SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Size: px
Start display at page:

Download "SUPPLEMENTAL EXPERIMENTAL PROCEDURES"

Transcription

1 SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla luciferase internal control plasmid prlsv4 using Lipofectamine2 transfection protocol. Twentyfour hours after transfection, cells were treated with 5 µm or 2 nm for additional 12 hours. Cells were then lysed and subjected to DualLuciferase assay as per the manufacturer s recommendations (Promega). SUPPLEMENTARY FIGURE LEGENDS Fig. S1. HDACi have no effect on 3 S transactivation. 3 /, 3 WT or 3 S HCT116 cells were transiently cotransfected with the indicated firefly luciferase reporter constructs containing p21 or mdm2 promoter together with prlsv4 renilla luciferase vector. Cells were treated with, or and subjected to DualLuciferase assay. The results are represented as the mean ratio of firefly/renilla luciferase activities ± SD, n=3. Fig. S2. Cell death and 3 expression in response to HDACi. (A) HCT116 wild type (3 / ) and 3 / cells stably transfected with empty vector (Puro or Bsd), 3 WT or 3 S were treated with either 5 µm or 2 nm for the indicated periods of time. The percentage of cell viability was determined by trypan blue dye exclusion assay. (B) The same cell lines treated as above for 18 hours were subjected to immunoblot analysis. Fig. S3. Knockdown of mutant 3 reduces HDACiinduced apoptosis. (A) HT29 cells infected with either scrambled control (shscr) or 3 targeting shrna (sh3) lentivirus were treated with 5 μm or 2 nm for 36 hours and subjected to immunoblot and caspase3 activity assay. (B, C) SW48 and HT29 cells infected with shscr or sh3 lentivirus were treated with 5 μm or 2 nm for the indicated times, and cell viability was determined by trypan blue exclusion assay. (D) SW48 cells infected with shscr or sh3 lentivirus were treated with or 2 nm for 24 hours and subjected to Annexin VAPC/7AAD staining. Fig. S4. SirT1 does not affect induced 3dependent apoptosis. (A, B) H / and 3 D281G cells were transfected with empty pcdna3.1 or pcdna3.1sirt1 expression vectors and then treated with or 2 nm for 24 hours and subjected to immunoblot and caspase3 assays. (C, D) H / and 3 D281G cells were treated with, 1 μm EX527, 2 nm or the combination of 1 μm EX527 and 2 nm for 24 hours and subjected to western blot and AnnexinV APC/7AAD staining. Fig. S5. HCT116 3 / cells stably expressing TAP or TAP3 S were treated with 2 nm for the indicated periods of time. The percentage of cell viability was determined by trypan blue dye exclusion assay. Fig. S6. H / and 3 D281G cells were infected with shscr or shku7 lentivirus for 24 hours, treated with or 2 nm for 24 hours, and subjected to immunoblot analysis. Fig. S7. Acetylation of 3 is required for Bax translocation but not for 3 binding to BclXL. (A) HCT116 3 / cells stably expressing control Puro or 3 S were treated with, 5 μm or 2 nm for 18 hours and subjected to subcellular fractionation and immunoblot analysis. (B) HCT116 3 / cells stably transfected with empty (Puro), M3 S or M3 S3KR were treated with, 5 μm or 2 nm for 16 hours and subjected to subcellular fractionation and immunoblot analysis. (C, D) HCT116 3 / cells were transiently transfected with BclXL and the indicated Mtagged 3 expression plasmids or empty control vector for 36 hours, treated with or

2 without 2 nm for additional 12 hours, and subjected to immunoprecipitation in CHAPS lysis buffer with antim monoclonal antibody, followed by immunoblot analysis with the indicated antibodies.

3 Firefly/Renilla Empty p21 MDM2 Empty p21 MDM2 Empty p21 MDM2 WT) 3 / Figure S1

4 A Viability (%) Time (h) Time (h) / WT) 3/ Puro 3/ Bsd Puro Bsd 16 Bsd 63 Bsd 71 3 / B 3 / WT) Puro Bsd Puro Bsd 16 Bsd 63 Bsd 71 (clone) 3 βactin Figure S2

5 A B HT29 Empty shscr sh3 % Viability 9 βactin 3 Caspase3 Activity ( FU/hr/mg protein) % Viability.36 ±.1 FL3H::7AAD ± ±.3 13 FL4H::AnnexinVAPC 2.3 ± ± FL4H::AnnexinVAPC ± ± ±.39 sh3.41 ±.13 Hours FL3H::7AAD ± ± Empty Empty shscr shscr sh3 sh3 9 shscr 48 SW48 24 Hours HT C D FL3H::7AAD 7 8 FL3H::7AAD 8 6 Empty shscr sh3 Empty Empty shscr shscr sh3 sh3 12 SW ± FL4H::AnnexinVAPC 1.11 ± ± ± ± FL4H::AnnexinVAPC 14 Figure S3

6 3 / SirT1 D281G) B βactin SirT1 3 AcK3823 C 3 / Caspase3 Activity ( FU/mg Protein/hr) A D D281G) 3 / 3 /D281G) Empty Empty SirT1 SirT1 D281G) AcK βactin EX527 EX527 EX527 Figure S4

7 Viability (%) TAP TAP Time (h) Figure S5

8 3 / D281G) shscr shku7 Ku7 βactin Figure S6

9 WCL Figure S7 3 BclXL IP: M Ku7 BclXL M3 M M IP: M WCL S3K R) S3K R) y pt D Em M Mitochondria ) KR S W Q/ Pu S KR ro ) L 22 W Cytoplasm M y C pt Q/ Pu ro L 22 B Em Em p M ty M W M 3 T ) (L p Q (L Em 22 2 Q/ 3S pt M y W ) Sp M 5 3K R) p W M 53 T ) (L p Q (L 22 2 Q/ 3S W ) S3K R) Pu ro Pu ro A Bax 3 Ku7 Histone H3 αtubulin Nucleus Bax HSP6 αtubulin Cytoplasm

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Journal of Cell Science Supplementary Material

Journal of Cell Science Supplementary Material 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

More information

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated

More information

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

More information

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

Supplementary Figure legends. Supplementary Methods

Supplementary Figure legends. Supplementary Methods Supplementary Methods Transmission electron microscopy. For transmission electron microscopy (TEM), the cell populations were rinsed with 0.1 Sorensen s buffer (ph 7.5), fixed in 2.5% glutaraldehyde for

More information

Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression

Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Cat# Product Name Amounts* LVP336 NLS-CRE (Bsd) LVP336-PBS NLS-CRE (Bsd), in vivo ready LVP339 NLS-CRE (Puro) LVP339-PBS NLS-CRE

More information

Description of Supplementary Files. File name: Supplementary Information Description: Supplementary figures and supplementary tables.

Description of Supplementary Files. File name: Supplementary Information Description: Supplementary figures and supplementary tables. Description of Supplementary Files File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Supplementary Data 1 Description: Differential expression

More information

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Product: Arrest-In TM Transfection Reagent for RNAi

Product: Arrest-In TM Transfection Reagent for RNAi Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

Online Supplementary Information

Online Supplementary Information Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17 Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,

More information

from Dr. David Livingston. Rabbit anti-myc, V5, and BACH1 were raised by immunizing rabbits with peptides EQKLISEEDI, GKPIPNPLLGLDST, and

from Dr. David Livingston. Rabbit anti-myc, V5, and BACH1 were raised by immunizing rabbits with peptides EQKLISEEDI, GKPIPNPLLGLDST, and upporting Material Experimental Procedures: Cell culture and antibodies All cell lines were maintained in RPMI 164 medium with 1% fetal calf serum at 37 C in 5% CO 2 (v/v). For HCC 1937-BRCA1 cells and

More information

Hossain_Supplemental Figure 1

Hossain_Supplemental Figure 1 Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

Supplemental Material

Supplemental Material Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

SUPPLEMENTARY MATERIALS AND METHODS

SUPPLEMENTARY MATERIALS AND METHODS SUPPLEMENTARY MATERIALS AND METHODS Chemicals. All chemicals used in supplementary experiments were the same as in the manuscript except the following. Methyl-methanesulfonate (MMS) was from Fluka. NU1025

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac. + NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Antibodies: Anti-SRF (cat# Sc-335) and anti-igf1r (sc-712) (Santa Cruz Biotech), and anti- ADAM-10 (14-6211) were from e-bioscience, anti-ku70 (cat# MS-329-P) (Labvision),

More information

CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611

CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Data Sheet CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)

More information

TE5 KYSE510 TE7 KYSE70 KYSE140

TE5 KYSE510 TE7 KYSE70 KYSE140 TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified

More information

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling

Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination

More information

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS

More information

Lentiviral shrna expression Cloning Kit User Manual for generating shrna expression lentivectors

Lentiviral shrna expression Cloning Kit User Manual for generating shrna expression lentivectors Lentiviral shrna expression Cloning Kit User Manual for generating s Cat# Product Name Amount Application LTSH-H1-GB peco-lenti-h1-shrna(gfp-bsd) cloning kit with GFP-Blasticidin selection LTSH-H1-GP peco-lenti-h1-shrna(gfp-puro)

More information

ingenio electroporation kits & solution

ingenio electroporation kits & solution ingenio electroporation kits & solution Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic

More information

pgbkt7 Anti- Myc AH109 strain (KDa) 50

pgbkt7 Anti- Myc AH109 strain (KDa) 50 pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture

More information

ASC is a Bax adaptor and regulates the p53 Bax mitochondrial apoptosis pathway

ASC is a Bax adaptor and regulates the p53 Bax mitochondrial apoptosis pathway is a adaptor and regulates the mitochondrial apoptosis pathway Takao Ohtsuka 1,Hoon Ryu 2,Yohji A. Minamishima 1, Salvador Macip 3, Junji Sagara 4,Keiichi I. Nakayama 5, Stuart A. Aaronson 3 and Sam W.

More information

Nucleofector technology and transient protein production

Nucleofector technology and transient protein production amaxa xxxxxxxxxxxx Nucleofector technology research Nucleofector technology and transient protein production your link to transfection The Nucleofector technology and transient protein production Transient

More information

Protocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System

Protocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System Luciferase Assay System Protocol High-throughput Transfection Protocol for GoClone Reporter Assays LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow promoter luciferase Step 1: Simultaneously

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Design and sequence of system 1 for targeted demethylation.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Design and sequence of system 1 for targeted demethylation. Supplementary Figure 1 Design and sequence of system 1 for targeted demethylation. (a) Design of system 1 for targeted demethylation. TET1CD was fused to a catalytic inactive Cas9 nuclease (dcas9) and

More information

Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM)

Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM) Supplemental Data. Sun et al. Plant ell. ()..5/tpc..9599 A FLS-FLA FLS -HA BAK-HA flg (mm) - B FLS -cmyc -FP FLS -HA IP antibody cmyc FLA FP cmyc IP ; WB: α-ha IP; WB: α-ha IP: α-fla; WB: α-ha IP ; WB:

More information

Supplemental Information. Lysine-5 Acetylation Negatively Regulates. Lactate Dehydrogenase A and Is Decreased. in Pancreatic Cancer

Supplemental Information. Lysine-5 Acetylation Negatively Regulates. Lactate Dehydrogenase A and Is Decreased. in Pancreatic Cancer Cancer Cell, Volume 23 Supplemental Information Lysine-5 Acetylation Negatively Regulates Lactate Dehydrogenase A and Is Decreased in Pancreatic Cancer Di Zhao, Shao-Wu Zou, Ying Liu, Xin Zhou, Yan Mo,

More information

Translation of HTT mrna with expanded CAG repeats is regulated by

Translation of HTT mrna with expanded CAG repeats is regulated by Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree

More information

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Supplementary Information. CITED2 links hormonal signaling to PGC-1α acetylation in regulation of gluconeogenesis!

Supplementary Information. CITED2 links hormonal signaling to PGC-1α acetylation in regulation of gluconeogenesis! Supplementary Information CITED2 links hormonal signaling to PGC-1α acetylation in regulation of gluconeogenesis! Mashito Sakai 1,2, Michihiro Matsumoto 1, Tomoko Tujimura 1, Cao Yongheng 1, Tetsuya Noguchi

More information

Supplementary Information

Supplementary Information Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara

More information

and MCU Channels by Regulating Threshold and Gain

and MCU Channels by Regulating Threshold and Gain Cell Reports, Volume 21 Supplemental Information MICU2 Restricts Spatial Crosstalk between InsP 3 R and MCU Channels by Regulating Threshold and Gain of MICU1-Mediated Inhibition and Activation of MCU

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

Secrete-Pair TM Dual Luminescence Assay Kit For parallel bioluminescence assays of Gaussia luciferase (GLuc) and secreted Alkaline Phosphatase (SEAP)

Secrete-Pair TM Dual Luminescence Assay Kit For parallel bioluminescence assays of Gaussia luciferase (GLuc) and secreted Alkaline Phosphatase (SEAP) Secrete-Pair TM Dual Luminescence Assay Kit For parallel bioluminescence assays of Gaussia luciferase (GLuc) and secreted Alkaline Phosphatase (SEAP) Cat. No. SPDA-D010 (100 reactions) Cat. No. SPDA-D030

More information

LI-COR, Odyssey, Aerius, IRDye and In-Cell Western are registered trademarks or trademarks of LI-COR Biosciences Inc.

LI-COR, Odyssey, Aerius, IRDye and In-Cell Western are registered trademarks or trademarks of LI-COR Biosciences Inc. PROTOCOL PARP-1 (cleaved) In-Cell ELISA Kit (IR) 185 Millrace Drive, Suite 3A Eugene, Oregon 9743 MSA43 Rev. DESCRIPTION An In-Cell ELISA kit for measuring cleaved PARP-1 (89kDa fragment) in human adherent

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2) SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca

More information

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.

More information

supplementary information

supplementary information DOI: 10.1038/ncb2017 Figure S1 53BP1 sirna results in a heterochromatic DSB repair defect. Panel A: NIH3T3 cells were transfected with murine 53BP1 sirna. 48 hrs later, cells were irradiated with 3 Gy

More information

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed

More information

Direct Cell Counting Assays for Immuno Therapy

Direct Cell Counting Assays for Immuno Therapy Direct Cell Counting Assays for Immuno Therapy Cytotoxicity assays play a central role in studying the function of immune effector cells such as cytolytic T lymphocytes (CTL) and natural killer (NK) cells.

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

ENCODE RBP Antibody Characterization Guidelines

ENCODE RBP Antibody Characterization Guidelines ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document

More information

M X 500 µl. M X 1000 µl

M X 500 µl. M X 1000 µl GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,

More information

Cell Imaging. Localization: Robust protein labeling of live or fixed cells

Cell Imaging. Localization: Robust protein labeling of live or fixed cells F eat u r es & B e n efits ptions Cell Imaging with the alotag platform Localization: Robust protein labeling of live or fixed cells Trafficking & Turnover: Directly observe proteins with one or two colors

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

SUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are

SUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are SUPPLEMENTAL FIGURE LEGENDS Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are the amino acid sequences of human DDR2, mouse DDR2 and the closest homologs in zebrafish and C. Elegans.

More information

A Dual Pathogenic Mechanism Links Tau Acetylation to Sporadic Tauopathy

A Dual Pathogenic Mechanism Links Tau Acetylation to Sporadic Tauopathy A Dual Pathogenic Mechanism Links Tau Acetylation to Sporadic Tauopathy Hanna Trzeciakiewicz, Jui-Heng Tseng, Connor M. Wander, Victoria Madden, Ashutosh Tripathy, Chao-Xing Yuan, and Todd J. Cohen Supplementary

More information

Cignal Reporter Assay Handbook

Cignal Reporter Assay Handbook January 2011 Cignal Reporter Assay Handbook For cell-based pathway activity assays Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and

More information

SUPPLEMENTARY DATA American Diabetes Association. Published online at

SUPPLEMENTARY DATA American Diabetes Association. Published online at Plasmids and Constructs. Plasmids pcdna3.1-ar and pbabe-ar were generated by inserting the full-length mouse AR cdna. The pcdna3.1-ar was constructed by cloning the full-length mouse AR cdna from mouse

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator

Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator INCUCYTE LIVE-CELL ANALYSIS SYSTEM Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator See what your cells are doing and when they do it

More information

Small-Molecule Drug Target Identification/Deconvolution Technologies

Small-Molecule Drug Target Identification/Deconvolution Technologies Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily

More information

THE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL

THE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL THE DELIVERY EXPERTS INTERFERin in vitro sirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna transfection reagent that ensures efficient gene silencing and reproducible transfection

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2

More information