Supporting Information

Transcription

1 Supporting Information Lee et al /pnas SI Experimental Procedures Plasmid and Strain Construction. (p)odr-3::gfp::egl-4 was constructed by excising the coding region of GFP and the first few codons of EGL-4 from (p)egl-4::gfp::egl-4 (M. Fujiwara, Hakozaki, Fukuoka, Japan) (1) and placing this downstream of (p) odr-3 in the (p)odr-3::egl-4 vector (2) using MscI and BglII restriction sites. (p)odr-3::gfp::egl-4 was coinjected (50 ng/μl) with the AWC marker (p)odr-1::dsred (25 ng/μl) and coelomocyte marker (P. Sengupta, Waltham, MA) (p)ofm-1::gfp (25 ng/μl) into N2 animals, and the subsequent transgenic line was integrated by trimethylpsoralen (TMP) (3). The transgeneic line with 50% transmission of the transgene is exposed to TMP and UV, and the F2s are cloned out as described in Yandell et al. (3); however, the integrants are screened for 100% transmission of the coinjection marker. Integration events were mapped to chromosomes, and one on chromosome V was chosen. This was outcrossed to N2 through 10 generations to rid the genome of TMPinduced mutations. This strain is called pyis500[(p)odr-3::gfp:: EGL-4]. (p)odr-3::gfp::egl-4(δnls) was constructed by removing the original nuclear localization signal (NLS) with the flanking restriction sites BglII and AflII and replacing it with ΔNLS coding sequences from ref. 2. NLS::GFP::EGL-4 was constructed by site-directed mutagenesis (QuikChange; Stratagene) to place the Sv40 NLS (CCAAAGAAGAAGCGTAAGGTA) into (p)odr- 3::GFP::EGL-4 at the N terminus of the GFP-coding region. This was injected at 25 ng/μl. (p)hsp-16.2::nls:: EGL-4 was constructed by site-directed mutagenesis (QuikChange; Stratagene) to place the Sv40 NLS right after the start codon of EGL-4 in (p) hsp-16.2::egl-4 from ref. 2. The heat-shock promoter came from ppd49.78 (gift of A. Fire, Stanford, CA). (p)hsp-16.2::nls:: EGL- 4 was coinjected (5 ng/μl) with (p)str-2::dsred (100 ng/μl) and (p)ofm-1::gfp (100 ng/μl) GFP::EGL-4. GFP::EGL-4(T276A and T398A) and GFP::EGL-4(D611N) mutants were constructed by site-directed mutagenesis with the following primers: GCA- CAAGAGCCGCATCAGTTCAA, AATCAACTCAAGACAA GTGAAAGTC, and ACTGGATATCTGAAACTTGTGAATT TCGGATTCGCAAAGAAAC, respectively. GFP::EGL-4 T276A;T398A was constructed by site-directed mutagenesis of T276A followed by site-directed mutagenesis of T398A. Each construct was injected into egl-4(n479) at 25 ng/μl with (p)ofm-1:: GFP (25 ng/μl) as the coinjection marker. Lines were selected for equivalent expression levels of GFP::EGL-4. For analysis of behavior, we used a line that rescued a behavioral phenotype of egl-4 (n479). Typically, one in three lines expressing the EGL-4 cdna rescued adaptation or butanone chemotaxis of the egl-4 mutant. We obtained enough lines to find three rescuing lines, and we used the line with the average behavioral responses for further analysis. In cases where we failed to see rescue of an EGL-4 phenotype or when we were examining a transgene in the wild-type genetic background, we generally had at least six lines; we chose one with an average phenotype and one that did not show dominant effects. Behavioral Assays. Odors (Sigma) were diluted in EtOH as follows: 1:200 benzaldehyde (bz), 1:1,000 butanone, 1:100 isoamyl alcohol, and 1:1,000 diacetyl. Odor adaptations were performed either in liquid or on plates as described (2, 4). Adaptation was performed by diluting odors in the following way: 9 μl bz, 14 μl butanone, and 4 μl of diacetyl were diluted into 100 ml S-basal buffer, and populations of animals were exposed to the diluted odor for 30 min for short-term exposure or 80 min for long-term exposure. These treated populations were then subjected to chemotaxis assays. For isoamyl alcohol, animals were exposed to 12 μl isoamyl alcohol on agar plugs placed on the lid of a chemotaxis assay plate. Recovery from adaptation was performed in S-basal buffer at room temperature, and the length of recovery time was chosen based on initial experiments, which showed that the shortest time in which we could observe reliable recovery was 60 min for the 30-min exposed animals. Because we failed to observe recovery in the 80-min exposed populations, we allowed them to recover as long as possible before the buffer-treated controls showed a decrease in chemotaxis that we attributed to starvation. Butanone repulsion was carried out as described in ref. 5. Each experiment was conducted on at least 3 separate days with >50 (usually 100) animals per assay. Transgenic extrachromosomal arrays carrying lines were scored on the fluorescence-dissecting scope using coelomocyte GFP as a marker for transgeneic individuals. The bars represent the means of all assays, and the error bars represent the SEM. Microscopic Assessment of GFP EGL-4 Subcellular Localization. To assess GFP EGL-4 localization, four to five L4 animals were placed onto a 9-cm OP50 seeded plate and incubated for 5 days at 22; their adult progeny were collected by washing plates with approximately 1 ml of S-basal buffer. Animals were washed 3 times in dh 2 0, exposed to odor or S-basal basal for 80, and then, placed onto a 1% agar pad containing 5 mm sodium azide. Twenty animals were observed at 63 times per experiment (Ziess Axioskop II), and each experiment was performed at least three times for each data point. The criteria for scoring GFP EGL-4 as nuclear were if the outline of the AWC nucleus was clearly visible and brighter than the cell body (similar to AWB); they were cytoplasmic if the nucleus was not visible. In ambiguous cases, the first ambiguous animal was scored as cytoplasmic and the next as nuclear etc. Double-blind experiments gave similar results. For butanone experiments, both AWC neurons were examined for each animal. For the AWC ON versus AWC OFF experiments, both AWC nuclei were examined, and the pstr-2:: dsred-expressing cell was assigned the AWC ON identity. The bars represent the mean values of the percentage of each population that exhibited nuclear GFP EGL-4 on each day, whereas the error bars represent the standard error of the mean. 1. Fujiwara M, Sengupta P, McIntire SL (2002) Regulation of body size and behavioral state of C. elegans by sensory perception and the EGL-4 cgmp-dependent protein kinase. Neuron 36: L Etoile ND, et al. (2002) The cyclic GMP-dependent protein kinase EGL-4 regulates olfactory adaptation in C. elegans. Neuron 36: Yandell MD, Edgar LG, Wood WB (1994) Trimethylpsoralen induces small deletion mutations in Caenorhabditis elegans. Proc Natl Acad Sci USA 91: Colbert HA, Bargmann CI (1995) Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 14: Tsunozaki M, Chalasani SH, Bargmann CI (2008) A behavioral switch: cgmp and PKC signaling in olfactory neurons reverses odor preference in C. elegans. Neuron 59: of5

2 Fig. S1. Immunologic characterization of endogenous EGL-4. (A) Western blot of 100 μl of either wild-type (N2, first two lanes) or egl-4(n479) mutant animals boiled for 30 min in Lamelli sample buffer and resolved on an 8% polyacrylamide gel with SDS. The first lane was incubated with preimmune serum, and the subsequent lanes were incubated with serum from a rabbit that had been exposed to a fragment of EGL-4. The left arrow indicates the mobility of full-length EGL-4, which is close to its predicted molecular weight of 87 kda. (B D) Fluorescence micrographs of the anterior ganglion of a wild-type animal that expressed GFP under the str-2 promoter to outline the AWC neuron are shown. The arrowhead points to the AWC neuron, the red line in C outlines the cell body, and the white indicates immunoreactivity with the same antiserum used in A above. Similarly treated egl-4(n479) animals showed no staining using this serum and these procedures (1). (E) Benzaldehyde exposure results in nuclear endogenous EGL-4. Animals were exposed to buffer (Upper) or benzaldehyde (Lower) for 80 min before fixing and staining (2), anti EGL-4 antibodies were followed by DAPI and rhodamine-conjugated secondary antibodies. The AWC cell body was visualized by pstr-2::gfp and outlined in green, whereas the nucleus, outlined in red, was visualized by DAPI. The staining seen in E is rhodamine. All eight benzaldehyde-exposed animals exhibited nuclear EGL-4 staining as seen in Upper, whereas 10 of 12 naïve animals showed the cytoplasmic EGL-4 seen in Lower. 1. Eastham-Anderson JR (2004) Nuclear translocation of EGL-4, a cgmp dependant (i.e. dependent) protein kinase, in response to odorant adaptation in C. elegans. Master s thesis (University of California, Davis, CA). 2. Nonet ML, Grundahl K, Meyer BJ, Rand JB (1993) Synaptic function is impaired but not eliminated in C. elegans mutants lacking synaptotagmin. Cell 73: Fig. S2. GFP EGL-4 and NLS-GFP EGL-4 are expressed at equivalent levels; 10 μl of packed worms were lysed and run on a 12% polyacrylamide gel. Proteins were transferred to nitrocellulaose and blotted with anti-gfp antibodies. GFP-tagged EGL-4 ran at the expected molecular weight of 114 kda, and soluble GFP was used as a loading control, because each population of transgeneic animals expressed GFP under the ofm-1 promoter as a coinjection marker. Thus, soluble GFP is used to normalize between populations. N2 animals expressing just the coinjection marker reveal the specificity of the anti-gfp antibody. 2of5

3 Fig. S3. Prolonged benzaldehyde exposure can cross-adapt the isoamyl-alcohol response in well-fed animals. (Upper) Exposure of fed wild-type animals expressing podr-3::gfp EGL-4 from an extrachromosomal array to buffer plus benzaldehyde for 80 min (dark bars) or buffer alone (light bars) are shown. The bars represent the mean percentage of animals with nuclear GFP EGL-4 in both AWCs over 3 separate days. On each day, >20 animals were scored. Error is SEM. (Lower) The same populations of animals were subjected to chemotaxis assays toward either benzaldehyde or isoamyl alcohol. The bars represent the mean chemotaxis index (CI) over 3 days, whereas the error is the standard error of the mean. 3of5

4 Fig. S4. Expression from the fos1a promoter was not appreciably affected by odor exposure. (Left) A micrograph of a naïve worm expressing cyan fluorescent protein (CFP) from the fos-1a promoter. (Right) The same strain of worm that had been exposed to benzaldehyde for 80 min. This was typical of >20 worms for each condition benzaldehyde chemotaxis index pstr-2 ::luciferase /unit DNA naive bz exposed naive bz exposed Fig. S5. Dynamic changes in str-2 expression cannot be seen during adaptation using a luciferase reporter. The destabilized luciferase reporter (1) was placed under the control of the str-2 promoter and the unc-54 3 UTR. Units of luciferase were assessed using standard luminometry and Promega luciferase assay kit. These values were normalized to transgene number through qpcr. Samples were obtained from naïve versus benzaldehyde exposed animals, and CIs are presented at the side. 1. Kaye JA, Rose NC, Goldsworthy B, Goga A, L Etoile ND (2009) A 3 UTR pumilio-binding element directs translational activation in olfactory sensory neurons. Neuron 61: of5

5 Table S1. str-2 expression in AWC neurons as a function of EGL-4 status Animals (percent) Genotype Heat 0 AWC pstr-2 ON 1 AWC pstr-2 ON 2 AWC pstr-2 ON n Wild type egl-4(loss of function)* egl-4(null); ex(podr-3::δnls EGL-4) egl-4(null); ex(phsp-16.2::nls EGL-4) Adult animals grown at 20 C were examined for pstr-2::rfp [in wild-type and egl-4(ks60) animals] or pstr-2:: DsRed [in wild-type and egl-4(n479) animals] in the AWC neurons. *The egl-4(loss of function) allele is ks60. The egl-4(null) allele was n479, and it was transgenic for the odr-3 promoter driving ΔNLS EGL-4. The egl-4(n479) was transgenic for the heat-inducible promoter driving NLS EGL-4. Animals were heat-treated for 2 h at 33 C and analyzed after min of recovery at room temperature. P < P = P = The P values for the significance of the difference between naïve and heat-treated animals were determined using a two-sample t test between proportions. 5of5