SUPPLEMENTARY INFORMATION

Transcription

1 doi: 1.138/nature Fraction Bordering Fraction Aggregating Promoter Head neurons expressing npr-1 cdna Genotype WT - - URX AQR ALN AVM gcy-35 sax-7 gcy-32+ gpa-3 RMG ILs URX AQR ASH ADF ADL ASK ASI ASJ AIY AIZ npr-1(ad69) gcy-32+ odr-2b URX AQR ASG IL2 AIZ AIB AVG gcy-32+ nhr-79 URX AQR ASH ADL Supplementary Figure 1: Aggregation behaviors of additional npr-1-rescued strains. f these strains, only sax-7::npr-1 suppressed high locomotion speed on food (data not shown). The sax-7 promoter was not used for further studies, because of unstable and irregular expression. For one line that rescued well, expression was seen in RMG, BDU, hypodermis, rectal epithelium, and unidentified tail neurons. Neurons listed in bold are found in the endogenous npr-1 expression set. Asterisk, different from npr-1(ad69) (P <.1, Bonferroni's multiple comparison test). Error bars indicate s.d. 1

2 doi: 1.138/nature Avoidance Index Cell ablation - - MCK RMG 1 Genotype WT osm-1(n162) npr-1(ad69) Supplementary Figure 2: RMG-ablated npr-1(ad69) animals avoid solutions of high osmolarity. Animals were tested using the dry drop test with 1M glycerol. osm-1(n162) control animals are strongly defective in osmotic avoidance. Avoidance Index = Average number of responses of 8-1 animals in 8-1 trials. Asterisk, different from WT (P <.1, Student's t-test). Error bars indicate s.d. 2

3 doi: 1.138/nature7886 a b.2 Fraction Aggregating Speed on Food (mm. s -1 ) Fraction Bordering Speed on Food (mm. s -1 ) Promoter Driving TeTx Expression - - Cre/Lox - Cre/Lox Expression of flp-21::pkc-1(gf) Cell ablation treatment Genotype MCK RMG WT Neurons Expressing TeTx RMG RMG Pan-Neuronal crsnb expression Genotype WT npr-1(ad69) Supplementary Figure 3: a, TeTx light chain inhibits aggregation and related behaviors through synaptobrevin cleavage. Cleavage-resistant synaptobrevin (crsnb) was expressed in all neurons, and crossed into animals expressing TeTx light chain in RMG. Asterisk, different from npr-1(ad69);rmg::tetx (P<.1, Student's t-test). b, Suppression of high locomotion on food by ablating RMG in WT animals expressing flp-21::pkc-1(gf) (third lane in panel). Asterisk, different from mock ablated flp-21::pkc-1(gf) (P <.1, Student's t-test). Suppression of bordering was observed in RMG(-) animals, but because of the small number of ablated worms, neither aggregation nor bordering was quantified. Error bars indicate s.d. 3

4 a H doi: 1.138/nature7886 H H H H H H Supplementary Figure 4 H d F/Fo ASK 1 nm WT N2 npr-1(ad69) b.6 WT npr-1(ad69) -8 +Asc +Asc +Asc time (s) 1 ASK WT N2 8 1 µm npr-1(ad69) 6 Chemotaxis Index (1 nm) Ascaroside(s) F/Fo Asc +Asc +Asc time (s) 2 1 ASK mock ablated RMG (-) -1-2 F/Fo -3-4 c Chemotaxis Index (1 nm) no array ASK::tax-4 e F/Fo time (s) AIA 1 nm WT npr-1(ad69) Ascaroside(s) +Asc time (s) 5 AIA WT 1 µm npr-1(ad69) 4 3 F/Fo 2 1 time (s) +Asc time (s) 4

5 doi: 1.138/nature7886 Supplementary Figure 4: Effects of ascarosides on behavior and neuronal activity. a, Chemical structures of the three synthetic ascarosides. b, Chemotaxis of wild type and npr-1(ad69) animals to 1 nm of the individual ascarosides shown in a, and to equimolar combinations at 1 nm each. Asterisk, P <.1 by Student s t-test. c, Chemotaxis to the 1 nm ascaroside mixtures in tax-4(p678); npr-1(ad69) animals, and the same strain rescued by expressing tax-4 in ASK neurons. Asterisk, P <.1 by Student s t-test. d. ASK calcium responses of wild type and npr-1(ad69) animals to 1 nm (top panel, n = 7 per trace) and 1 µm (middle panel, n = 13 per trace) ascaroside cocktail. Bottom, ASK responses in mock-ablated (n = 1) and RMG-ablated (n = 9) npr-1(ad69) animals. Note that in all cases, the difference between npr-1 and wild type or RMG ablation is greatest in the first cycle of ascaroside presentation/removal. e, AIA calcium responses of wild-type and npr-1(ad69) animals to 1 nm (top panel, n =12 per trace) and 1 µm (bottom panel, n = 14 WT, n = 13 npr-1) ascaroside cocktail. For d and e, dark shading indicates presence of ascarosides, and light shading indicates s.e.m. 5

6 doi: 1.138/nature7886 Plasmid npr-1::npr-1 SL2 GFP gcy-32::npr-1 SL2 GFP flp-8::npr-1 SL2 GFP ncs-1::npr-1 SL2 GFP Figure 1 Expression Pattern AUA (96.3%), RMG (78.57%), ASG (78.57%), RIG (71.42%), SMBD (71.42%), AQR (71.42%), URX (64.2%), ASE (57.14%), 4-5 neurons anterior to nerve ring (likely ILs), body motor neurons, 2-4 tail neurons AQR, PQR, URX URX, AUA ADL, AFD, AIY/AVK, ASE, ASG, ASI, AVE, AWB, AWC, BAG, RMG, 1 additional cell anterior to nerve ring, 1 tail neuron flp-21::npr-1 SL2 GFP RMG (1%), ASJ (1%), URA? (1%), URX (88.9%), M2 pharyngeal neuron (88.9%), FLP? (77.8%), ASK (77.8%), ASH (33.3%), ASG (22.2%), ASI (22.2%), ADF (22.2%), unidentified tail cells Figure 3b, 4c, Supplementary Figure 4c gcy-36::tax-4 SL2 GFP AQR, PQR, URX srh-11:tax-4 SL2 GFP ASJ sra-9::tax-4 SL2 GFP ASK str-3::tax-4 SL2 GFP ASI Figure 3c, 4d gcy-36::tetx AQR, PQR, URX srh-11::tetx+sra-9::tetx ASJ, ASK Figure 3d, Supplementary Figure 3b gcy-36::pkc-1(gf) SL2 GFP AQR, PQR, URX gcy-27::pkc-1(gf) SL2 GFP ASI, ASJ, ASK flp-21::pkc-1(gf) SL2 GFP ADF, ASG, ASH, ASJ, ASK, URA?, FLP?, M2 pharyngeal neuron, RMG Supplementary Table 1: Full expression patterns of transgenes. Neurons were identified in 14 individual npr-1::npr-1 SL2 GFP animals, 9 flp-21::npr-1 SL2 GFP animals, 2 ncs-1::npr-1 SL2 GFP animals. The percentages correspond to the fraction of animals expressing GFP in the indicated neurons. Subsequent clones made with the above promoters were spot-checked for appropriate expression. In all figures, lines labeled RMG were made using the intersectional cre-lox strategy shown in Figure 2a. 6

7 doi: 1.138/nature7886 Molecular biology Coding Sequences The npr-1 cdna, including 5 and 3 UTRs sequences, was amplified by RT-PCR from C. elegans mixed stage RNA using the oligonucleotides 5 - agctacctgctagcacataggccaaatggaagttg-3 and 5 - agctaggtggtaccaaaaaaagatcataaaaactatttcagcaa-3 and cloned into the vector psm- SL2GFP via the NheI and KpnI sites. The pkc-1 cdna was amplified by RT-PCR from C. elegans mixed stage RNA using the oligonucleotides 5 -ctgttcacaggcaccgtgcgcgttc-3 and 5 - gtaggtaaaatgcggattgataaatg-3 and cloned into psm-sl2gfp via the NheI and KpnI sites. The gain-of-function A16E mutation was introduced by QuickChange (Stratagene). Tetanus toxin light chain (TeTx) was amplified from the Drosophila tetanus toxin light chain expression vector ptnt (courtesy S. Sweeney, Univ. of York 1 ) using the oligonucleotides 5 -gcgatcggatcgctagcatgccgatcaccatcaacaacttcc-3 and 5 - cgcgatccgatggtaccctagcggtacggttgtacaggttt-3 and cloned into the psm-mcherry vector using the NheI and KpnI sites to generated an mcherry fusion protein. The cleavage-resistant synaptobrevin (crsnb) coding sequence was amplified from a plasmid generously provided by Michael Nonet using the oligonucleotides 5 - agctgcttgctagcggaacagccggataagacc-3 and 5 -agctgcttggtaccgagttttcaacaccattttattcgc-3 and cloned into the psm vector using the NheI and KpnI sites. The tax-4 cdna was amplified by RT-PCR from C. elegans mixed stage RNA using the oligonucleotides 5 -agctgcttgctagcatgtcaacggcggaacctg-3 and

8 doi: 1.138/nature7886 agctgcttggtaccctatttgagcaaggattcagat-3 and cloned into the vector psm-sl2gfp via the NheI and KpnI sites. A NcoI-SacI fragment containing ncre was introduced into the NcoI and SacI sites of psm to generate psm-cre. To generate psm-loxplaczloxp, a ~3.5 kb LacZ cdna fragment from pjm67 was amplified with oligonucleotides 5 - taccgttcgtatagcatacattatacgaagttatatggtcgttttacaacgtcgtg-3 and 5 - agtagtggatcctattatttttgacaccagac-3 and 5 -gagagagctagctaccgttcgtatagcatacattatacg-3. The stop sequence was amplified using oligonucleotides 5 - gcgcagagatctaataaagaataaagaataaattt-3 and 5 -gagagagctagctaccgttcgtataatgtatgctat-3 from template oligonucleotides with the sequence 5 - gatctaataaagaataaagaataaattttttttgaaacatgaaacataacttcgtatagcatacattatacga agttata-3 and 5 -ccggtataacttcgtataatgtatgctatacgaagttatgtttcatgtttcaaaaaaaatt tattctttattctttatta-3. The LacZ and stop fragments were digested with BglII, ligated with T4 DNA ligase, and used as template for PCR with oligonucleotides 5 - gagagagctagcgataacttcgtatagcatacat-3 and 5 -gagagagctagcgataacttcgtataatgtatgc-3. The resulting PCR product was digested with NheI and ligated into the NheI site of psm- GFP. A Not-I fragment containing GCaMP2.2b (gift from Loren Looger) was introduced into psmnt to generate psmnt-gcamp3.1. Promoters 8

9 Generation of Transgenic Lines Transgenic lines were made using standard protocols 2. A fluorescent co-injection marker (ofm-1::dsred, elt-2::gfp, or elt-2::mcherry) was used to identify array-containing animals that were tested for social behavior. Listed in parentheses after each construct is the number of lines tested: Fig. 1: tag-168::npr-1 (2 lines); npr-1::npr-1 (7); gcy-32::npr-1 (3); flp-8::npr-1 (3); ncs-1::npr-1 (2); flp-21::npr-1 (3). Fig. 2: A single ncs-1::ncre line was crossed to two separate flpdoi: 1.138/nature7886 All promoters were amplified from N2 wild-type genomic lysates. The sequences of the promoter ends are shown below, along with the concentration at which resulting plasmids were injected for generation of transgenic lines: flp-21: tgaggtcacgcaacttgatgatcat, ctccaaaatccaaaaagtcattttc npr-1: ctcgagttctcgtgtttgtgtccgt, ctccattagactaaaaaaatttcag tag-168: aaaaagcaggcttctccttgaagct, tgcaggcgcccacacccagctttct ncs-1: ccaatctgcaataagctttactgtt, agagagaatcaagttgcaaatcaaa sax-7: gacatggatttgggtaaattggtct, ctagatcacgtcgaaagaccaccat gcy-32: atttccattccactgatgatgtgat, attcgaaagcggaaaggaaaatata gcy-36: tggatgttggtagatggggtttgga, aaattcaaacaagggctacccaaca flp-8: gcaatgagtgctcaaatggagtctg, tcagtccacacttttcaagtagaaa gcy-27: gtaaactgggagtgaaagcatctcc, tatgctttcagctgtactccttttg r9f1.6: gggcaaggacaatgttgccgcagaa, ttcatacgtcgttattttattccca sra-9: gcatgctatattccaccaaaagaaa, tagcttgtgcatcaatcatagaaca 4 ng/µl 75 ng/µl 2 ng/µl 2 ng/µl 75 ng/µl 5 ng/µl 2 ng/µl 4 ng/µl 5 ng/µl 5 ng/µl 5 ng/µl 9

10 doi: 1.138/nature ::LoxStopLox::npr-1 lines. Fig. 3: 3-4 lines were used for every tax-4 condition. gcy-36::tetx (2); flp- 8::TeTx (3); a single ncs-1::ncre line was crossed to two separate flp- 21::LoxStopLox::TeTx lines. 3-4 lines were used for every pkc-1(gf) condition. Fig. 4: A single representative line, previously validated in aggregation and related behaviors (Fig. 3) was tested in each condition. Supplementary Fig. 1: gcy-35::npr-1 (2); sax-7::npr-1 (3); gcy-32+odr-2b::npr-1 (3); gcy-32+nhr-79::npr-1 (2). Supplementary Fig. 3: A single tag-168::crsnb (1) line was crossed into the RMG::TeTx line with the strongest behavioral suppression. Strains Wild-type animals were C. elegans Bristol strain N2. Strains used in this study include: DA69 npr-1(ad69) X CX939-CX9391 npr-1(ad69) X; kyex196-kyex1961 [ pan-neuronal::npr-1 TAG- 168::npr-1 SL2 GFP, ofm-1::dsred] CX9395, CX9586 npr-1(ad69) X; kyex1965,kyex257 [gcy-32::npr-1 SL2 GFP, ofm- 1::dsRed] CX9396, CX9695, CX9777 npr-1(ad69) X; kyex1966, kyex2158, kyex2122 [flp- 21::npr-1 SL2 GFP, ofm-1::dsred] CX9592-CX9594 npr-1(ad69) X; kyex261-kyex263 [ endogenous npr-1 promoter::npr-1 npr-1::npr-1 SL2 GFP, ofm-1::dsred] 1

11 doi: 1.138/nature7886 CX9633-CX9634 npr-1(ad69) X; kyex296-kyex297 [flp-8::npr-1 SL2 GFP, ofm- 1::dsRed] CX9641-CX9643 npr-1(ad69) X; kyex214-kyex216 [sax-7::npr-1 SL2 GFP, ofm- 1::dsRed] CX9644-CX9645 npr-1(ad69) X; kyex217-kyex218 [ncs-1::npr-1 SL2 GFP, ofm- 1::dsRed] CX1114 npr-1(ad69) X; kyex2295 [ncs-1::ncre, ofm-1::dsred] CX1116 kyex2295; kyex2296 [flp-21::loxstoplox::gfp, elt-2::mcherry] CX1189-CX119 npr-1(ad69); kyex2295; kyex2352-kyex2353 [flp- 21::LoxStopLox::npr-1 SL2 GFP, elt-2::mcherry] CX9741 npr-1(ad69); kyex2144 [ncs-1::gfp] CX1645-CX1646 kyex2695-kyex2696 [ ASI+ASJ+ASK+URX+flp- 21::LoxStopLox::pkc-1(gf) gcy-36::pkc-1(gf), gcy-27::pkc-1(gf), flp- 21::LoxStopLox::pkc-1(gf), elt-2::mcherry] CX1252-CX1254 kyex2385-kyex2387 [flp-21::pkc-1(gf) SL2 GFP, ofm-1::dsred] CX1386 kyex2491 [ URX::pkc-1(gf) gcy-36::pkc-1(gf) SL2 GFP, ofm-1::dsred] CX1842 kyex2295; kyex2546 [gcy-36::pkc-1(gf) SL2 GFP, elt-2::gfp]; kyex2545 [flp-21::loxstoplox::pkc-1(gf) SL2 GFP, elt-2::mcherry] CX11379 kyex2295; kyex34 [ ASI+ASJ+ASK::pkc-1(gf) gcy-27::pkc-1(gf) SL2 GFP, flp-1::loxstoplox::pkc-1(gf) SL2 GFP, elt-2::mcherry] CX4819 tax-4(p678) III; npr-1(ad69) X CX1544-CX1546 tax-4(p678) III; npr-1(ad69) X; kyex263-kyex265 [ ASJ+URX::tax-4 srh-11::tax-4 SL2 GFP, gcy-36::tax-4 SL2 GFP, elt-2::gfp] 11

12 doi: 1.138/nature7886 CX1547-CX1549 tax-4(p678) III; npr-1(ad69) X; kyex266-kyex268 [ ASK+URX::tax-4 sra-9::tax-4 SL2 GFP, gcy-36::tax-4 SL2 GFP, elt-2::gfp] CX155-CX1552 tax-4(p678) III; npr-1(ad69) X; kyex269-kyex2611 [ ASK+ASJ::tax-4 srh-11::tax-4 SL2 GFP, sra-9::tax-4 SL2 GFP, elt-2::gfp] CX1553-CX1555 tax-4(p678) III; npr-1(ad69) X; kyex2612-kyex2614 [ ASK+ASJ+URX::tax-4 srh-11::tax-4 SL2 GFP, sra-9::tax-4 SL2 GFP, gcy-36::tax-4 SL2 GFP, elt-2::gfp] CX1556 tax-4(p678) III; npr-1(ad69) X; kyex2615 [ URX::tax-4 gcy-36::tax-4 SL2 GFP, elt-2::gfp]. CX1981 kyex2866 [ ASK::GCaMP2.2b sra-9::gcamp2.2b SL2 GFP, ofm-1::gfp] CX1982 npr-1(ad69) X; kyex2866 CX1173 kyex2916 [ AIA::GCaMP2.2b T1A4.1::GCaMP2.2b SL2 GFP, ofm- 1::GFP] CX11346 npr-1(ad69) X; kyex2916 CX17 npr-1(ad69); kyex2257 [gcy-36::tetx::mcherry, ofm-1::dsred] CX18-CX19 npr-1(ad69); kyex2258-kyex2259 [flp-8::tetx::mcherry, ofm- 1::dsRed] CX1191-CX1192 npr-1(ad69); kyex2295; kyex2354-kyex2355 [flp- 21::LoxStopLox::TeTx::mCherry, elt-2::mcherry] CX1388 kyex2493 [ pan-neuronal::crsnb TAG-168::snb-1(Q68V), elt-2::gfp] CX186 npr-1(ad69); kyex2295; kyex2771 [ RMG+ASJ+ASK::TeTx flp- 21::LoxP::TeTx, srh-11::tetx, sra-9::tetx, elt-2::mcherry] 12

13 doi: 1.138/nature7886 CX189-CX181 npr-1(ad69);kyex2295;kyex2774-kyex2775 [ URX+RMG::TeTx flp-21::loxp::tetx, gcy-36::tetx, elt-2::mcherry] CX187 npr-1(ad69); kyex2295; kyex2771; kyex2772-kyex2773 [gcy-36::tetx, elt- 2::GFP] 1 2 Sweeney, S.T., Broadie, K., Keane, J., Niemann, H., and 'Kane, C.J., Targeted expression of tetanus toxin light chain in Drosophila specifically eliminates synaptic transmission and causes behavioral defects. Neuron 14, (1995). Mello, C. and Fire, A., DNA transformation. Methods Cell Biol. 48, (1995). 13