A PROTEIN INTERACTION NETWORK OF THE MALARIA PARASITE PLASMODIUM FALCIPARUM

Size: px
Start display at page:

Download "A PROTEIN INTERACTION NETWORK OF THE MALARIA PARASITE PLASMODIUM FALCIPARUM"

Transcription

1 A PROTEIN INTERACTION NETWORK OF THE MALARIA PARASITE PLASMODIUM FALCIPARUM DOUGLAS J. LACOUNT, MARISSA VIGNALI, RAKESH CHETTIER, AMIT PHANSALKAR, RUSSELL BELL, JAY R. HESSELBERTH, LORI W. SCHOENFELD, IRENE OTA, SUDHIR SAHASRABUDHE, CORNELIA KURSCHNER, STANLEY FIELDS & ROBERT E. HUGHES Jung Ah (Grace) Lee

2 Why Plasmodium falciparum? Most deadly of the four Plasmodium species that cause human malaria Malaria has a massive impact on human death Around 300 million clinical cases occur each year resulting in between million deaths annually, the majority in sub-saharan Africa

3 Life Cycle of Malaria

4 What can research bring us? Understand the pathways and processes of the parasite Discover new drug and vaccine targets Important because resistance to common drugs are increasing

5 Not so easy! 80% AT content of P. falciparum genome hinders protein expression in heterologous systems Cannot use model organisms Limits both conventional biochemical approaches and comprehensive analyses of this organism s proteins Greater than 60% of the proteins are annotated as hypothetical

6 Then how did the paper do it? Functions of uncharacterized proteins can be inferred from the functions of binding partners Large scale yeast-two hybrid assay To screen for protein-protein interactions BIOINFORMATICS! To characterize the proteins

7 Yeast Two-Hybrid Assay Made libraries that are targeted to genes expressed in the intraerythrocytic-stage of parasites Stage responsible for pathogenesis in humans

8 Yeast-Two Hybrid Assay

9 Yeast-Two Hybrid Assay Positive results were: PCR Sequence PCR products BlastN

10 Results of Yeast-Two Hybrid Assay

11 False Positives! Many proteins are promiscuous Multiple binding partners (up to 207) Then what s real? Ideally, retest all positives and confirm them with an independent method (co-ip and mass spectrometry?) Not ideal for P. falciparum project Expression problems Large scale K-means clustering analysis

12 K-means Clustering Analysis Method of cluster analysis which aims to partition n observations into k clusters in which each observation belongs to the cluster with the nearest mean In the paper, k=2 (2 clusters or 2 populations) Clusters are based on number of interacting partners

13 Results of K-means Clustering Analysis 13 promiscuous prey fragments with more than 31 partners 28 promiscuous bait fragments with more than 25 partners Total removal of 2,155 interactions involving these fragments

14 Results of K-means Clustering Analysis 2,846 unique pair-wise interactions, containing 1,267 proteins core data

15 Core Data

16 Core Data Analysis Core data set includes 23 interactions that were previously identified PFC0255c ubiquitin conjugating enzyme E2 homologous to S. cerevisiae Mms2 PFE1350c ubiquitin-conjugating enzyme homologous to S. cerevisiae Ubc13 Mms2 and Ubc13 interact 82% of the interactions include at least one protein annotated as hypothetical 33% of the interactions include two hypothetical proteins Use bioinformatic analyses to uncover biologically interesting regions of the network

17 Bioinformatic Analysis I Survey regions of the network with higher than expected connectivity High degree of local network interconnectivity can identify sets of functionally related proteins Parsed the network into 1,308 primary subnetworks containing a protein, its direct binding partners and all interactions between them Calculated connectivity coefficient

18 Bioinformatic Analysis I Connectivity coefficient # interaction / # proteins

19 Bioinformatic Analysis I Found regions of highest connectivity in the data set by MCODE

20 Bioinformatic Analysis I Based on these analysis, they identified a group of interacting proteins that may be involved in: chromatin modification transcriptional regulation mrna stability ubiquitination

21 These interactions indicate that chromatin-modifying complexes might be targeted to specific regions in the genome to regulate transcription and are of particular significance given unique features of gene expression of the parasite and the absence of recognizable transcription factors encoded by the genome

22 This group seems analogous to Ccr4-Not, which also integrates transcription regulation, chromatin modification, ubiquitination and RNA stability

23 Bioinformatic Analysis II Examined the relationship between P. falciparum protein interaction data and mrna abundance Interacting proteins are more likely to be co-expressed than non-interacting proteins Microarray data sets available from DeRisi and Winzeler labs (mrna abundace) Grouped into clusters of proteins that are co-expressed

24 Bioinformatic Analysis II For each protein pair, calculated Pearson correlation coefficient (PCCs), which measures the degree of correlation Cluster 15 of microarray: contains proteins implicated in the invasion of host cells, including Merozoite Surface Protein 1 (MSP1, PFI1475w) Essential protein that coats the surface of merozoites and is thought to be required for the invasion of red blood cells Potential vaccine target

25 Bioinformatic Analysis II Contains several conserved blocks of sequence, some of which establish interactions with uncharacterized, co-expressed proteins that might also have a function in the invasion of host cells

26 Identified 103 interactions among 89 proteins Deduce possible biological interactions that are involved in the invasion of red blood cells

27 Bioinformatic Analysis III Because specific protein domains are often associated with discrete biological processes, enrichment of particular domains in subnetworks can implicate proteins relevant to a process Similarly, enrichment of proteins sharing common Gene Ontology (GO) annotations can also implicate proteins from a subnetwork in biological processes Molecular function & biological processes

28 Bioinformatic Analysis III Searched the P. falciparum interaction network for primary subnetworks associated with protein domains or GO annotations

29 Identified several subnetworks with an enrichment of RNA recognition motifs (RRM)

30 Given that proteins containing SNF2 domains are involved in chromatin remodeling, PFI1715w might provide a link between gene expression and splicing

31

32

33 Conclusion Speculate possible functions to uncharacterized proteins Identify novel parasite pathways Provide a resource for the malaria research community Some future direction: Identify host factors required for P. falciparum growth Better understand regulation of gene expression in P. falciparum Ultimately lead to better drugs and vaccines.

34 References Douglas J. LaCount Powerpoint Presentation LaCount, DJ. et al A protein interaction network of the malaria parasite Plasmodium falciparum. Nature 438, (2005). Le Roch, K. G. et al Discovery of gene function by expression profiling of the malaria parasite life cycle. Science 301, (2003).

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

Genome Biology and Biotechnology

Genome Biology and Biotechnology Genome Biology and Biotechnology 10. The proteome Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course

More information

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

CRISPR/Cas9 Genome Editing: Transfection Methods

CRISPR/Cas9 Genome Editing: Transfection Methods CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Le proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali

Le proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali Le proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali Tipo cellulare 1 Tipo cellulare 2 Tipo cellulare 3 DNA-protein Crosslink Lisi Frammentazione Immunopurificazione

More information

Stefano Monti. Workshop Format

Stefano Monti. Workshop Format Gad Getz Stefano Monti Michael Reich {gadgetz,smonti,mreich}@broad.mit.edu http://www.broad.mit.edu/~smonti/aws Broad Institute of MIT & Harvard October 18-20, 2006 Cambridge, MA Workshop Format Morning

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger SHK Stelle frei Ab 1.9.2015, 2 Jahre, 41h/Monat Verbundprojekt MaptTorNet: Pankreatische endokrine Tumore Insb. statistische Aufbereitung und

More information

Sequence Analysis Lab Protocol

Sequence Analysis Lab Protocol Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Network System Inference

Network System Inference Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What

More information

Gene Signal Estimates from Exon Arrays

Gene Signal Estimates from Exon Arrays Gene Signal Estimates from Exon Arrays I. Introduction: With exon arrays like the GeneChip Human Exon 1.0 ST Array, researchers can examine the transcriptional profile of an entire gene (Figure 1). Being

More information

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS

Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS The Bioinformatics book covers new topics in the rapidly

More information

Biology 252 Nucleic Acid Methods

Biology 252 Nucleic Acid Methods Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.

More information

sirna Overview and Technical Tips

sirna Overview and Technical Tips 1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

Introduction to the UCSC genome browser

Introduction to the UCSC genome browser Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Expression Array System

Expression Array System Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Bioinformatics of Transcriptional Regulation

Bioinformatics of Transcriptional Regulation Bioinformatics of Transcriptional Regulation Carl Herrmann IPMB & DKFZ c.herrmann@dkfz.de Wechselwirkung von Maßnahmen und Auswirkungen Einflussmöglichkeiten in einem Dialog From genes to active compounds

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome

2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome Protein-Protein Interactions Protein Interactions A Protein may interact with: Other proteins Nucleic Acids Small molecules Protein-Protein Interactions: The Interactome Experimental methods: Mass Spec,

More information

1. Introduction. 1 Page 1

1. Introduction. 1 Page 1 1. INTRODUCTION Osteoblast differentiation is the key component of the bone formation, growth and remodeling. During this incompletely understood process a subpopulation of multipotential mesenchymal stem

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes

More information

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics

More information

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

More information

Technical University of Denmark

Technical University of Denmark 1 of 13 Technical University of Denmark Written exam, 15 December 2007 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open Book Exam Provide your answers and calculations on

More information

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?

What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells? Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression

More information

Applications of RNA -seq in Microbiology

Applications of RNA -seq in Microbiology Applications of RNA -seq in Microbiology STUDENT: CHEUNG YUK YAM, ANDY SUPERVISOR: PROF MAMIE HUI JOINT GRADUATE SEMINAR DEC 2016 DEPARTMENT OF MICROBIOLOGY, FACULTY OF MEDICINE, THE CHINESE UNIVERSITY

More information

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic

More information

Do engineered ips and ES cells have similar molecular signatures?

Do engineered ips and ES cells have similar molecular signatures? Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

MOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS

MOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS 03-442 Lectures: MWF 9:30-10:20 a.m. Doherty Hall 2105 03-742 Advanced Discussion Section: Time and place to be announced Probably Mon 4-6 p.m. or 6-8p.m.? Once we establish who is taking the advanced

More information

O C. 5 th C. 3 rd C. the national health museum

O C. 5 th C. 3 rd C. the national health museum Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Introduction to genome biology

Introduction to genome biology Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis SWATH Acquisition on the TripleTOF 5600+ System Samuel L. Bader, Robert L. Moritz Institute of Systems Biology,

More information

Fundamentals of Bioinformatics: computation, biology, computational biology

Fundamentals of Bioinformatics: computation, biology, computational biology Fundamentals of Bioinformatics: computation, biology, computational biology Vasilis J. Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus A short self-introduction

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does

More information

Genetic Approaches for Malaria Control. Marcelo Jacobs-Lorena, PhD

Genetic Approaches for Malaria Control. Marcelo Jacobs-Lorena, PhD This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)

More information

Complementary Technologies for Precision Genetic Analysis

Complementary Technologies for Precision Genetic Analysis Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features

More information

Exploring Similarities of Conserved Domains/Motifs

Exploring Similarities of Conserved Domains/Motifs Exploring Similarities of Conserved Domains/Motifs Sotiria Palioura Abstract Traditionally, proteins are represented as amino acid sequences. There are, though, other (potentially more exciting) representations;

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog

More information

Novel T cell antigen discovery technology providing new momentum on a malaria vaccine

Novel T cell antigen discovery technology providing new momentum on a malaria vaccine Novel T cell antigen discovery technology providing new momentum on a malaria vaccine World Vaccine Congress 2012 Best Vaccine Startup 2008 Jessica Baker Flechtner, PhD Vice President, Research Genocea

More information

Bioinformatics and computational tools

Bioinformatics and computational tools Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya International Livestock Research Institute Nairobi, Kenya ILRI works at the

More information

Molecular Biology: DNA sequencing

Molecular Biology: DNA sequencing Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides

More information

Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL

Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Target Enrichment Strategies for Next Generation Sequencing

Target Enrichment Strategies for Next Generation Sequencing Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced

More information

Transcriptional Regulation in Eukaryotes

Transcriptional Regulation in Eukaryotes Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

Binding Analysis of a Novel Peptide to Malaria Knob Protein

Binding Analysis of a Novel Peptide to Malaria Knob Protein Binding Analysis of a Novel Peptide to Malaria Knob Protein http://www.nuigalway.ie/cryst/ oscail_tutorial/moilin/ biomolecules/ala_gly.png Jessica Preston Professors C. Takoudis, A. Chisti, and G. Jursich

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

Introduction to Molecular Biology

Introduction to Molecular Biology Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

ENCODE RBP Antibody Characterization Guidelines

ENCODE RBP Antibody Characterization Guidelines ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document

More information