Kristin Seré, Jea-Hyun Baek, Julia Ober-Blöbaum, Gerhard Müller-Newen, Frank Tacke, Yoshifumi Yokota, Martin Zenke, and Thomas Hieronymus
|
|
- Godwin Daniels
- 6 years ago
- Views:
Transcription
1 Immunity, Volume 37 Supplemental Information Two Distinct Types of Langerhans Cells Populate the Skin during Steady State and Inflammation Kristin Seré, Jea-Hyun Baek, Julia Ober-Blöbaum, Gerhard Müller-Newen, Frank Tacke, Yoshifumi Yokota, Martin Zenke, and Thomas Hieronymus Inventory of Supplemental Information - Figure S1, related to main Figure 1, shows LC and dermal DC subsets in Id2 -/- mice, and shows uptake of FITC-latex beads in peripheral blood Gr-1 hi monocytes and their recruitment to skin upon UV treatment. - Figure S2, related to main Figure 2, displays LC and dermal DC subset repopulation in epidermis and dermis, respectively, in Id2 +/+ and Id2 -/- mice four weeks after UV irradiation. - Figure S3, related to main Figure 4, compares the surface marker phenotype of short-term and long-term LCs one week after UV exposure with LCs and Gr-1 hi monocytes in steady state. - Figure S4, related to main Figure 6, shows chimerism of Id2 +/+ or Id2 -/- bone marrow cells and surface marker phenotype of donor-derived short-term and long-term LCs after transplantation into NSG mice. - Figure S5 depicts a model of short-term and long-term LC development in steady state and under inflammatory conditions. - Supplemental Movies S1-3 are animated z-stacks of a representative LC in epidermal sheet from (i) an untreated Id2 +/+ mouse (Movie S1), (ii) an Id2 +/+ mouse 4 weeks after UV irradiation (Movie S2) and (iii) an Id2 -/- mouse 4 weeks after UV irradiation (Movie S3). All movies relate to Figure 5. - Supplemental Experimental Procedures - Supplemental References 1
2 2
3 Figure S1, related to Figure 1. LC and dermal DC subsets in Id2 -/- mice, and uptake of latex beads in peripheral blood monocytes and their recruitment to skin upon UV treatment. (A) Immunofluorescence staining of skin epidermis from Id2 +/+ and Id2 -/- mice for MHC- II (green) and langerin expression (red); nuclear staining with DAPI (blue). Scale bar, 50 µm. (B and C) Flow cytometry of single-cell suspensions of skin from Id2 +/+ and Id2 -/- mice. SSC, side scatter. (B) For detection of LCs, cells from epidermal sheets were stained for CD45, CD11c, and langerin. (C) Dermal DCs of Id2 +/+ and Id2 -/- mice were identified by staining for CD45, CD11c and MHC-II expression. Dermal DC subsets were analyzed for langerin, CD205 (DEC205) and CD209 (DC-SIGN) expression as indicated (filled histogram). Isotype control, open histogram. (D) Frequency of low SSC leukocytes as percentage of total cell number and frequency of Gr-1 hi and Gr-1 lo monocytes in Id2 +/+ and Id2 -/- mice. Data are the means ± SD (n = 8). (E) Gr-1 hi monocytes of Id2 +/+ and Id2 -/- mice were labeled with FITC-conjugated latex-beads (LX beads) in vivo. The percentage of FITC-latex bead-labeled monocytes in blood 24h after injection is shown. (F) The number of CD45 + cells as percentage of total epidermal cell numbers before (steady state) and 5 days after UV treatment (inflammation) in Id2 +/+ and Id2 -/- mice. Data are the means ± SD (n = 3), *p < (G) Dermal Sheets were examined 5 days after UV treatment for the presence of CD45 + cells and latex + Gr-1 hi monocytes by flow cytometry. The percentage of FITC-latex bead-labeled Gr-1 hi monocytes within the CD45 + cells is shown. Data shown are representative of at least n = 3 independent experiments. 3
4 Figure S2, related to Figure 2. Repopulation of LCs and ddcs after UV irradiation. (A) Numbers of LCs per high power field (HPF) examined by MHC-II antibody and fluorescence microscopy in epidermal sheets of Id2 +/+ and Id2 -/- mice before and 4 weeks after UV exposure are shown. 5 areas were counted per sheet (20 HPF per mouse). Data are mean values ± SD of six mice per group. (B) Langerin + DCs in dermis of Id2 +/+ and Id2 -/- mice were examined 4 weeks after UV exposure by staining for CD45, CD11c, and langerin. Total ddcs were gated on CD45 + CD11c + and MHC-II expression (open) is shown in histogram. Isotype control, filled histogram. 4
5 Figure S3, related to Figure 4. Surface marker phenotype of short-term and long-term LCs. Mice were exposed to UV light for 15 minutes and epidermal single cell suspensions were analyzed by flow cytometry one week later. Surface marker expression on blood-derived Gr-1 hi monocytes (SSC lo CD45 + CD115 + Gr-1 hi ) and steady state LCs (CD45 + CD11c + MHC-II + ) of untreated Id2 +/+ mice as indicated (grey histograms). Surface marker expression on CD45 + CD11c + cells from Id2 +/+ and Id2 -/- mice one week after UV exposure (red and blue histograms, langerin hi and langerin lo cells, long-term LCs and shortterm LCs, respectively). Isotype control, open histogram. 5
6 6
7 Figure S4. Chimerism of Id2 +/+ or Id2 -/- bone marrow cells in NSG mice and surface phenotype of donor-derived short-term and long-term LCs. Id2 +/+ and Id2 -/- bone marrow cells were transplanted into sublethally irradiated NSG mice. LC reconstitution was examined 4 and 10 weeks after UV irradiation. (A) Schematic outline of the experiment. (B) Bar diagrams display the number of donor-derived CD cells as percentage of total CD45 + cells (upper left panel), donor-derived CD cells as percentage of CD11c + cells (upper right panel), langerin hi cells as percentage of donorderived CD CD11c + cells (lower left panel) and langerin hi cells as percentage of recipient-derived CD cells (lower right panel) 4 weeks (n = 3) and 10 weeks (n = 4) after UV treatment. Data are shown as the means ± SD. (C) Surface marker expression on donor-derived langerin hi and langerin lo CD11c + cells, representing long-term and shortterm LCs, respectively, of Id2 +/+ bone marrow (4 weeks; red and blue histograms, langerin hi and langerin lo LCs, respectively). Recipient LCs, grey histograms; isotype controls, open histograms. 7
8 Figure S5. Model for short-term and long term LC development in steady state and inflammation. (A) In steady state LCs develop from a local precursor in skin or hematopoietic stem cells (HSCs) in bone marrow, which is strictly Id2-dependent. These LCs stably populate the epidermis and self-renew throughout life, therefore referred to long-term LCs. During inflammation LCs can develop from Gr-1 hi monocytes and this is independent of Id2 and transient, referred to short-term LCs. (B) Two consecutive waves of LC repopulation. Recruitment and occurrence of Gr-1 hi monocyte-derived short-term LCs in epidermis upon inflammation is transient. With time, short-term LCs are replaced by long-term LCs developing from local precursor in skin or from bone marrow-derived precursors. 8
9 Supplemental Experimental Procedures Transplantation of bone marrow cells. A total of 2x10 5 bone marrow cells from Id2 +/+ mice were transplanted into lethally irradiated Id2 -/- recipient mice as previously described (Hieronymus et al., 2005). Bone marrow cells from Id2 -/- mice were used as a control. To generate BM chimeric NSG mice, 1x10 6 bone marrow cells from Id2 +/+ or Id2 -/- mice (CD45.2, MHC-II I-A b haplotype) were transplanted into sublethally irradiated NSG recipient mice (CD45.1, MHC-II I-A d,g7 haplotype). Eight- to 12-week old mice were irradiated with a dose of 2.5 Gy in a 6 MeV photonic energy linear accelerator (model Precise, Elekta) and bone marrow cells were injected via the lateral tail vein. Adoptive transfer of Gr-1 hi monocytes. Adoptive transfer of monocytes was done as described previously (Ginhoux et al., 2006) with minor modifications. Briefly, bone marrow cells from CD45.1, Id2 +/+ or Id2 -/- mice were first depleted of MHC-II + and CD11c + cells, which was followed by positive selection of CD115 + monocytes using immunomagnetic cell separation (MACS, Miltenyi Biotech). 6 to 9 Mio of isolated cells were injected i.v. into recipient mice, which had been UV-irradiated 24 h before injection. Mice were treated with UV-C light (wavelength 254 nm) for 30 min at a distance of 30 cm (total dose 16.8 kj) to induce ear skin inflammation as described (Merad et al., 2002). Biotinylated antibodies to mouse MHC-II (I-A/I-E; clone M5/ ), CD11c (N418) and CD115 (AFS98) were obtained all from ebioscience. In vivo labeling of blood monocytes with FITC-latex beads. For labeling of Gr-1 hi monocytes, 250 µl of liposomes containing clodronate were injected i.v. into Id2 -/- and Id2 +/+ mice, followed by intravenous injection of 250 µl FITC-conjugated latex microspheres 0.5 µm in diameter (LX-beads, Polysciences) 18 h later as described before (Tacke et al., 2006). Clodronate was a gift from Roche and was incorporated into liposomes as described (Van Rooijen and Sanders, 1994). Flow cytometry. Multi-color staining for flow cytometry was performed as described 9
10 (Hieronymus et al., 2005). Monoclonal antibodies to mouse MHC-II (I-A/I-E; clone 2G9), CD11c-PE (HL3), CD24-PE, CD103-PE, Gr-1-biotin (Ly6C/G), CD209-biotin, Sirpα- APC, PerCP-Cy5.5- conjugated streptavidin, and respective isotype controls were from BD Biosciences. CD4-PE, CD8a-eFluor450, CD11b-eFluor450, CD40-APC, CD80-PE, CD44- efluor450, CD45.2-APC, CD62L-eFluor450, CD115-PE, CD205-PE, CD209-PE, EpCAM-eFluor450, TLR4-PE, F4/80-APC, Clec9a-PE, and corresponding isotype controls were obtained from ebioscience. CD11b-FITC was from Caltag Laboratories (Invitrogen). E-Cadherin-PE and CD205-biotin were from R&D Systems and Miltenyi Biotech, respectively. Alexa488- and Alexa546-conjugated monoclonal antibodies to langerin (clone 929F3) were from Dendritics. For intracellular staining of langerin, cells were fixed with 2% PFA in PBS and permeabilized in saponin buffer (1% saponin, 2 mm EDTA, 3% FCS, 0.02% Thimerosal in PBS). Flow cytometry analysis was performed on a FACSCalibur or FACSCanto (BD Biosciences) and data were analyzed with FlowJo software (Tree Star). LC analysis by immunofluorescence microscopy in normal and inflamed skin. To determine LC density and morphology, epidermal sheets from Id2 +/+ and Id2 -/- mice, Ccr2 -/- Ccr6 -/-, and NSG mice were prepared for immunofluorescence microscopy as follows. Dorsal and ventral halves were fixed on tape (crystal clear, Tesa) and incubated in PBS/0.02 M EDTA (Sigma-Aldrich) for 90 min at 37 C to allow separation of the epidermal sheets from dermis. Epidermal sheets were fixed in 100% ice-cold acetone for 20 min, rinsed in PBS and blocked with PBS/3% BSA for 30 min at room temperature before staining with Abs overnight at 4 C. For detection of LCs staining was performed with anti- MHC-II-FITC and anti-langerin-alexa546, or anti-langerin-alexa488 in combination with CD45.1-biotin (A20, ebioscience) and PE-conjugated streptavidin. Sheets were counterstained with DAPI (Vector Laboratories) before being mounted in ProLong Gold mounting media (Molecular Probes). Images were acquired using a fluorescence microscope (Axiovert 200, Zeiss) and a digital CCD camera (Roper Scientific) operated with IPlab software. Image processing was done with Adobe Photoshop software. LC numbers per mm 2 were calculated from microscopic fields. 10
11 Confocal laser-scanning microscopy. Confocal imaging of epidermal sheets was carried out on a LSM 510 or LSM 710 confocal microscope (Zeiss). With the LSM 510 a 63x 1.2 NA Zeiss water immersion objective was used. Alexa546-fluorescence was excited with the 543 nm emission line of the helium-neon laser and detected using a nm bandpass filter. FITC-fluorescence was excited with the 488 nm emission line of the argon laser and detected using a nm bandpass filter. Image processing was done with the Zeiss LSM image browser 4.2 software. With the LSM 710 a 40x 1.1 NA Zeiss water immersion objective was used. Alexa546-fluorescence was excited with the 561 nm emission line of a laser diode and detected using a nm bandpass filter. FITC-fluorescence was excited with the 488 nm emission line of the argon laser and detected using a nm bandpass filter. Quantitative PCR analysis of sorted cells. Total RNA of sorted cells was isolated using MagMAX-96 for Microarrays Kit (Ambion, Life Technologies) according to manufacturer s protocol. cdna synthesis was done using High Capacity cdna Reverse Transcription Kit (Applied Biosystems). For real-time PCR cdna from 150 cells was used per reaction with SYBR green (Fast SYBR Green Master Mix, Applied Biosystems) using a StepOnePlus Real Time PCR system (Applied Biosystems). Data were analyzed using StepOne TM Software v2.1 (Applied Biosystems) and for each sample Ct values were normalized to the corresponding Ct values of GAPDH. Primer sequences are listed in Supplementary Table S1 below. Relative expression values were subjected to bi-directional hierarchical cluster analysis using R software (R Development Core Team, 2012). 11
12 Table S1. Primer sequences for quantitative RT-PCR Gene Primer sequence Reference Langerin Smad7 Klf4 Tlr4 Id2 forward 5 ATGTTGAAAGGTCGTGTGGAC 3 reverse 5 GTGGTGTTCACTATCTGCATCT 3 forward 5 GCAGGCTGTCCAGATGCTGT 3 reverse 5 GATCCCCAGGCTCCAGAAGA 3 forward 5 CCAGACCAGATGCAGTCACAA 3 reverse 5 TGGCATGAGCTCTTGATAATGG 3 forward 5 TGGCTAGGACTCTGATCATGGC 3 reverse 5 TGAAGAAGGAATGTCATCAGGG 3 forward 5 AAAACAGCCTGTCGGACCAC 3 reverse 5 CTGGGCACCAGTTCCTTGAG 3 Kautz et al., 2008 Ruau et al., 2008 Lichtinger et al., 2007 Saika et al., 2006 GAPDH forward 5 ACCTGCCAAGTATGATGACATCA 3 Tagoh et al., 2004 reverse 5 GGTCCTCAGTGTAGCCCAAGAT 3 12
13 Supplemental References Kautz, L., Meynard, D., Monnier, A., Darnaud, V., Bouvet, R., Wang, R.H., Deng, C., Vaulont, S., Mosser, J., Coppin, H., and Roth, M.P. (2008). Iron regulates phosphorylation of Smad1/5/8 and gene expression of Bmp6, Smad7, Id1, and Atoh8 in the mouse liver. Blood 112, Lichtinger, M., Ingram, R., Hornef, M., Bonifer, C., and Rehli, M. (2007). Transcription factor PU.1 controls transcription start site positioning and alternative TLR4 promoter usage. J. Biol. Chem. 282, Ruau, D., Ensenat-Waser, R., Dinger, T.C., Vallabhapurapu, D.S., Rolletschek, A., Hacker, C., Hieronymus, T., Wobus, A.M., Muller, A.M., and Zenke, M. (2008). Pluripotency associated genes are reactivated by chromatin-modifying agents in neurosphere cells. Stem Cells 26, Saika, S., Ikeda, K., Yamanaka, O., Flanders, K.C., Ohnishi, Y., Nakajima, Y., Muragaki, Y., and Ooshima, A. (2006). Adenoviral gene transfer of BMP-7, Id2, or Id3 suppresses injury-induced epithelial-to-mesenchymal transition of lens epithelium in mice. Am. J. Physiol. Cell Physiol. 290, C Tagoh, H., Schebesta, A., Lefevre, P., Wilson, N., Hume, D., Busslinger, M., and Bonifer, C. (2004). Epigenetic silencing of the c-fms locus during B-lymphopoiesis occurs in discrete steps and is reversible. EMBO J. 23, Van Rooijen, N., and Sanders, A. (1994). Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J. Immunol. Methods 174,
Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
More information7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells.
Antibody staining for Ho uptake analyses For HSC staining, 10 7 BM cells from Ho perfused mice were stained with biotinylated lineage antibodies (CD3, CD5, B220, CD11b, Gr-1, CD41, Ter119), anti Sca-1-PECY7,
More informationSupplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationThe RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The
SUPPLEMENTARY MATERIALS AND METHODS Real time quantitative PCR The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The RT-qPCR was performed on the Applied Biosystems StepOne TM
More informationReal-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:
More informationSupplementary Fig. 5
Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency
More informationSupporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
More informationFigure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.
LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4
More informationSupplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +
Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase
More informationSupplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined
More informationMeasurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer
SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min
More informationIn vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *
In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,
More informationTwo Distinct Types of Langerhans Cells Populate the Skin during Steady State and Inflammation
Article Two Distinct Types of Langerhans Cells Populate the Skin during Steady State and Inflammation Kristin Seré, 1,2,6 Jea-Hyun Baek, 1,2,6 Julia Ober-Blöbaum, 1,2,6,7 Gerhard Müller-Newen, 3 Frank
More information15h. 24h. Blander & Medzhitov supplementary Figure 1. Apoptotic cells. Apoptotic LPS blasts 30% 32% 32% + Exogenous LPS 0.1% 31% 21% 20% 48% 60% 53%
a None Apoptotic cells Apoptotic LPS blasts 30% 32% 32% Apoptotic cells + Exogenous LPS 6h 0.1% 31% 21% 20% 48% 60% 53% 15h 0% 7% 5% 4% 30% 32% 32% 24h CD11c 0% 8% 2% 2% CFSE Blander & Medzhitov supplementary
More informationThe transcrip-on factor NR4A1 (Nur77) controls bone marrow differen-a-on and survival of Ly6C monocytes
Supplementary Informa0on The transcrip-on factor NR4A1 (Nur77) controls bone marrow differen-a-on and survival of Ly6C monocytes Richard N. Hanna 1, Leo M. Carlin 2, Harper G. Hubbeling 3, Dominika Nackiewicz
More informationefluor Organic Dyes 450/50 BP Fluorescence Intensity Wavelength (nm)
efluor Organic Dyes efluor Organic Dyes Catalog No. Description Clone Application Anti-Mouse efluor 450 Products 48-0042 Anti-mouse CD4 RM4-5 Flow Cytometry 48-0081 Anti-mouse CD8 53-6.7 Flow Cytometry
More informationSupplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05574 SUPPLEMENTARY INFORMATION Supplementary Results Additional Materials and Methods Analysis of epidermal wholemounts and sections: Tail epidermis. The patterned organisation of tail
More informationThe following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700
Flow cytometry analysis and cell sorting The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700 anti-cd5. (), APC-Cy7 anti-epcam (G.; Biolegend, San Diego, CA), PE-Cy7 anti-cd31
More informationNature Immunology: doi: /ni.1744
Macrophage colony stimulating factor induces macrophage proliferation and survival through a pathway involving DAP12 and β-catenin Karel Otero, Isaiah R Turnbull, Pietro Luigi Poliani *, William Vermi
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSupplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
More informationTable S1. Antibodies and recombinant proteins used in this study
Table S1. Antibodies and recombinant proteins used in this study Labeled Antibody Clone Cat. no. Streptavidin-PerCP BD Biosciences 554064 Biotin anti-mouse CD25 7D4 BD Biosciences 553070 PE anti-mouse
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationFour different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and
SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer
More informationYalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A.
Supplementary information Thymic epithelial cell expansion through matricellular protein CYR61 boosts progenitor homing and T- cell output Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet,
More informationMultiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,
Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude
More informationSupporting information. Supplementary figures.
Supporting information. Supplementary figures. Figure S1. Vacuolar parasite content is independent of the number of vacuoles per cell. The datasets employed for Fig. 1B were examined to determine the number
More informationPhagocytosis Assay Kit (IgG PE)
Phagocytosis Assay Kit (IgG PE) Item No. 600540 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationF4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated
SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationSupplemental Information. Histo-Cytometry: A Method for Highly Multiplex. Quantitative Tissue Imaging Analysis Applied to
Immunity, Volume 37 Supplemental Information Histo-Cytometry: A Method for Highly Multiplex Quantitative Tissue Imaging Analysis Applied to Dendritic Cell Subset Microanatomy in Lymph Nodes Michael Y.
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Histogram displaying the distribution of DNA barcode copy numbers for each virus library. 100,000 BB88 cells were infected by lentivirus that carried the corresponding
More informationSupplementary Figure 1
DOI: 1.138/ncb273 Supplementary Figure 1 a 1x DAPI field images 4x contoured cells 2µm 5µm b Tissue map Dot plot Histogram Y X antigen X DAPI antigen X Figure S1 Laser Scanning Cytometry of bone marrow
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationFlow Cytometry SOP: Monocytes from Frozen Cells
Flow Cytometry SOP: Monocytes from Frozen Cells Purpose This SOP standardizes the procedure for measuring immune cells using flow cytometry in ACTG Immunology Laboratories. Materials 1. 12x75mm flow tubes
More informationA Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)
More informationSupplementary information
Supplementary information Epigenetic silencing of retinoblastoma gene regulates pathologic differentiation of myeloid cells in cancer Je-In Youn, Vinit Kumar, Michelle Collazo, Yulia Nefedova, Thomas Condamine,
More informationSupplemental methods Supplemental figure and legend...7. Supplemental table.. 8
Supplemental Digital Content (SDC) Contents Supplemental methods..2-6 Supplemental figure and legend...7 Supplemental table.. 8 1 SDC, Supplemental Methods Flow cytometric analysis of intracellular phosphorylated
More informationSingle-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads
S S Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads (Miltenyi Biotech) and T cells were positively selected by magnetically activated cell sorting (MACS). 50x10 6 or greater
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Diffusion of MCF-7 and 3T3 cells. (a) High-resolution image (40x): DAPI and Cy5-CellTracker TM stained MCF-7 cells. (b) Corresponding high-resolution (40x)
More informationFigure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse
Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti
More informationMicroRNAs Modulate Hematopoietic Lineage Differentiation
Chen et al., page 1 MicroRNAs Modulate Hematopoietic Lineage Differentiation Chang-Zheng Chen, Ling Li, Harvey F. Lodish, David. Bartel Supplemental Online Material Methods Cell isolation Murine bone marrow
More informationSupplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
More informationSI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers
SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei
More informationTIB6 B16F1 LLC EL4. n=2 n=7 n=9 n=6
Shojaei et al., Supplemental Fig. 1 9 Mean Inhibition by anti-vegf (%) 7 5 3 1 TIB6 n=2 n=7 n=9 n=6 Supplemental Figure 1 Differential growth inhibition by anti-vegf treatment. The percent of tumor growth
More informationisolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
More informationSupporting Information
Supporting Information Chiu et al. 10.1073/pnas.0911405106 SI Methods Mice and Symptomatic Analysis. For generation of msod1 G93A C4 / animals, male B6.mSOD1 G93A mice (lowcopy substrain; Jackson Laboratories)
More informationNo wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
More informationB Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily
Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment
More informationSupplementary Table-1: List of genes that were identically matched between the ST2 and
Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationSUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin
More informationInterferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information
Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto
More informationFACS. Chromatin immunoprecipitation (ChIP) and ChIP-chip arrays 3 4
FACS Stem progenitor sorting for progenitor analysis Adult bone marrow cells were depleted with Miltenyi lineage depletion column (Miltenyi). For identification of CMPs, GMPs, and MEPs the cells were incubated
More informationWelcome to More Choice. Mouse Panels
Welcome to More Choice Mouse Panels Choose from our extensive portfolio of high-quality fluorescent-conjugated reagents to build your multicolor flow cytometry panels. Welcome to a More Colorful World
More informationSOPVII-7. Panel X: NK-characterization
Created by judith.eckl Page 1 of 8 09/06/2011 SOPVII-7 Panel X: NK-characterization Date: Author: Petra Prinz, Judith Eckl Experimenter: Date: 08/06/2011 Experiment description: Version: 1.0 Start: End:
More informationAntibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing
Antibody used for FC The following antibodies were used following manufacturer s instructions: anti-human CD4 (clone HI3, IgG1, k - Becton Dickinson), anti-human CD33 (clone WM3, IgG1, k- Becton Dickinson),
More informationDURACLONE IM ACCELERATE YOUR PACE IN IMMUNE SYSTEM RESEARCH. For Reseach Use Only - Not for use in Diagnostic procedures
DURACLONE IM ACCELERATE YOUR PACE IN IMMUNE SYSTEM RESEARCH Your clinical research trial companion For Reseach Use Only - Not for use in Diagnostic procedures ACCELERATE YOUR PACE IN IMMUNE SYSTEM RESEARCH
More informationHuman skin punch biopsies were obtained under informed consent from normal healthy
SUPPLEMENTAL METHODS Acquisition of human skin specimens. Human skin punch biopsies were obtained under informed consent from normal healthy volunteers (n = 30) and psoriasis patients (n = 45) under a
More informationQuantitative real-time RT-PCR analysis of the expression levels of E-cadherin
Supplementary Information 1 Quantitative real-time RT-PCR analysis of the expression levels of E-cadherin and ribosomal protein L19 (RPL19) mrna in cleft and bud epithelial cells of embryonic salivary
More informationSupporting Information
Supporting Information Tomura et al. 1.173/pnas.8227815 WT CFSE Con A stimulation Before After 2 3 1 CFSE Kaede- Tg No photoconversion Photoconversion Kaede Red Fig. S1. Dilution of photoconverted Kaede
More informationNature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
More informationCancer inflammation research applications and products
Cancer inflammation research applications and products Flow cytometry Immunoassays Cell imaging Instrumentation Invitrogen Attune NxT Flow Cytometer Antibodies RNA flow Conjugated antibodies for flow cytometry
More informationSupporting Information
Supporting Information of Laser Immunotherapy in Combination with Perdurable PD-1 Blocking for Treatment of Metastatic Tumor Lihua Luo, Chunqi Zhu, Hang Yin, Mengshi Jiang, Junlei Zhang, Bing Qin, Zhenyu
More informationMice TRAMP mice were maintained in a C57BL/6J background. Syngeneic UBI-GFP/BL6 mice were used for bone marrow engraftment. 2
Antibodies Chicken IgY polyclonal α-gfp antibodies were purchased from Abcam (Cambridge, MA) and were detected using α-chicken IgY-FITC or α-chicken-hrp (also purchased from Abcam). The CD31-PE, CD11b-PE,
More informationApplication Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar
September Assay Portability on the BD FACSVerse System Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar Contents Summary Introduction 3 Objective 4 Methods 6 Results Discussion Conclusions
More informationFlow Cytometry Immune Activation SOP
Flow Cytometry Immune Activation SOP Purpose This SOP standardizes the procedure for measuring immune activation of T cells using flow cytometry in ACTG Immunology Laboratories. Materials 1. 12x75mm flow
More informationSupplemental Figure 1
Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium
More informationSupplemental material and methods
Supplemental material and methods Antibodies: Primary antibodies used for these stainings were 174/2 1 (migg1 against PV-1), PAL-E 2 (migg2a; Abcam, Cambridge, UK), anti-nrp-1 (monoclonal migg2a or polyclonal
More informationMurine and Non-Human Primate Dendritic Cell Targeting Nanoparticles for In Vivo Generation of Regulatory T-Cells
Murine and Non-Human Primate Dendritic Cell Targeting Nanoparticles for In Vivo Generation of Regulatory T-Cells Sebastian O. Stead 1, Svjetlana Kireta 2, Steven James Peter McInnes 3, Francis D. Kette
More informationBD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information
Technical Data Sheet Streptavidin Particles Plus - DM Product Information Material Number: Size: Storage Buffer: 557812 5 ml Aqueous buffered solution containing BSA and 0.09% sodium azide. Description
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1: Phenotypically defined hematopoietic stem and progenitor cell populations show distinct mitochondrial activity and mass. (A) Isolation by FACS of commonly
More informationFlow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
More informationPrinciples of Multicolor Panel Design BD. BD, the BD Logo and all other trademarks are property of Becton, Dickinson and Company.
1 Principles of Multicolor Panel Design 2 Common Multicolor Applications Intracellular cytokine staining Regulatory T cells (Tregs) Protein phosphorylation (BD Phosflow) Leukemia and lymphoma phenotyping
More informationCD1a-autoreactive T cells are a normal component of the human αβ T cell repertoire
CDa-autoreactive T cells are a normal component of the human αβ T cell repertoire Annemieke de Jong, Victor Peña-Cruz, Tan-Yun Cheng, Rachael A. Clark, Ildiko Van Rhijn,, D. Branch Moody Division of Rheumatology,
More informationFlow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining Western blotting RT-PCR
Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining The capability of cells, either PBMC or purified T- cell lines, to inhibit parasite growth or merozoite
More informationSUPPLEMENTARY FIG. S2. Expression of single HLA loci in shns- and shb 2 m-transduced MKs. Expression of HLA class I antigens (HLA-ABC) as well as
Supplementary Data Supplementary Methods Flow cytometric analysis of HLA class I single locus expression Expression of single HLA loci (HLA-A and HLA-B) by shns- and shb 2 m-transduced megakaryocytes (MKs)
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationTitle: Stromal Cell Subsets Directing Neonatal Spleen Regeneration
Title: Stromal Cell Subsets Directing Neonatal Spleen Regeneration Authors: Jonathan K.H. Tan and Takeshi Watanabe SUPPLEMENTAL INFORMATION Supplemental Tables 1-4 Supplemental Figure 1 Table S1. Marker
More informationPCCS Growth Media, Cell Tagging, Cell Separation Final Assignment. Igneris Rosado-Erazo. Panama College of Cell Science
Running Head: Growth Media, Cell Tagging, Cell Separation PCCS Growth Media, Cell Tagging, Cell Separation Final Assignment Igneris Rosado-Erazo Panama College of Cell Science In partial fulfillment of
More informationMarilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-
Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,
More informationFigure S1 Proteasome inhibition leads to formation of aggregates in human cells and tissues. (a)
SUPPLEMENTARY MATERIAL Figure S1 Proteasome inhibition leads to formation of aggregates in human cells and tissues. (a) Flow cytometry. Cells were treated with MG132 for the indicated times. Cells were
More informationNature Biotechnology: doi: /nbt.4086
Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3
More informationSupporting Information
(xe number cells) LSK (% gated) Supporting Information Youm et al../pnas. SI Materials and Methods Quantification of sjtrecs. CD + T subsets were isolated from splenocytes using mouse CD + T cells positive
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationCompetitive Bone-marrow Transplantations Maria Maryanovich and Atan Gross *
Competitive Bone-marrow Transplantations Maria Maryanovich and Atan Gross * Biological Regulation, Weizmann Institute of Science, Rehovot, Israel *For correspondence: atan.gross@weizmann.ac.il [Abstract]
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3342 EV O/E 13 4 B Relative expression 1..8.6.4.2 shctl Pcdh2_1 C Pcdh2_2 Number of shrns 12 8 4 293T mterc +/+ G3 mterc -/- D % of GFP + cells 1 8 6 4 2 Per2 p=.2 p>
More informationPURPOSE: To delineate the subsets of human lymphocytes based on the expression profiles of different phenotypic markers by FACS analysis
LABORATORY PROCEDURE: IMMUNOPHENOTYPING: Lymphocyte Staining for FACS Analysis Date: April 29 2014 Authors: Jennifer Hossler PURPOSE: To delineate the subsets of human lymphocytes based on the expression
More informationBest practices in panel design to optimize the isolation of cells of interest
Sort Best practices in panel design to optimize the isolation of cells of interest For Research Use Only. Not for use in diagnostic or therapeutic procedures. Alexa Fluor is a registered trademark of Life
More informationIsolation of mouse monocytes: Mouse monocytes were isolated using a modified
Supplemental Material Extended Methods Isolation of mouse monocytes: Mouse monocytes were isolated using a modified method described (1). Citrated mouse whole blood was mixed with equal volume of PBS,
More informationNanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity
Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity Daisuke Muraoka, Naozumi Harada,, Tae Hayashi, Yoshiro Tahara,, Fumiyasu
More informationMethods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
More informationFlowcytometry-based purity analysis of peritoneal macrophage culture.
Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate
More informationSupplementary Materials and Methods:
Supplementary Materials and Methods: Reagents Immune complexes (ICs) were prepared as described previously (31). In short, FITC-labeled human serum albumin (HSA, 1 mg/ml) (Abcam) was incubated with polyclonal
More informationAssay Name: Antibody-Dependent Drug Uptake Assay
Assay Name: Antibody-Dependent Drug Uptake Assay Assay ID: Celigo_02_0019 Table of Contents Experiment: Antibody-Dependent Drug Uptake Assay... 2 Celigo Setup...2 Assay Protocol and Plate Setup...3 Results...5
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13420 Estimating SRC number by the Poisson distribution of random events Schematic flowchart explaining the calculation made to estimate the number of transplanted SCID repopulating cells
More informationIdentification of a radio-resistant and cycling dermal dendritic cell population in mice and men
Published Online: 20 November, 2006 Supp Info: http://doi.org/10.1084/jem.20060667 Downloaded from jem.rupress.org on July 3, 2018 ARTICLE Identification of a radio-resistant and cycling dermal dendritic
More information