (Qiagen, Hilden, Germany, The labeling procedure was carried out by using a RNA Fluorescent Linear Amplification Kit (Agilent Technologies, Palo Alto, CA, agilent.com). The sample and control were labeled with cy-3 and cy-5, respectively. Fragmentation was carried out by incubating at 60 C for 30 minutes in fragmentation buffer (Agilent Technologies) and stopped by adding equal volume of hybridization buffer (Agilent Technologies). Fragmented target was applied to Whole Genome Oligo Microarray of rat, mouse and human, respectively (Agilent Technologies). Hybridization proceeded at 60 C for 17 hours in a hybridization oven (Robbins Scientific, Sunnyvale, CA). The hybridized array was scanned with Agilent microarray scanner. The TIFF image generated was loaded into Feature Extraction Software (Agilent Technologies) for feature data extraction. The data analysis was performed with GeneSpring To do a cross-species comparison, we have to set a baseline for each species. Then we can compare sample versus the baseline to get relative data (a ratio of change). At the end, we can compare the relative data in different samples to get the information of the similarity of the samples from different species. MEFs are a mixture of many cell types. A mixed cell sample for the rat or human should be more similar to MEF than one cell type. To identify the enriched genes, mouse cells were compared with murine embryonic fibroblast (MEF), human cells were compared with a mixture (1:1) of Human newborn foreskin fibroblasts (ATCC, catalog number CRL-2097) and IMR90 fetal fibroblasts (ATCC, catalog number CCL-186), and rat cells were compared with a mixture (1:1) of BMC and PEF. MEF, human foreskin fibroblast cells and human fetal lung cell were routinely used to produce mouse and human ips cells, respectively(park et al., 2008; Takahashi and Yamanaka, 2006; Yu et al., 2007). BMC and PEF were the cells used to produce rat ips cells in our study. The significantly enriched genes were selected according to the following criteria: P 0.01 and fold change 3. The ortholog search was performed with GeneSprings The signal ratios of orthologous genes were used to perform hierarchical clustering (conditioned tree) with GeneSpring The signal ratio is log ratio unless specifically defined. The microarray data have been submitted to GEO. Accession number is GSE

3 Note: 1. The probes on the Agilent Oligo Microarray were designed to locate in the 3 -UTR region of each gene. Rat Nanog(ACCESSION NO. AB275459)doesn t contain 3 -UTR. Therefore, there is no probe for Nanog in Agilent Oligo Microarray. The exogenous genes don t contain 3 -UTR neither. 2. The probe on rat microarray, A_44_P506024, represents rat sox2 (IMAGE clone: ). Bisulfite genomic sequencing Bisulfite treatment was performed using the CpGenome modification kit (Chemicon) according to the manufacturer s recommendations. PCR primers are listed in Table S3. Amplified products were cloned into T-vector, and at least ten randomly selected clones were sequenced. Telomerase activity of ips cells The telomerase activity of the ips cells and ES cells was determined with the TRAPEZE telomerase detection kit (Chemicon) according to the manufacturer s recommendations. The lysates were heated at 85 C for 10 minutes and used as negative controls. Reactions were separated with non-denaturing TBE-based 12% polyacrylamide gel electrophoresis and visualized with SYBR Gold staining. Teratoma formation Cells were injected intramuscularly into non-obese diabetic/severe combined immune deficient (NOD/SCID) mice (~ cells per site). After 4 6 weeks, tumors were processed for hematoxylin-eosin staining. All animal experiments were conducted in accordance with the Guide for the Care and Use of Animals for Research Purposes and were approved by the SIBS Animal Care Committee. Supplemental References Aleckovic, M., and Simon, C. (2008). Is teratoma formation in stem cell research a characterization tool or a window to developmental biology? Reprod Biomed Online 17, Liao, J., Wu, Z., Wang, Y., Cheng, L., Cui, C., Gao, Y., Chen, T., Rao, L., Chen, S., Jia, N., et al. (2008). Enhanced efficiency of generating induced pluripotent stem (ips) cells from human somatic cells by a combination of six transcription factors. Cell Res 18, Park, I. H., Zhao, R., West, J. A., Yabuuchi, A., Huo, H., Ince, T. A., Lerou, P. H., Lensch, M. W., and Daley, G. Q. (2008). Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451, 3

4 Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, Xiao, L., Yuan, X., and Sharkis, S. J. (2006). Activin A maintains self-renewal and regulates fibroblast growth factor, Wnt, and bone morphogenic protein pathways in human embryonic stem cells. Stem Cells 24, Yu, J., Vodyanik, M. A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J. L., Tian, S., Nie, J., Jonsdottir, G. A., Ruotti, V., Stewart, R., et al. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318,

5 Table S1. Characterization of rat ips cell lines. Cell name AP SSEA1 SSEA3 SSEA4 NANOG Teratoma Karyotyping Telomerase PEF ND 42XY - BMC ND 42XY - M11 + ND ND ND ND - ND ND M ND ND + M XY + F ND + F ND ND ND ND F XY + F ND + F ND ND ND F XY + F ND ND ND 5

6 Table S2. Primers for RT-PCR Gene Name Oct4 endo-f Oct4 endo-r Oct4 exo-f Oct4 exo-r Sox2 endo-f Sox2 endo-r Sox2 exo-f Sox2 exo-r Nanog endo-f Nanog endo-r Nanog exo-f Nanog exo-r Nodal-f Nodal -r Fgf4-f Fgf4-r Gal-f GalL-r Sequence CGAGGCCTTTCCCTCTGTTCCT TCTCTTTGTCTACCTCCCTTCCTTGC AGAAGGATGTGGTCCGAGTGTG CAGAGTGGTGACAGAGACAGGG GGCCATTAACGGCACACTGCC TTACTCTCCTCTTTTGCACCCCTCC TCTTGGCTCCATGGGTTCGG AGTGCTGGGACATGTGAAGTCTG ACCTACCTCTTCAAGATAGCCCTG ACCTTTGCCTCTGAAACCTATCCT GCTGAGATGCCTCACACGGA GGTCTTCACCTGTTTGTAGCTGAG GAGCGTGTTTGGATGGAGAGG ATGCCAACACTTTCCTGCTTGAC GTGTGCCTTTCTTTACCGACGAGTG GGAAGTGGGTTACCTTCATGGTCG TGGAAGTGGAGGAAGGGAGACTAGG GGGATGCCAGGCAGGCTGTC 6

7 Leftyb-f Leftyb-r Lin28 3'UTR-f Lin28 3'UTR-r Gabrb-f Gabrb-r Sox17-f Sox17-r AFP-f AFP-r NCAM-f NCAM-r PAX6-f PAX6-r SM22-a-f SM22-a-r Myod-f Myod-r TGACCATCAGGTGGCCATTTCTG TGTTGGGCAGGCTGACCACTTG CGGGAGGAGGAAGAAGAGATCCAC CCACTCTGCGGATTGATGCCTC AATCAACCGGGTGGATGCTC GTGCGGGATGCTTCTGTCTC GGCACGGAACCCAACCAGC CAGTCGTGTCCCTGGTAGGGAAGAC TCTGAAACGCCATCGAAATGCC AATGTAAATGTCGGCCAGTCCCT TGCTCAAGTCCCTAGACTGGAACG CTTCTCGGGCTCTGTCAGTGGTGTGG TGCTCAAGTCCCTAGACTGGAACG GGACGGGAACTGACACTCCAGG GCTGAAGAATGGCGTGATTCTGAG CCTTCAAAGAGGTCAACAGTCTGG GCTCAGGAAGATTGCTGTGTCCA CCGCAACACTCCATGCATATCTCC 7

8 Table S3. PCR primers for Bisulfite genomic sequencing Name Sequence Region (ATG +1) roct4-of-1 TTATAGTGAATGTATAGATATTGGGAG -1794bp~-1202bp roct4-or-1 CCTCCAAAATCCCATTACTAAC -1794bp~-1202bp roct4-of-1 TTATAGTGAATGTATAGATATTGGGAG -1794bp~-1202bp roct4-ir-1 ACTAACCCAATACTTAATTTATCTTTAC -1794bp~-1202bp roct4-of-2 TTTAAGATTTAGGAGGTAAGAAGTCG -2357bp~-1932bp roct4-or-2 AAAACTAAAACCACCCAATTC -2357bp~-1932bp roct4-if-2 TTCGTGGTTATCGGGTTAATATTAG -2357bp~-1932bp roct4-ir-2 CTACCCCCAAAACAAAACTATC -2357bp~-1932bp 8

9 Figure. S1. The expressions of endogenous Oct4 and Nanog in rat ips cells were not maintained by LIF. Figure. S2. The relative expressions of Tert were determined by real-time PCR. Figure. S3. PEF and BMC don t express SSEA1. 9

Chemically defined conditions for human ipsc derivation and culture

Chemically defined conditions for human ipsc derivation and culture Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,

More information

Cat# Product Name amounts h NANOG (RFP-Bsd) inducible particles

Cat# Product Name amounts h NANOG (RFP-Bsd) inducible particles Premade Lentiviral Particles for ips Stem Factors For generating induced pluripotent stem (ips) cells or other applications. LVP003 LVP004 LVP005 LVP006 LVP007 LVP008 RESEARCH USE ONLY, not intend for

More information

Premade Lentiviral Particles for human ips Stem Factors

Premade Lentiviral Particles for human ips Stem Factors Premade Lentiviral Particles for human ips Stem Factors For generating induced pluripotent stem (ips) cells or other applications RESEARCH USE ONLY, not for diagnostics or therapeutics Cat# Product Name

More information

Premade Lentiviral Particles for ips Stem Factors: Single vector system. For generation of induced pluripotent stem (ips) cells and other applications

Premade Lentiviral Particles for ips Stem Factors: Single vector system. For generation of induced pluripotent stem (ips) cells and other applications Premade Lentiviral Particles for ips Stem Factors: Single vector system For generation of induced pluripotent stem (ips) cells and other applications RESEARCH USE ONLY, not for diagnostics or therapeutics

More information

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

APPLICATION NOTE Page 1

APPLICATION NOTE Page 1 APPLICATION NOTE Page 1 Generation of ips Cells from Oct4-Neo Reporter Embryonic Fibroblasts Dongmei Wu, Yan Gao, Charles Martin, Xun Cheng, Wen Xiong, Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle St.,

More information

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the transduction and reprogramming of one well of Oct4-GFP mouse embryonic fibroblasts (MEF) using the Dox Inducible Reprogramming Polycistronic

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent

Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent APPLICATION NOTE Page 1 Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent Authors: Amelia L. Cianci 1, Xun Cheng 1 and Kerry P. Mahon 1,2 1 Stemgent Inc.,

More information

Generation of ips Cells by Reprogramming Human Fibroblasts with a Four Transcription Factor, Dox- Inducible Lentivirus Set

Generation of ips Cells by Reprogramming Human Fibroblasts with a Four Transcription Factor, Dox- Inducible Lentivirus Set APPLICATION NOTE Page 1 Generation of ips Cells by Reprogramming Human Fibroblasts with a Four Transcription Factor, Dox- Inducible Lentivirus Set Authors: Chenmei Luo, Kevin Yi, Brad Hamilton 1 Stemgent,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature08267 Figure S: Karyotype analysis of ips cell line One hundred individual chromosomal spreads were counted for each of the ips samples. Shown here is an spread at passage 5, predominantly

More information

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived

More information

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10. Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency

Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency nature methods Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency Akitsu Hotta, Aaron Y L Cheung, Natalie Farra, Kausalia Vijayaragavan, Cheryle A Séguin, Jonathan S Draper,

More information

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM STEMGENT Page 1 Reprogramming Lentivirus Set: Human OKSM OVERVIEW The following procedure describes the reprogramming of BJ Human Fibroblasts (BJ cells) to induced pluripotent stem (ips) cells using the

More information

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification

More information

Supplemental Information

Supplemental Information Cell Stem Cell, Volume 15 Supplemental Information Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Riguo Fang, Kang Liu, Yang Zhao, Haibo Li, Dicong Zhu, Yuanyuan Du,

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure S1 Colony-forming efficiencies using transposition of inducible mouse factors. (a) Morphologically distinct growth foci appeared from rtta-mefs 6-8 days following PB-TET-mFx cocktail

More information

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,

More information

HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR)

HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) OBJECTIVE: is performed to analyze gene expression of human Embryonic Stem Cells (hescs) in culture. Real-Time PCR

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed

More information

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

More information

Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B

Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Certificate of Analysis NIGMS Human tic Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Diagnosis Mutation Reprogramming method Publication(s) describing ipsc line establishment

More information

NIA Aging Cell Repository

NIA Aging Cell Repository Certificate of Analysis NIA Aging Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: AG25370*B Diagnosis Alzheimer Disease, Familial, Type 4 Mutation Reprogramming method Publication(s) describing

More information

TITLE: Induced Pluripotent Stem Cells as Potential Therapeutic Agents in NF1

TITLE: Induced Pluripotent Stem Cells as Potential Therapeutic Agents in NF1 AD Award Number: W81XWH-10-1-0181 TITLE: Induced Pluripotent Stem Cells as Potential Therapeutic Agents in NF1 PRINCIPAL INVESTIGATOR: Jonathan Chernoff, M.D., Ph.D. CONTRACTING ORGANIZATION: Institute

More information

bfgf Supports Human ES Cell Self- Renewal

bfgf Supports Human ES Cell Self- Renewal APPLICATION NOTE Page 1 bfgf Supports Human ES Cell Self- Renewal Authors: Dongmei Wu, Wen Xiong, Yan Gao, Kristine Guerrero, Yi Chen, Liming Yang, Yang Liu, and Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

Document S1. Supplemental Experimental Procedures and Three Figures (see next page)

Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas

More information

Suggested Method Reprogramming MEF Cells into pips Cells using the Stemgent Recombinant Human Protein Set: OSKM-11R

Suggested Method Reprogramming MEF Cells into pips Cells using the Stemgent Recombinant Human Protein Set: OSKM-11R Page 1 Reprogramming MEF Cells into pips Cells using the Cat. No. 00-0062 OVERVIEW The procedure outlined below describes the reprogramming of mouse embryonic fibroblasts (MEF) by the addition of four

More information

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D MATERIALS Media Sodium Pyruvate (Mediatech; Cat# MT25-000-CI) Leukemia Inhibitory Factor

More information

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

More information

Supplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line

Supplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line Supplemental Data mrna Protein A kda 75 40 NEO/vector NEO/RNase L RNASE L β-actin RNASE L β-actin B % of control (neo vector), normalized 240 ** 200 160 120 80 40 0 Neo Neo/RNase L RNase L Protein Supplementary

More information

CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION. Stem Cell Research Solutions Promotional offers

CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION. Stem Cell Research Solutions Promotional offers CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION Stem Cell Research Solutions Promotional offers Stem Cell research products For more than a decade, we have provided you with key tools to address challenges

More information

Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale.

Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale. Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer Application Deborah Vitale Introduction Oligonucleotide arrays are a powerful tool for gene expression studies.

More information

Supplementary Data. Supplementary Materials and Methods Twenty-cell gene expression profiling. Stem cell transcriptome analysis

Supplementary Data. Supplementary Materials and Methods Twenty-cell gene expression profiling. Stem cell transcriptome analysis Supplementary Data The Supplementary Data includes Supplementary Materials and Methods, and Figures (Supplementary Figs. S1 S10). Supplementary Materials and Methods Twenty-cell gene expression profiling

More information

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%

More information

PluriQ TM Serum Replacement (PluriQ TM SR)

PluriQ TM Serum Replacement (PluriQ TM SR) PluriQ TM Serum Replacement (PluriQ TM SR) (PluriQ SR) is a defined, serum-free supplement formulated as a direct replacement for FBS (fetal bovine serum) used in the growth and maintenance of undifferentiated

More information

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4

More information

produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing

produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing Supplementary Figure 1 Characterisation of newly produced laminins. Human recombinant LN-521 produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing 1 and non-reducing conditions.

More information

Edexcel (B) Biology A-level

Edexcel (B) Biology A-level Edexcel (B) Biology A-level Topic 7: Modern Genetics Notes Using Gene Sequencing Genome = all of an organism s DNA, including mitochondrial/chloroplast DNA. Polymerase chain reaction (PCR) is used to amplify

More information

ipsc Handbook

ipsc Handbook www.abmgood.com www.abmgood.com Table of Contents Introduction Notice to the Purchaser Technical Support 1 2 2 Product Description and Protocols 1. ipsc Products Minicircle ipsc DNA Recombinant ipsc Proteins

More information

Biology Open (2015): doi: /bio : Supplementary information

Biology Open (2015): doi: /bio : Supplementary information Fig. S1. Verification of optimal conditions for the generation of LIF-dependent inscs Representative images (from five repeat experiments) of human primary fibroblasts undergoing reprogramming for 21 days

More information

To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR

To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

More information

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University

More information

SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and

SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and first strand cdna was synthesized using 1 μg of RNA and

More information

Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila

Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory

More information

Chapter 12. An Improved Method for Generating and Identifying Human Induced Pluripotent Stem Cells

Chapter 12. An Improved Method for Generating and Identifying Human Induced Pluripotent Stem Cells Chapter 12 An Improved Method for Generating and Identifying Human Induced Pluripotent Stem Cells Prashant Mali, Zhaohui Ye, Bin-Kuan Chou, Jonathan Yen, and Linzhao Cheng Abstract This chapter describes

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

SCIENCE CHINA Life Sciences. A novel strategy to derive ips cells from porcine fibroblasts

SCIENCE CHINA Life Sciences. A novel strategy to derive ips cells from porcine fibroblasts SCIENCE CHINA Life Sciences RESEARCH PAPERS June 2011 Vol.54 No.6: 553 559 doi: 10.1007/s11427-011-4179-5 A novel strategy to derive ips cells from porcine fibroblasts RUAN WeiMin 1, HAN JianYong 1,2,

More information

Mutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells

Mutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells Mutagenesis and generation of expression vectors Human c-kit wild-type cdna encoding the short c-kit isoform was excised from vector pbshkitwt (kind gift from Dr. L Gros, France) by Sal I-Acc65 I digestion.

More information

Supplemental Methods Cell lines and culture

Supplemental Methods Cell lines and culture Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

Disease Clinical features Genotype

Disease Clinical features Genotype Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient

More information

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g.

For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. DESIGN OF grnas For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. http://crispr.mit.edu/, https://benchling.com). Assembly of grna transcriptional cassettes

More information

Genomic analysis of induced pluripotent stem (ips) cells: routes to reprogramming

Genomic analysis of induced pluripotent stem (ips) cells: routes to reprogramming DOI 10.1002/bies.200800204 Genomic analysis of induced pluripotent stem (ips) cells: routes to reprogramming Ashlin Kanawaty and Jeffrey Henderson * Leslie Dan Faculty of Pharmacy, University of Toronto,

More information

LysoTracker Red DND-99 (Invitrogen) was used as a marker of lysosome or acidic

LysoTracker Red DND-99 (Invitrogen) was used as a marker of lysosome or acidic information MATERIAL AND METHODS Lysosome staining LysoTracker Red DND-99 (Invitrogen) was used as a marker of lysosome or acidic compartments, according to the manufacturer s protocol. Plasmid independent

More information

Supporting Information

Supporting Information Supporting Information Ho et al. 1.173/pnas.81288816 SI Methods Sequences of shrna hairpins: Brg shrna #1: ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgacgnttttg (TRCN71383; Open Biosystems). Brg shrna

More information

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani

More information

The p53-puma axis suppresses ipsc generation

The p53-puma axis suppresses ipsc generation The p53-puma axis suppresses ipsc generation Yanxin Li, Haizhong Feng, Haihui Gu, Dale W. Lewis, Youzhong Yuan, Lei Zhang, Hui Yu, Peng Zhang, Haizi Cheng, Weimin Miao, Weiping Yuan, Shi-Yuan Cheng, Susanne

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use

Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture Catalog Number 354671 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare

Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare transcripts, that are expressed in one population but not in the

More information

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

ipsc Handbook

ipsc Handbook www.abmgood.com www.abmgood.com Table of Contents Introduction Notice to the Purchaser Technical Support 1 2 2 Product Description and Protocols 1. ipsc Products Minicircle ipsc DNA Recombinant ipsc Proteins

More information

Authors: Takuro Horii, Masamichi Yamamoto, Sumiyo Morita, Mika Kimura, Yasumitsu Nagao, Izuho Hatada *

Authors: Takuro Horii, Masamichi Yamamoto, Sumiyo Morita, Mika Kimura, Yasumitsu Nagao, Izuho Hatada * SUPPLEMENTARY INFORMATION Title: p53 Suppresses Tetraploid Development in Mice Authors: Takuro Horii, Masamichi Yamamoto, Sumiyo Morita, Mika Kimura, Yasumitsu Nagao, Izuho Hatada * Supplementary Methods

More information

The Agilent Total RNA Isolation Kit

The Agilent Total RNA Isolation Kit Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTRY INFORMTION DOI:.38/ncb Kdmb locus kb Long isoform Short isoform Long isoform Jmj XX PHD F-box LRR Short isoform XX PHD F-box LRR Target Vector 3xFlag Left H Neo Right H TK LoxP LoxP Kdmb Locus

More information

CRISPR-based gene disruption in murine HSPCs. Ayumi Kitano and Daisuke Nakada

CRISPR-based gene disruption in murine HSPCs. Ayumi Kitano and Daisuke Nakada CRISPR-based gene disruption in murine HSPCs Ayumi Kitano and Daisuke Nakada Nakada Lab Protocol INTRODUCTION We recently described fast, efficient, and cost-effective methods to directly modify the genomes

More information

qbiomarker PCR Array Handbook

qbiomarker PCR Array Handbook March 2011 qbiomarker PCR Array Handbook qbiomarker Screening PCR Array qbiomarker Validation PCR Array For induced pluripotent stem cell screening, validation, and differentiation Sample & Assay Technologies

More information

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

More information

Frequently Asked Questions Stem Cells

Frequently Asked Questions Stem Cells Q: Do you add antibiotics to your media? A: Coriell does not use antibiotics when culturing stem cells. Customers should be aware that inclusion of antibiotics in media may change growth characteristics

More information

REPROGRAMMING OF HUMAN STEM CELLS TO HEPATOCYTES FOR CLINICAL AND INDUSTRIAL APPLICATIONS. Eishani Kumar. Faculty Mentor: Dr.

REPROGRAMMING OF HUMAN STEM CELLS TO HEPATOCYTES FOR CLINICAL AND INDUSTRIAL APPLICATIONS. Eishani Kumar. Faculty Mentor: Dr. Kumar 1 REPROGRAMMING OF HUMAN STEM CELLS TO HEPATOCYTES FOR CLINICAL AND INDUSTRIAL APPLICATIONS BY Eishani Kumar Faculty Mentor: Dr. Wei-Shou Hu Graduate Mentor: David Chau Department of Chemical Engineering

More information

Supplementary Material & Methods

Supplementary Material & Methods Supplementary Material & Methods Affymetrix micro-array Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA). RNA concentration and quality was determined using the ND-1000 spectrophotometer

More information

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented

More information

Mammosphere formation assay. Mammosphere culture was performed as previously described (13,

Mammosphere formation assay. Mammosphere culture was performed as previously described (13, Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts

More information

First xeno-free serum replacement for pluripotent stem cells

First xeno-free serum replacement for pluripotent stem cells Stem Cell Research First xeno-free serum replacement for pluripotent stem cells KnockOut SR XenoFree Stem Cell Research New, xeno-free growth and expansion of hescs and human ipscs KnockOut SR XenoFree

More information

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Extrinsic Signaling during Reprogramming.

Nature Methods: doi: /nmeth Supplementary Figure 1. Extrinsic Signaling during Reprogramming. Supplementary Figure 1 Extrinsic Signaling during Reprogramming. a, In human pluripotent stem cells, exogenously- (medium) and endogenously-promoted (cell-secreted) FGF and TGF- pathways sustain the master

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of

More information

All-in-One qpcr Mix. User Manual. For universal quantitative real-time PCR

All-in-One qpcr Mix. User Manual. For universal quantitative real-time PCR All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000 qpcr reactions) Cat. No. AOPR-1200

More information

Efficient Multi-site-directed Mutagenesis directly from Genomic Template.

Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis

More information

Episomal ipsc Reprogramming Vectors FAQs

Episomal ipsc Reprogramming Vectors FAQs About Episomal ipsc Reprogramming Vectors Episomal ipsc Reprogramming Vectors Catalog Number A14703 1. What are induced pluripotent stem cells (ipscs)? ipscs are genetically reprogrammed somatic cells

More information

HUMAN IPSC CULTURE PROTOCOLS

HUMAN IPSC CULTURE PROTOCOLS HUMAN IPSC CULTURE PROTOCOLS FOR TRAINING COURSE IXCELLS BIOTECHNOLOGIES USA, LLC 10340 CAMINO SANTA FE, SUITE C, SAN DIEGO, CA 92121 TABLE OF CONTENTS CHAPTER 1 BEFORE STARTING 2-7 SECTION 1.1 COATING

More information