Rorα is essential for nuocyte development
|
|
|
- Elinor Garrett
- 6 years ago
- Views:
Transcription
1 Rorα is essential for nuocyte development See Heng Wong,,, Jennifer A. Walker,, Helen E. Jolin,, Lesley F. Drynan, Emily Hams 3, Ana Camelo, Jillian L. Barlow, Daniel R. Neill,6, Veera Panova, Ute Koch, Freddy Radtke, Clare S. Hardman, You Yi Hwang, Padraic G. Fallon 3,7 and Andrew N.J. McKenzie Nature Immunology doi:.8/ni.8
2 Supplementary Figure a Lin- cells Live cells.88 Linneg.3. Linneg IL-7Rα <R-67-A>: IL7Ra APC 97.. IL-7BR b CLP Lin-IL-7Rα IL-7Rα <V--A>:B/CDb/CD3/TER9/CD9 PB Comp FL IL7R PECy Lin c Flt3 CMP and HSC Lin-IL-7Rα IL-7Rα. Sca- FL IL7R PECy Lin FL.9 SCA FITC c-kit 3.6 Supplementary figure. Identification of nuocytes in bone marrow. (a) Bone marrow cells from naïve mice were stained for Linneg (CD/CD8/CD/Gr-/CDc), Linneg (CDb/CD3/B/TER9/CD9), IL-7BR and IL-7Rα. Cells negative for both Linneg and Linneg were gated and analysed for the expression of IL-7Rα and IL-7BR. Representative of three repeat experiments. (b) Gating strategy for the purification of CLP, CMP and HSC by fluorescence activated cell sorting. Bone marrow cells were prepared and stained for lineage markers (Lin; CD, CD8, CD3, CDb, CDc, CD9, B, Gr-), IL-7Rα and Flt3. Flt3+ CLPs were sorted from the LinnegIL-7Rα+ population. (c) Bone marrow cells were stained for lineage markers (Lin; CD, CD8, CD3, CDb, CDc, CD9, B, Gr-), IL-7Rα, Sca- and c-kit. Both c-kit+sca-- CMP and c-kit+sca-+ HSC were sorted from the LinnegIL-7Rα- population. Nature Immunology doi:.8/ni.8
3 Supplementary Figure a Day Day b 3.37 <B--A>: FITC <YG-8-A>.8. TCRβ.6 -A -A IL- IL-7+Flt3L <B--A>: FITC CD3 c CD3,CD,CD8 -A IL Day 6 Events (% of max) IL-7+IL Nkp6 CDb Day 9 Day CD9 Day Day 9 Day IL-7 + Flt3L 3.9 CD IL-7 + IL CD Day 6 Day 9 Day Day Day 9 Day IL-7 + Flt3L CD IL-7 + IL Supplementary figure. IL-7 and IL-33 support in vitro differentiation of CLPs into nuocytes. (a) Flow cytometry analysis of CLPs () seeded on OP9-DL stromal cells in either T cell conditions (IL-7 and Flt3L), or nuocyte conditions (IL-7 and IL-33) for days and analysed for the expression of CD3 or and, intracellular expression of IL- and IL-3, and the cell surface markers CDb, NKp6 and CD9. Data are representative of three similar independent experiments. (b) Flow cytometry analysis of T cell development from CLPs cultured in IL-7 and Flt3L for 8 days. Representative of triplicate cultures. (c) Time course of CLP development as assessed by CD, CD and expression. Representative of triplicate cultures. Nature Immunology doi:.8/ni.8
4 Supplementary Figure 3 IL-7 + Flt3L ng/ml 7. ng/ml. ng/ml. ng/ml. ng/ml. ng/ml TCRβ CD3, CD, CD8 IL-7 + IL-33 ng/ml 7. ng/ml ng/ml. ng/ml. ng/ml. ng/ml.3 TCRβ CD3, CD, CD8 Supplementary figure 3. Effect of IL-7 titration on nuocyte and T cell development. Flow cytometry analysis of CLPs cultured in either T cell conditions (IL-7 and Flt3L), or nuocyte conditions (IL-7 and IL-33) for 8 days. IL-7 concentration is at the top of each panel. Representative of triplicate cultures in each case. Nature Immunology doi:.8/ni.8
5 Supplementary Figure CD (also CD3 -, CD -, CD8 - ) OP9-DL (IL-7 + IL-33) CD (Day 6) 3 Day Day 3 Day 6 Day 9 Day : OP9-DL (IL-7 + IL-33) Day Day 3 Day 6 Day OP (Day 6) (IL-7 + IL-33) CD CD (also CD3 -, CD -, CD8 - ) Supplementary figure. Determination of the Notch interaction time required for nuocyte development. CLPs were cultured on OP9-DL cells for the times indicated, before being divided and moved on to either OP9-DL or OP9 cells and cultured until day 6. Cells were then analysed for cell surface markers for B cells (CD9), T cells (not shown) or nuocytes (CD3 - CD- CD CD + ). Representative of triplicate cultures. Nature Immunology doi:.8/ni.8
6 Supplementary Figure a flox (88bp) wt (7bp) del (68bp) Nuocytes Mx-Cre neg Mx-Cre pos PCR controls CLPs +/del +/flox +/+ Mx-Cre neg Mx-Cre pos b Nuocytes (% nonrbcs). NS.3... Mx-Cre neg Mx-Cre pos Supplementary figure. Notch signalling in nuocyte generation in vivo. In an attempt to establish whether Notch signalling is critical to nuocyte generation in vivo, we utilized mice bearing floxed Rbpjk, a key mediator of Notch signalling, crossed with mice carrying the IFN α-inducible Cre recombinase, Mx-Cre. Seven weeks after treatment with poly(i)-poly(c) to induce Cre expression, mice bearing the Mx-Cre transgene had deleted Rbpjk in the majority of CLPs (a) and were treated with IL- to elicit nuocytes. In contrast to our results in vitro, there was no detectable difference in the ability of Mx-Cre pos Rbpjk lox/lox mice to give rise to nuocytes in peripheral blood as compared to controls (3- mice per group; NS = not significant) (b). However, deletion of the floxed allele was incomplete in nuocytes sorted from the spleen of the Mx-Cre pos Rbpjk lox/lox mice (a), indicating that the conditional deletion system is inefficient and that nuocytes may have arisen from a small population of undeleted precursors. Notably, single cell culture of Mx-Cre pos Rbpjk lox/lox CLPs confirmed an absolute requirement for Notch signalling in vitro since homozygously deleted CLPs, in contrast to heterozygotes and non-deleted cells, failed to become nuocytes (data not shown). Nature Immunology doi:.8/ni.8
7 Supplementary Figure 6 a Total live cells CD. + cells CD. + cells CD CD CDb 6.3 CD. + CDb - cells CD. + CDb - cells A 3 B CD b Total live cells CD. + cells CD. + cells CD <V--A> 8.3 -A CD. 3 CDb CD. + CDb - cells 3.3. CD. + CDb - cells 7.. B -A 3 <B--A> CD3 <B--A>.9. Supplementary figure 6. Analysis of donor HSC and CLP reconstitution in the recipient mice. (a,b) Flow cytometry analysis of CD., CD., B, CD3 and CDb expression on tail blood cell samples from the HSC recipients (a) and CLP recipients (b) three weeks after adoptive transfer. Data are representative of three independent experiments with to 6 mice per group. Nature Immunology doi:.8/ni.8
8 Supplementary Figure 7 Day Day Supplementary figure 7. In vitro generation of myeloid cells from CMPs. Cytospins derived from CMPs cultured for days in the presence of stem cell factor, IL-3, IL-, GM-CSF, thrombopoietin and erythropoietin for days. The cells were stained with Giemsa. Magnification x. Nature Immunology doi:.8/ni.8
9 Supplementary Figure 8 a DN DN DN.73 DN IL-3..6 c.977. DN DN DN Events. DN.68 DN3 b 3.7 CD3, CD, CD8, TCRβ Supplementary figure 8. Phenotype of nuocytes derived in vitro from thymocyte subsets. Flow cytometry analysis of (a) nuocyte markers (+ and +); (b) IL-3 production by intracellular cytokine staining; and (c) T cell markers (TCRβ+/CD3+/CD+/CD8+) following culture on OP9-DL stromal cells in the presence of IL-7 and IL-33 for to weeks. Representative of two experiments. Nature Immunology doi:.8/ni.8
10 Supplementary Figure 9 IL-33Cit/+ WT. 3.3 Citrine % of Citrine+ cells % of Citrine+ cells in total bone marrow 3 WT IL-33Cit/+ 8 6 CD- cells CD+ cells Supplementary figure 9. Il33Citrine expression in bone marrow cells from naïve wildtype and Il33Citrine knock-in mice. Representive of mice per group. Nature Immunology doi:.8/ni.8
11 Supplementary Figure Rorasg/sg WT Supplementary figure. Intrinsic Rorα is required for nuocyte development. Analysis of nuocytes (++) from in vitro cultured CLPs from Rorasg/sg and wildtype mice at day 8 cultured with IL-7 and IL-33. Data are representative of two independent experiments. Nature Immunology doi:.8/ni.8
Supplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
Supplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:
The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700
Flow cytometry analysis and cell sorting The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700 anti-cd5. (), APC-Cy7 anti-epcam (G.; Biolegend, San Diego, CA), PE-Cy7 anti-cd31
Development of plasmacytoid and conventional dendritic cell subtypes from single precursor cells derived in vitro and in vivo
Development of plasmacytoid and conventional dendritic cell subtypes from single precursor cells derived in vitro and in vivo Shalin H Naik 1,2, Priyanka Sathe 1,3, Hae-Young Park 1,4, Donald Metcalf 1,
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or
Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
Immunophenotyping of Peripheral Blood and Bone Marrow Cells by Flow Cytometry *Akanni EO and # Palini A.
Immunophenotyping of Peripheral Blood and Bone Marrow Cells by Flow Cytometry *Akanni EO and # Palini A. * Department of Haematology & Blood Transfusion,College of Health Science, Ladoke Akintola University
Notch-Dependent Repression of mir-155 in the Bone Marrow Niche Regulates Hematopoiesis in an NF- B-Dependent Manner
Cell Stem Cell, Volume 5 Supplemental Information Notch-Dependent Repression of mir-55 in the Bone Marrow Niche Regulates Hematopoiesis in an NF- B-Dependent Manner Lin Wang, Huajia Zhang, Sonia Rodriguez,
Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
Supporting Information
Supporting Information Narni-Mancinelli et al. 10.1073/pnas.1112064108 SI Materials and Methods Cell Preparation. Mice were anesthetized and immediately perfused with PBS before organs were collected.
Supplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
Supporting Information
Supporting Information Sengupta et al. 10.1073/pnas.1103132108 SI Materials and Methods Mice. Mice carrying the atypical protein kinase C apkcλ f/f allele (1), and Mx1-Cre (2, 3), Vav1-Cre (4, 5), apkcζ
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
Development of NOG mice
Development of NOG mice General characteris5cs of NOG mice 1. T and B cell deficient 2. NK cell deficient 3. Reduced macrophage and dendri;c cell func;on 4. Complement ac;vity deficient 5. No incidence
NIH Public Access Author Manuscript Nat Immunol. Author manuscript; available in PMC 2009 September 17.
NIH Public Access Author Manuscript Published in final edited form as: Nat Immunol. 2008 June ; 9(6): 676 683. doi:10.1038/ni.1615. FMS-like tyrosine kinase 3 is required for dendritic cell development
Binding profiles of key transcription factors to the Bcl11b gene and enhancer.
Supplementary Figure 1 Binding profiles of key transcription factors to the Bcl11b gene and enhancer. A)-C) UCSC genome browser tracks (mm9 coordinates) showing published ChIP-Seq binding data of the following
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
Hematopoietic Stem Cells
Hematopoietic Stem Cells Isolate Culture Verify Differentiate Investigate a brand Hematopoietic Stem Cells Hematopoietic stem cells (HSCs) are multipotent, self-renewing progenitor cells from which all
Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation
Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María
Life Sciences Reporting Summary
Life Sciences Reporting Summary Corresponding Author: Date: Jun 30, 2017 Henrique Veiga-Fernandes Nature Research wishes to improve the reproducibility of the work we publish. This form is published with
Supplemental Information. Tissue-Resident Macrophages Self-maintain Locally. throughout Adult life with Minimal Contribution
Immunity, Volume 38 Supplemental Information Tissue-Resident Macrophages Self-maintain Locally throughout Adult life with Minimal Contribution from Circulating Monocytes Daigo Hashimoto, Andrew Chow, Clara
Background. Background. Background. Background. Background 3/4/2013
3/4/213 Human Very Small Embryonic-like Stem Cells (s) Capacity to Regenerate Bone Tissue: A Potential Cell-based Therapy for Autogenous Bone Grafting Aaron M. Havens, DMD Need to discover an improved
Supporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
Transcription Factor Miz-1 Is Required to Regulate
Immunity, Volume 33 Supplemental Information Transcription Factor Miz-1 Is Required to Regulate Interleukin-7 Receptor Signaling at Early Commitment Stages of B Cell Differentiation Christian Kosan, Ingrid
Mark J. Kiel, Melih Acar, Glenn L. Radice, and Sean J. Morrison
Cell Stem Cell, Volume 4 Supplemental Data Hematopoietic Stem Cells Do Not Depend on N-Cadherin to Regulate Their Maintenance Mark J. Kiel, Melih Acar, Glenn L. Radice, and Sean J. Morrison SUPPLEMENTAL
Hematopoietic Stem Cells
Hematopoietic Stem Cells ISOLATE & CULTURE VERIFY DIFFERENTIATE INVESTIGATE ISOLATE AND CULTURE Mouse Hematopoietic Cell Lineage Depletion Kit ( MAGM29) Both positive and negative selection methods can
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
- Figure S1 (related to Fig. 1): Phenotype of CD1d-/- mice and IL-17 secretion by
Cell Host & Microbe, Volume 10 Supplemental Information Innate Recognition of Cell Wall β-glucans Drives Invariant Natural Killer T Cell Responses against Fungi Nadia R. Cohen, Raju V.V. Tatituri, Amariliz
In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *
In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
Supporting Information
Supporting Information Kawane et al. 10.1073/pnas.1010603107 SI Materials and Methods Mice. The DNase II / IFN-IR / and DNase II flox/ Mx1-Cre T mice were described previously (1). To delete the DNase
by Alexander Y. Rudensky (Sloan-Kettering Institute, New York). LSL-TβRI CA (TGFβR-
Materials and Methods Mice. Tgfbr2 fl/fl CD4-Cre (TGFβR-KO) mice were previously reported (3). Cre negative littermates were used as wild-type controls. DN-TGFβRII (TGFβR-DN) mice were provided by Ronald
IL-17 Regulates Systemic Fungal Immunity by Controlling the Functional Competence of NK Cells
Immunity, Volume 40 Supplemental Information IL-17 Regulates Systemic Fungal Immunity by Controlling the Functional Competence of NK Cells Eva Bär, Paul G. Whitney, Kathrin Moor, Caetano Reis e Sousa,
Human Innate Lymphoid Cell Subsets Possess Tissue-Type Based Heterogeneity in Phenotype and Frequency
Resource Human Innate Lymphoid Cell Subsets Possess Tissue-Type Based Heterogeneity in Phenotype and Frequency Graphical Abstract Authors Yannick Simoni, Michael Fehlings, Henrik N. Kløverpris,..., Iain
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary figure 1 Flow diagram summarizing the overall experimental
Fundamental properties of Stem Cells
Stem cells Learning Goals: Define what a stem cell is and describe its general properties, using hematopoietic stem cells as an example. Describe to a non-scientist the current progress of human stem cell
Resolving Stem Cell Heterogeneity Using Flow Cytometry
Resolving Stem Cell Heterogeneity Using Flow Cytometry Mirko Corselli, PhD Senior Scientist We have not fully utilized the power of flow cytometry to address biological questions in other systems Flow
Supplemental figure 1. Dys-regulated signal pathways in MSCs from TNF-Tg. mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics
Supplemental figure 1. Dys-regulated signal pathways in MSCs from TN-Tg mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics esources software. The top 53 and top 11 dys-regulated
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3575 In the format provided by the authors and unedited. Supplementary Figure 1 Validation of key reagents and assays a, top, IHC with antibody recognizing specifically
Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'
Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr
TITLE: Novel Small-Molecule Inhibitor of Tyk2: Lucrative Therapeutic Target in Lupus
AWARD NUMBER: W81XWH-16-1-0609 TITLE: Novel Small-Molecule Inhibitor of Tyk2: Lucrative Therapeutic Target in Lupus PRINCIPAL INVESTIGATOR: Abhishek Trigunaite CONTRACTING ORGANIZATION: SRI International
4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig
4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig gene rearrangements Lineage commitment: transcription factors
Marcel Wüthrich, Karen Ersland, Thomas Sullivan, Kevin Galles, and Bruce S. Klein. of a Blastomyces TCR tg mouse. immunization.
Immunity, Volume 36 Supplemental Information Fungi Subvert Vaccine T Cell Priming at the Respiratory Mucosa by Preventing Chemokine-Induced Influx of Inflammatory Monocytes Marcel Wüthrich, Karen Ersland,
Single-cell analysis reveals the continuum of human lympho-myeloid progenitor cells
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41590-017-0001-2 In the format provided by the authors and unedited. Single-cell analysis reveals the continuum of human lympho-myeloid progenitor
Increased interleukin 1 -driven neutrophil counts preserve anti-bacterial defense in absence of IKK
Increased interleukin 1 -driven neutrophil counts preserve anti-bacterial defense in absence of IKK Li-Chung Hsu 1,2, Thomas Enzler 2,3,7, Jun Seita 4, Anjuli M. Timmer 5, Chih-Yuan Lee 1, Ting-Yu Lai
B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily
Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment
Tracking hematopoietic precursor division ex vivo in real time
Wang et al. Stem Cell Research & Therapy (2018) 9:16 DOI 10.1186/s13287-017-0767-z RESEARCH Tracking hematopoietic precursor division ex vivo in real time Open Access Yuchen Wang 1,2, Hong Tian 2,3, Wenzhi
In vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development.
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
B cell development The stages of B cell development
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
1,500 1,000. LPS + alum. * * Casp1 p10. Casp1 p45
a NLRP3 Non-stimulation R46 BAY SI TAT LPS R46 BAY SI TAT 1,5 1, c 15 1 5 5 Pro-IL-18 Pro-IL-1 LPS + alum d e f IL-1 p17 Pro-IL-1 1 75 5 5 Casp1 p1 NLRP3 LPS + alum Supplementary Figure 1 Inhiition of
Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
B Cells BCR. Antigen. Igα Igβ ITAM. Activated B Cell. Germinal Center. B Cell. Follicular Helper T Cell. Plasmablast.
s ntigen Igα Igβ ITM ctivated Germinal Center Follicular Helper T Cell Plasmablast Memory RnDSy-2945 Novus-2945 s lymphocytes ( cells) are an integral part of the humoral immune response due to their ability
HSV-2 therapeutic vaccine program. Subunit vaccine candidates
HSV-2 therapeutic vaccine program Subunit vaccine candidates Our HSV-2 vaccine program Therapeutic subunit vaccine T-cell-based Aim: Best-in-class antigens by engineering Excellent standing (Sept 2017):
CyTOF 2. Mass Cytometry System
CyTOF 2 Mass Cytometry System Discover more. Imagine more. CyTOF Applications Mass Cytometry. The Future of Cytometry Today. Mass cytometry resolves multiple metal probes per cell with minimal signal overlap,
Managing Specimen Stability for Robust Flow Cytometric Clinical Biomarker Assays
Managing Specimen Stability for Robust Flow Cytometric Clinical Biomarker Assays Dianna Wu, Richard Wnek Molecular Biomarkers & Diagnostics Merck Co., Inc 2014 AAPS Annual Meeting San Diego, CA (Fluorescent
Catalog # Product Size PRIME-XV Hematopoietic Cell Basal XSFM 500 ml (liquid) Additional package sizes are available at request
PRIME-XV HEMATOPOIETIC CELL BASAL XSFM PRIME-XV Hematopoietic Cell Basal XSFM is an optimized xeno- and serum free media recommended for use in the expansion of human hematopoietic cells, including hematopoietic
Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16
Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding
RAG-1 and Ly6D Independently Reflect Progression in the B Lymphoid Lineage
RAG-1 and Ly6D Independently Reflect Progression in the B Lymphoid Lineage Qingzhao Zhang 1, Brandt L. Esplin 1,2, Ryuji Iida 1, Karla P. Garrett 1, Zhixin L. Huang 3, Kay L. Medina 3, Paul W. Kincade
Rejuvenation of the muscle stem cell population restores strength to injured aged muscles
Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Benjamin D Cosgrove, Penney M Gilbert, Ermelinda Porpiglia, Foteini Mourkioti, Steven P Lee, Stephane Y Corbel,
BD Accuri C6. Flow cytometry within reach.
BD Accuri C6 Flow cytometry within reach. Flow Cytometry Within Reach The BD Accuri C6 is a personal flow cytometer that brings flow cytometry within reach by being easy to use, simple to maintain, and
Kristin Seré, Jea-Hyun Baek, Julia Ober-Blöbaum, Gerhard Müller-Newen, Frank Tacke, Yoshifumi Yokota, Martin Zenke, and Thomas Hieronymus
Immunity, Volume 37 Supplemental Information Two Distinct Types of Langerhans Cells Populate the Skin during Steady State and Inflammation Kristin Seré, Jea-Hyun Baek, Julia Ober-Blöbaum, Gerhard Müller-Newen,
NIH Public Access Author Manuscript Nat Immunol. Author manuscript; available in PMC 2013 February 05.
NIH Public Access Author Manuscript Published in final edited form as: Nat Immunol. 2012 September ; 13(9): 843 850. doi:10.1038/ni.2388. TGF-β is responsible for NK cell immaturity during ontogeny and
Conditional deletion of caspase-8 in macrophages alters macrophage activation in a RIPK-dependent manner
Conditional deletion of caspase-8 in macrophages alters macrophage activation in a RIPK-dependent manner Carla M. Cuda, PhD, Alexander V. Misharin, MD/PhD, Sonal Khare, PhD, Rana Saber, MS, FuNien Tsai,
efluor Organic Dyes 450/50 BP Fluorescence Intensity Wavelength (nm)
efluor Organic Dyes efluor Organic Dyes Catalog No. Description Clone Application Anti-Mouse efluor 450 Products 48-0042 Anti-mouse CD4 RM4-5 Flow Cytometry 48-0081 Anti-mouse CD8 53-6.7 Flow Cytometry
BD Mouse Hematopoietic Stem and Progenitor Cell Isolation Kit
BD Mouse Hematopoietic Stem and Progenitor Cell Isolation Kit Instruction Manual Catalog No. 560492 2010, Becton, Dickinson and Company. All rights reserved. No part of this publication may be reproduced,
At the conclusion of this lesson you should be able to:
Learning Objectives At the conclusion of this lesson you should be able to: Understand the key terms and definitions regarding stem cells Differentiate between the adult and embryonic stem cells Differentiate
Analyzing Protein Phosphorylation Pathways in Heterogeneous Samples
Analyzing Protein Phosphorylation Pathways in Heterogeneous Samples Erika O Donnell Cell Signaling Research BD Biosciences, San Diego, CA December 1, 2011 A Critical Role for Cell Signaling in Communication
Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)
SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin
Measurement of Hematopoietic Stem Cell Potency Prior to Transplantation
WHITE PAPER Measurement of Hematopoietic Stem Cell Potency Prior to Transplantation February, 2009 This White Paper is a forward-looking statement. It represents the present state of the art and future
Supplemental Information. Neutrophil-Derived IL-1b Impairs the Efficacy. of NF-kB Inhibitors against Lung Cancer
Cell Reports, Volume 16 Supplemental Information Neutrophil-Derived IL-1b Impairs the Efficacy of NF-kB Inhibitors against Lung Cancer Allyson G. McLoed, Taylor P. Sherrill, Dong-Sheng Cheng, Wei Han,
MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.
Page 1 of 2 MagniSort Mouse Hematopoietic Lineage Depletion Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse bone marrow cells were unsorted (top row) or sorted with the MagniSort
Modulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K.
Modulation of the anti-tumor immune response by complement Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Ricklin- Lichtsteiner, Anna Koutoulaki, Craig Gerard, George Coukos & John
Supplementary information
Supplementary information Cooperation of Oncolytic Herpes Virotherapy and PD-1 Blockade in Murine Rhabdomyosarcoma Models Chun-Yu Chen 1, Pin-Yi Wang 1, Brian Hutzen 1, Les Sprague 3, Hayley M. Swain 1,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
Supplementary Data, Romain et al., ATVB/2012/300516R2
Supplementary Data, Romain et al., ATV/212/3516R2 Methods online Mice All experiments were conducted on male mice between 8 and 12 weeks of age. Mice with genetic overexpression of SOCS3 or cell-specific
Mouse Strain Differences in Plasmacytoid Dendritic Cell Frequency and Function Revealed by a Novel Monoclonal Antibody
Mouse Strain Differences in Plasmacytoid Dendritic Cell Frequency and Function Revealed by a Novel Monoclonal Antibody Carine Asselin-Paturel, 1 Géraldine Brizard, Jean-Jacques Pin, Francine Brière, and
-Immune phenotype -Cancer xenografts -Immune system humanization -Services
-Immune phenotype -Cancer xenografts -Immune system humanization -Services services@herabiolabs.com 859-414-0648 About Hera BioLabs Precision Toxicology & Efficacy: utilizing precisely gene-edited models
THE ROLE OF FLT3L AND BAFF
Originaldokument gespeichert auf dem Dokumentenserver der Universität Basel edoc.unibas.ch Dieses Werk ist unter dem Vertrag Creative Commons Namensnennung-Keine kommerzielle Nutzung-Keine Bearbeitung
the tamoxifen treatment schedule used to induce recombination. Arrows indicate on which
SUPPLEMENTAL DATA Figure S1. Characterization of Vhl / mice. (A) Left panel shows a schematic outline of the tamoxifen treatment schedule used to induce recombination. Arrows indicate on which days tamoxifen
Stem Cells and Regenerative Medicine
Stem Cells and Regenerative Medicine 纪俊峰 Email: jijunfeng@zju.edu.cn May 07, 2015 Definition of a Stem Cell Potency of Stem Cells Totipotent Pluripotent Multipotent /mucosa /enamel /cartilage/denti n Types
Supplemental Data. ALDH1 Is a Marker of Normal and Malignant. Human Mammary Stem Cells. and a Predictor of Poor Clinical Outcome
Cell Stem Cell, Volume 1 Supplemental Data ALDH1 Is a Marker of Normal and Malignant Human Mammary Stem Cells and a Predictor of Poor Clinical Outcome Christophe Ginestier, Min Hee Hur, Emmanuelle Charafe-Jauffret,
Supplementary Figure and Table Legends
1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for
BD Pharmingen. Mouse Th1/Th2/Th17 Phenotyping Kit. Technical Data Sheet. Product Information. Description Components:
BD Pharmingen Technical Data Sheet Mouse Th1/Th2/Th17 Phenotyping Kit Product Information Material Number: 560758 Size: 50 tests Description Components: 51-9006631 Mouse Th1/Th2/Th17 Phenotyping Cocktail
Regulation of immunoglobulin heavy-chain gene rearrangements
Dipanjan Chowdhury Ranjan Sen Regulation of immunoglobulin heavy-chain gene rearrangements Authors address Dipanjan Chowdhury*, Ranjan Sen Laboratory of Cellular and Molecular Biology, National Institute
TISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Direct Toll-Like Receptor-Mediated Stimulation of Hematopoietic Stem and Progenitor Cells Occurs In Vivo and Promotes Differentiation Toward Macrophages JAVIER MEGÍAS, a ALBERTO
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland Approved for public release; distribution unlimited
AD Award Number: W81XWH-7-1-345 TITLE: Second-Generation Therapeutic DNA Lymphoma Vaccines PRINCIPAL INVESTIGATOR: Larry W. Kwak, MD, PhD CONTRACTING ORGANIZATION: The University of Texas M. D. Anderson
Supplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet
A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary
Primitive erythrocytes are generated from hemogenic endothelial cells. Monika Stefanska, Kiran Batta, Rahima Patel, Magdalena Florkowska, Valerie
Supplementary Information: Primitive erythrocytes are generated from hemogenic endothelial cells Monika Stefanska, Kiran atta, Rahima Patel, Magdalena Florkowska, Valerie Kouskoff & Georges Lacaud 1 Supplementary
T E C H N I C A L B U L L E T I N
TECHNICAL BULLETIN CULTURE OF HEMATOPOIETIC STEM AND PROGENITOR CELLS 1. Background Mature hematopoietic cells of both the lymphoid and myeloid lineages are continuously generated from a small self-renewing
Supplementary Figure 1 Activated B cells are subdivided into three groups
Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation
Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation
Immunity Supplemental Information Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation Jernej Godec, Yan Tan, Arthur Liberzon, Pablo Tamayo, Sanchita
Anupam Banerjee, Daniel Northrup, Hanane Boukarabila, Sten Erik W. Jacobsen, and David Allman
Immunity, Volume 38 Supplemental Information Transcriptional Repression of Gata3 Is Essential for Early B Cell Commitment Anupam Banerjee, Daniel Northrup, Hanane Boukarabila, Sten Erik W. Jacobsen, and
Boundary-breaking acoustic focusing cytometry
Boundary-breaking acoustic focusing cytometry Introducing the Attune NxT Acoustic Focusing Cytometer a high-performance system that s flexible enough for any lab One of the main projects in my laboratory