Kristin Seré, Jea-Hyun Baek, Julia Ober-Blöbaum, Gerhard Müller-Newen, Frank Tacke, Yoshifumi Yokota, Martin Zenke, and Thomas Hieronymus

Transcription

1 Immunity, Volume 37 Supplemental Information Two Distinct Types of Langerhans Cells Populate the Skin during Steady State and Inflammation Kristin Seré, Jea-Hyun Baek, Julia Ober-Blöbaum, Gerhard Müller-Newen, Frank Tacke, Yoshifumi Yokota, Martin Zenke, and Thomas Hieronymus Inventory of Supplemental Information - Figure S1, related to main Figure 1, shows LC and dermal DC subsets in Id2 -/- mice, and shows uptake of FITC-latex beads in peripheral blood Gr-1 hi monocytes and their recruitment to skin upon UV treatment. - Figure S2, related to main Figure 2, displays LC and dermal DC subset repopulation in epidermis and dermis, respectively, in Id2 +/+ and Id2 -/- mice four weeks after UV irradiation. - Figure S3, related to main Figure 4, compares the surface marker phenotype of short-term and long-term LCs one week after UV exposure with LCs and Gr-1 hi monocytes in steady state. - Figure S4, related to main Figure 6, shows chimerism of Id2 +/+ or Id2 -/- bone marrow cells and surface marker phenotype of donor-derived short-term and long-term LCs after transplantation into NSG mice. - Figure S5 depicts a model of short-term and long-term LC development in steady state and under inflammatory conditions. - Supplemental Movies S1-3 are animated z-stacks of a representative LC in epidermal sheet from (i) an untreated Id2 +/+ mouse (Movie S1), (ii) an Id2 +/+ mouse 4 weeks after UV irradiation (Movie S2) and (iii) an Id2 -/- mouse 4 weeks after UV irradiation (Movie S3). All movies relate to Figure 5. - Supplemental Experimental Procedures - Supplemental References 1

2 2

3 Figure S1, related to Figure 1. LC and dermal DC subsets in Id2 -/- mice, and uptake of latex beads in peripheral blood monocytes and their recruitment to skin upon UV treatment. (A) Immunofluorescence staining of skin epidermis from Id2 +/+ and Id2 -/- mice for MHC- II (green) and langerin expression (red); nuclear staining with DAPI (blue). Scale bar, 50 µm. (B and C) Flow cytometry of single-cell suspensions of skin from Id2 +/+ and Id2 -/- mice. SSC, side scatter. (B) For detection of LCs, cells from epidermal sheets were stained for CD45, CD11c, and langerin. (C) Dermal DCs of Id2 +/+ and Id2 -/- mice were identified by staining for CD45, CD11c and MHC-II expression. Dermal DC subsets were analyzed for langerin, CD205 (DEC205) and CD209 (DC-SIGN) expression as indicated (filled histogram). Isotype control, open histogram. (D) Frequency of low SSC leukocytes as percentage of total cell number and frequency of Gr-1 hi and Gr-1 lo monocytes in Id2 +/+ and Id2 -/- mice. Data are the means ± SD (n = 8). (E) Gr-1 hi monocytes of Id2 +/+ and Id2 -/- mice were labeled with FITC-conjugated latex-beads (LX beads) in vivo. The percentage of FITC-latex bead-labeled monocytes in blood 24h after injection is shown. (F) The number of CD45 + cells as percentage of total epidermal cell numbers before (steady state) and 5 days after UV treatment (inflammation) in Id2 +/+ and Id2 -/- mice. Data are the means ± SD (n = 3), *p < (G) Dermal Sheets were examined 5 days after UV treatment for the presence of CD45 + cells and latex + Gr-1 hi monocytes by flow cytometry. The percentage of FITC-latex bead-labeled Gr-1 hi monocytes within the CD45 + cells is shown. Data shown are representative of at least n = 3 independent experiments. 3

4 Figure S2, related to Figure 2. Repopulation of LCs and ddcs after UV irradiation. (A) Numbers of LCs per high power field (HPF) examined by MHC-II antibody and fluorescence microscopy in epidermal sheets of Id2 +/+ and Id2 -/- mice before and 4 weeks after UV exposure are shown. 5 areas were counted per sheet (20 HPF per mouse). Data are mean values ± SD of six mice per group. (B) Langerin + DCs in dermis of Id2 +/+ and Id2 -/- mice were examined 4 weeks after UV exposure by staining for CD45, CD11c, and langerin. Total ddcs were gated on CD45 + CD11c + and MHC-II expression (open) is shown in histogram. Isotype control, filled histogram. 4

5 Figure S3, related to Figure 4. Surface marker phenotype of short-term and long-term LCs. Mice were exposed to UV light for 15 minutes and epidermal single cell suspensions were analyzed by flow cytometry one week later. Surface marker expression on blood-derived Gr-1 hi monocytes (SSC lo CD45 + CD115 + Gr-1 hi ) and steady state LCs (CD45 + CD11c + MHC-II + ) of untreated Id2 +/+ mice as indicated (grey histograms). Surface marker expression on CD45 + CD11c + cells from Id2 +/+ and Id2 -/- mice one week after UV exposure (red and blue histograms, langerin hi and langerin lo cells, long-term LCs and shortterm LCs, respectively). Isotype control, open histogram. 5

6 6

7 Figure S4. Chimerism of Id2 +/+ or Id2 -/- bone marrow cells in NSG mice and surface phenotype of donor-derived short-term and long-term LCs. Id2 +/+ and Id2 -/- bone marrow cells were transplanted into sublethally irradiated NSG mice. LC reconstitution was examined 4 and 10 weeks after UV irradiation. (A) Schematic outline of the experiment. (B) Bar diagrams display the number of donor-derived CD cells as percentage of total CD45 + cells (upper left panel), donor-derived CD cells as percentage of CD11c + cells (upper right panel), langerin hi cells as percentage of donorderived CD CD11c + cells (lower left panel) and langerin hi cells as percentage of recipient-derived CD cells (lower right panel) 4 weeks (n = 3) and 10 weeks (n = 4) after UV treatment. Data are shown as the means ± SD. (C) Surface marker expression on donor-derived langerin hi and langerin lo CD11c + cells, representing long-term and shortterm LCs, respectively, of Id2 +/+ bone marrow (4 weeks; red and blue histograms, langerin hi and langerin lo LCs, respectively). Recipient LCs, grey histograms; isotype controls, open histograms. 7

8 Figure S5. Model for short-term and long term LC development in steady state and inflammation. (A) In steady state LCs develop from a local precursor in skin or hematopoietic stem cells (HSCs) in bone marrow, which is strictly Id2-dependent. These LCs stably populate the epidermis and self-renew throughout life, therefore referred to long-term LCs. During inflammation LCs can develop from Gr-1 hi monocytes and this is independent of Id2 and transient, referred to short-term LCs. (B) Two consecutive waves of LC repopulation. Recruitment and occurrence of Gr-1 hi monocyte-derived short-term LCs in epidermis upon inflammation is transient. With time, short-term LCs are replaced by long-term LCs developing from local precursor in skin or from bone marrow-derived precursors. 8

9 Supplemental Experimental Procedures Transplantation of bone marrow cells. A total of 2x10 5 bone marrow cells from Id2 +/+ mice were transplanted into lethally irradiated Id2 -/- recipient mice as previously described (Hieronymus et al., 2005). Bone marrow cells from Id2 -/- mice were used as a control. To generate BM chimeric NSG mice, 1x10 6 bone marrow cells from Id2 +/+ or Id2 -/- mice (CD45.2, MHC-II I-A b haplotype) were transplanted into sublethally irradiated NSG recipient mice (CD45.1, MHC-II I-A d,g7 haplotype). Eight- to 12-week old mice were irradiated with a dose of 2.5 Gy in a 6 MeV photonic energy linear accelerator (model Precise, Elekta) and bone marrow cells were injected via the lateral tail vein. Adoptive transfer of Gr-1 hi monocytes. Adoptive transfer of monocytes was done as described previously (Ginhoux et al., 2006) with minor modifications. Briefly, bone marrow cells from CD45.1, Id2 +/+ or Id2 -/- mice were first depleted of MHC-II + and CD11c + cells, which was followed by positive selection of CD115 + monocytes using immunomagnetic cell separation (MACS, Miltenyi Biotech). 6 to 9 Mio of isolated cells were injected i.v. into recipient mice, which had been UV-irradiated 24 h before injection. Mice were treated with UV-C light (wavelength 254 nm) for 30 min at a distance of 30 cm (total dose 16.8 kj) to induce ear skin inflammation as described (Merad et al., 2002). Biotinylated antibodies to mouse MHC-II (I-A/I-E; clone M5/ ), CD11c (N418) and CD115 (AFS98) were obtained all from ebioscience. In vivo labeling of blood monocytes with FITC-latex beads. For labeling of Gr-1 hi monocytes, 250 µl of liposomes containing clodronate were injected i.v. into Id2 -/- and Id2 +/+ mice, followed by intravenous injection of 250 µl FITC-conjugated latex microspheres 0.5 µm in diameter (LX-beads, Polysciences) 18 h later as described before (Tacke et al., 2006). Clodronate was a gift from Roche and was incorporated into liposomes as described (Van Rooijen and Sanders, 1994). Flow cytometry. Multi-color staining for flow cytometry was performed as described 9

10 (Hieronymus et al., 2005). Monoclonal antibodies to mouse MHC-II (I-A/I-E; clone 2G9), CD11c-PE (HL3), CD24-PE, CD103-PE, Gr-1-biotin (Ly6C/G), CD209-biotin, Sirpα- APC, PerCP-Cy5.5- conjugated streptavidin, and respective isotype controls were from BD Biosciences. CD4-PE, CD8a-eFluor450, CD11b-eFluor450, CD40-APC, CD80-PE, CD44- efluor450, CD45.2-APC, CD62L-eFluor450, CD115-PE, CD205-PE, CD209-PE, EpCAM-eFluor450, TLR4-PE, F4/80-APC, Clec9a-PE, and corresponding isotype controls were obtained from ebioscience. CD11b-FITC was from Caltag Laboratories (Invitrogen). E-Cadherin-PE and CD205-biotin were from R&D Systems and Miltenyi Biotech, respectively. Alexa488- and Alexa546-conjugated monoclonal antibodies to langerin (clone 929F3) were from Dendritics. For intracellular staining of langerin, cells were fixed with 2% PFA in PBS and permeabilized in saponin buffer (1% saponin, 2 mm EDTA, 3% FCS, 0.02% Thimerosal in PBS). Flow cytometry analysis was performed on a FACSCalibur or FACSCanto (BD Biosciences) and data were analyzed with FlowJo software (Tree Star). LC analysis by immunofluorescence microscopy in normal and inflamed skin. To determine LC density and morphology, epidermal sheets from Id2 +/+ and Id2 -/- mice, Ccr2 -/- Ccr6 -/-, and NSG mice were prepared for immunofluorescence microscopy as follows. Dorsal and ventral halves were fixed on tape (crystal clear, Tesa) and incubated in PBS/0.02 M EDTA (Sigma-Aldrich) for 90 min at 37 C to allow separation of the epidermal sheets from dermis. Epidermal sheets were fixed in 100% ice-cold acetone for 20 min, rinsed in PBS and blocked with PBS/3% BSA for 30 min at room temperature before staining with Abs overnight at 4 C. For detection of LCs staining was performed with anti- MHC-II-FITC and anti-langerin-alexa546, or anti-langerin-alexa488 in combination with CD45.1-biotin (A20, ebioscience) and PE-conjugated streptavidin. Sheets were counterstained with DAPI (Vector Laboratories) before being mounted in ProLong Gold mounting media (Molecular Probes). Images were acquired using a fluorescence microscope (Axiovert 200, Zeiss) and a digital CCD camera (Roper Scientific) operated with IPlab software. Image processing was done with Adobe Photoshop software. LC numbers per mm 2 were calculated from microscopic fields. 10

11 Confocal laser-scanning microscopy. Confocal imaging of epidermal sheets was carried out on a LSM 510 or LSM 710 confocal microscope (Zeiss). With the LSM 510 a 63x 1.2 NA Zeiss water immersion objective was used. Alexa546-fluorescence was excited with the 543 nm emission line of the helium-neon laser and detected using a nm bandpass filter. FITC-fluorescence was excited with the 488 nm emission line of the argon laser and detected using a nm bandpass filter. Image processing was done with the Zeiss LSM image browser 4.2 software. With the LSM 710 a 40x 1.1 NA Zeiss water immersion objective was used. Alexa546-fluorescence was excited with the 561 nm emission line of a laser diode and detected using a nm bandpass filter. FITC-fluorescence was excited with the 488 nm emission line of the argon laser and detected using a nm bandpass filter. Quantitative PCR analysis of sorted cells. Total RNA of sorted cells was isolated using MagMAX-96 for Microarrays Kit (Ambion, Life Technologies) according to manufacturer s protocol. cdna synthesis was done using High Capacity cdna Reverse Transcription Kit (Applied Biosystems). For real-time PCR cdna from 150 cells was used per reaction with SYBR green (Fast SYBR Green Master Mix, Applied Biosystems) using a StepOnePlus Real Time PCR system (Applied Biosystems). Data were analyzed using StepOne TM Software v2.1 (Applied Biosystems) and for each sample Ct values were normalized to the corresponding Ct values of GAPDH. Primer sequences are listed in Supplementary Table S1 below. Relative expression values were subjected to bi-directional hierarchical cluster analysis using R software (R Development Core Team, 2012). 11

12 Table S1. Primer sequences for quantitative RT-PCR Gene Primer sequence Reference Langerin Smad7 Klf4 Tlr4 Id2 forward 5 ATGTTGAAAGGTCGTGTGGAC 3 reverse 5 GTGGTGTTCACTATCTGCATCT 3 forward 5 GCAGGCTGTCCAGATGCTGT 3 reverse 5 GATCCCCAGGCTCCAGAAGA 3 forward 5 CCAGACCAGATGCAGTCACAA 3 reverse 5 TGGCATGAGCTCTTGATAATGG 3 forward 5 TGGCTAGGACTCTGATCATGGC 3 reverse 5 TGAAGAAGGAATGTCATCAGGG 3 forward 5 AAAACAGCCTGTCGGACCAC 3 reverse 5 CTGGGCACCAGTTCCTTGAG 3 Kautz et al., 2008 Ruau et al., 2008 Lichtinger et al., 2007 Saika et al., 2006 GAPDH forward 5 ACCTGCCAAGTATGATGACATCA 3 Tagoh et al., 2004 reverse 5 GGTCCTCAGTGTAGCCCAAGAT 3 12

13 Supplemental References Kautz, L., Meynard, D., Monnier, A., Darnaud, V., Bouvet, R., Wang, R.H., Deng, C., Vaulont, S., Mosser, J., Coppin, H., and Roth, M.P. (2008). Iron regulates phosphorylation of Smad1/5/8 and gene expression of Bmp6, Smad7, Id1, and Atoh8 in the mouse liver. Blood 112, Lichtinger, M., Ingram, R., Hornef, M., Bonifer, C., and Rehli, M. (2007). Transcription factor PU.1 controls transcription start site positioning and alternative TLR4 promoter usage. J. Biol. Chem. 282, Ruau, D., Ensenat-Waser, R., Dinger, T.C., Vallabhapurapu, D.S., Rolletschek, A., Hacker, C., Hieronymus, T., Wobus, A.M., Muller, A.M., and Zenke, M. (2008). Pluripotency associated genes are reactivated by chromatin-modifying agents in neurosphere cells. Stem Cells 26, Saika, S., Ikeda, K., Yamanaka, O., Flanders, K.C., Ohnishi, Y., Nakajima, Y., Muragaki, Y., and Ooshima, A. (2006). Adenoviral gene transfer of BMP-7, Id2, or Id3 suppresses injury-induced epithelial-to-mesenchymal transition of lens epithelium in mice. Am. J. Physiol. Cell Physiol. 290, C Tagoh, H., Schebesta, A., Lefevre, P., Wilson, N., Hume, D., Busslinger, M., and Bonifer, C. (2004). Epigenetic silencing of the c-fms locus during B-lymphopoiesis occurs in discrete steps and is reversible. EMBO J. 23, Van Rooijen, N., and Sanders, A. (1994). Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J. Immunol. Methods 174,