Silkworm genomics progress and prospects

Size: px
Start display at page:

Download "Silkworm genomics progress and prospects"

Transcription

1 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY Silkworm genomis progress n prospets J. Ngrju, n M. R. Golsmith** Lbortory of Moleulr Genetis, entre for NA Fingerprinting n ignostis, EIL Ro, Nhrm, Hyerb , Ini **eprtment of iologil Sienes, University of Rhoe Isln, Kingston, RI, , USA The biology n genetis of silkworm, ombyx mori, is the most vne of ny lepioptern speies. Its rih repertoire of geneti resoures n potentil pplitions in seriulture n s moel for other Lepiopter le to the initition of genomis reserh. uring the pst ee muh effort hs been me in the res of mrker evelopment, n moleulr mps hve been onstrute in stnr strins with the use of RFLPs, RAPs, ISSRs, STSs, n mirostellites. The potentil pplitions of moleulr mrkers n linkge mps inlue stok ientifition, Mrker Assiste Seletion (MAS), ientifition of Quntittive Trit Loi (QTL), n, ultimtely, positionl loning of visible muttions n QTL. To these ens, A librries hve been onstrute n re being use to mke lrge-sle physil mps, with mrkers bse on ESTs s frmework nhors. Altogether this work provies fountion for ientifition of gene funtion, gene n hromosome evolution, n omprtive genomis. THE silkworm, ombyx mori, omestite for silk proution for bout 5000 yers is the most well-stuie lepioptern moel system beuse of its rih repertoire of well hrterize muttions ffeting virtully every spet of the orgnism s morphology, evelopment, n behviour n its onsierble eonomi importne. y virtue of long history of silkworm rering for ommeril purpose, silkworm genetis hs been the subjet of onsierble reserh interest resulting in reful olletion, tloguing n mintenne of vrious silkworm geneti stoks of onsierble sientifi n eonomi interest. Toy, the opportunities for geneti mnipultion n stuy of the silkworm,. mori inlue more thn 400 visible muttions out of whih 200 hve been ssigne to onventionl linkge groups overing M (ref. 1). These muttions ffet mny funmentl spets of the inset s life yle, inluing egg n egg shell formtion, erly embryoni evelopment n pttern formtion, lrvl feeing behviour, molting, embryoni ipuse, et. In ition, vst rry of istint geogrphil res n inbre lines tht represent vrition for number of qulittive n quntittive trits of bsi biologil n eonomi interest inluing For orresponene. (e-mil: jngrju@ boy size, silk qulity, feunity, pthogen resistne, n het tolerne re vilble. In ft, the silkworm. mori is genetilly the best known inset next only to the fruitfly, rosophil melnogster. The hploi genome size of. mori is estimte to be 530 Mb (ref. 2), 3.8 times tht of. melnogster n one-sixth the size of the mmmlin genome. Supporte by the infrstruture of t n geneti resoures vilble for reserh, the silkworm is key moel orgnism in Lepiopter whih inlues more thn 160,000 speies, of whih ombyoi moths inlue silkmoths of eonomi importne n Notui moths, the lrgest group in the orer n inlues some of the most evstting pests of griulture, prtiulrly Heliothis (H. viresens, H. rmiger, H. ze). The genomi informtion of the moel speies. mori shoul be pplible to the most importnt speies in Lepiopter. omprtive stuies on genome sequenes between Lepiopter n other publishe genome sequenes oul unover lepiopter-speifi genes. Prouts of suh novel genes oul serve s trgets for lepiopternspeifi insetiies. ombyoi moths serete iverse vrieties of silk fibres. These speies inlue. mori of fmily ombyie n wil silkmoths tht belong to Sturniie, Anthere mylitt (Inin tropil tsr silkmoth), A. pernyi (hinese ok tsr silkmoth), A. ssm (Inin golen silkmoth), A. ymmi (Jpnese ok silkmoth) n Philosmi ynthi riini (Inin stor silkmoth). Silk proution bse on these moths, speilly. mori, A. pernyi, A. mylitt n A. ssm plys importnt role in rurl eonomies of mny populous eveloping ntions. Six million people in Ini lone re involve in seriulture, whih involves intensive lbour n provies the key to improving lol qulity of life. In orer to mke seriulture eonomilly vible, genes ffeting growth rte, yiel, fibre qulity, virus resistne n be tgge with moleulr mrkers for rpi onstrution of genetilly improve strins. onsiering the unique experimentl vntges of this orgnism n its eonomi importne, n Interntionl onsortium on Lepioptern Genomis ws reently forme to promote interntionl oopertion to sequene the genome of. mori n to unertke omprtive genomis of other eonomilly importnt Lepiopter 3. Suh interntionl oopertion is expete to foster knowlege both in the bsi n pp- URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST

2 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY lie spets of inset siene. The urrent efforts of severl lbortories ontributing to the silkworm genome projet hve, s their immeite objetive, the genertion of high ensity moleulr linkge mp, evelopment of tools n tehniques to fingerprint silkworm vrieties, ientifition of lepiopter-speifi genes, n genertion of lone-bse physil mp tht will llow virtully immeite ess to ny efine region of the euhromtin. The long-term objetive is to ientify the position, NA sequene n funtion of ll the genes in the orgnism. These re hievble gols onsiering the revolutionry evelopments in nlytil tools n tehnil fesibility of lrge-sle NA sequening s emonstrte reently in omplex genomes suh s rosophil n humn 4 6. In this review, we summrize the results rue in vrious genome nlysis projets now unerwy in severl lbortories in the re of moleulr genetis n genomis of the silkworm. Geneti mrkers In the pst ee, severl key vnes in moleulr biology hve gretly vne the impt of moleulr genetis in biology. Most importnt hve been: (i) evelopment of the polymerse hin retion (PR), whih mplifies speifi strethes of NA to usble onentrtions, (ii) the pplition of evolutionrily onserve sequenes s PR primers, (iii) the vent of hypervrible mirostellite loi s geneti mrkers n (iv) the vent of routine NA sequening in biology lbortories. These innovtions, ouple with the reent explosion of powerful nlysis n reltively user-frienly omputer progrms, hve elerte the pe t whih moleulr geneti t n be use for vrious progrmmes. These evelopments le to the etetion, nlysis n exploittion of nturlly ourring NA sequene polymorphisms in eukryotes n li fountion for ontemporry genomis of severl orgnisms. Polymorphi geneti mrkers hve foun potentil pplitions in niml n plnt improvement progrmmes s mens for vrietl n prentge ientifition, onstrution of moleulr linkge mps n evlution of polymorphi geneti loi ffeting quntittive eonomi trits. A wie rry of NA mrker tehniques is vilble for geneti stuies. All NA mrkers reflet ifferenes in NA sequenes. Typilly, in iploi orgnism, eh iniviul n hve one or two ifferent sttes (lleles) per hrter (lous). The hoie of prtiulr geneti mrker often epens upon the purpose of the stuy n is usully tre-off between prtility n preision of geneti mrkers. One mnifesttion of this is the ihotomy between multilous NA tehniques whih inlue Rnom Amplifie Polymorphi NAs (RAPs), Amplifie Frgment Length Polymorphisms 416 (AFLPs) n Inter-Simple Sequene Repet PR mrkers (ISSR-PR) n single lous tehniques whih inlue single opy nuler NA regions n mirostellites. Multilous methos result in simultneous visuliztion of mny ominnt mrkers n re tehnilly onvenient, but hve some mrke weknesses n limittions, inluing ominnt inheritne the NA frgment n be sore only s present or bsent, n in mny ses substntil proportion of vrition they etet n be non-heritble or not even erive from the trget orgnism. y ontrst, single lous mrkers re quite informtive beuse they provie lleles whose zygosity sttus n be ssye esily. evelopment of moleulr mrkers is importnt in the silkworm for onstrution of linkge mp, fingerprinting of strins for breeing, n mrker-ssiste seletion. In the erlier stuies, fingerprinting nlyses of silkworm strins hve been rrie out using RAPs 7, heterologous ministellite probes, km(2)8 (refs 8, 9), M13 (ref. 10), n ISSR-PR (ref. 11). Geneti linkge mps of silkworm hve been onstrute using RAPs 12 14, RFLPs 15, n AFLPs 16. Most of these mrkers, exept RFLPs, re ominnt n strin-speifi. onsiering the geneti informtiveness offere by mirostellite loi, whih re o-ominnt, mirostellite isovery progrmme in the silkworm genome ws initite 21. Mirostellites, lso known s simple sequene repets (SSRs), re short strethes of nuleoties in whih motif of one to six bses is tnemly repete, hve emerge s iel mrkers in eukryoti genetis. They re ubiquitous in prokryoti n eukryoti genomes n re rnomly istribute, both in protein oing n non-oing regions. The sequenes in mirostellite motifs n iffer in repet number mong iniviuls, proviing rey soure of polymorphism. With the vent of the PR, this property of mirostellite NA ws onverte into highly verstile geneti mrkers PR prouts of ifferent lengths n be mplifie using primers flnking the vrible mirostellite region (Figure 1). ue to the vntges offere by mirostellites they hve been use to onstrut linkge mps 20. In ition to their ler utility for prtil pplitions, informtion bout the istribution n vribility of mirostellite sequenes in the genome of given speies n help eluite its geneti history from the stnpoint of evolution n rtifiil seletion. Mirostellite motifs in the silkworm genome In previous stuy 21, nlysis of mirostellite loi lone n hrterize from. mori sub-genomi librry ws reporte. The totl frtion of the genome nlyse (2810 kb), whih ounts for 0.53% of the ombyx genome (530 Mb) yiele 57 (A) n /(GT) n n URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST 2002

3 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY Alleles #1 AAAAAAAAAAA #2 AAAAAAAAAAAAA #3 AAAAAAAAAAAAAAAA Genotypes 1/1 2/2 3/3 1/2 1/3 2/3 Figure 1. Mirostellite lleles n their etetion. Three lleles of ifferent sizes t mirostellite lous ompose of (A) repet re shown. The rrows inite the lous-speifi primers esigne for the region flnking the (A) repet, use for PR mplifition. Illustrtions of the vrious gel ptterns tht woul be observe with ifferent llele ombintions re inite. Tble 1. Perentge of ifferent tegories of (GT) n n (T) n mirostellites in silkworm, honey bee (Estoup, A. et l. 42 ) n humn (Weber, 1990). Number in prenthesis is the number of (GT) n or (T) n mirostellites nlyse Silkworm Honey bee Humn Type of motif GT (21) T (7) GT (23) T (52) GT (57) Perfet Imperfet ompoun (GA) n /(T) n hrbouring lones. The frequeny of ourrene of inuleotie repets, ws estimte to be, on verge, one (GT) n every 49 kb, n one (T) n mirostellite every 104 kb. The frequenies of ourrene of these two types of mirostellite motifs ompre well with those reporte in honey bee, pig, rt n humn. The perfet (no interruption in the run of repets), imperfet (interruption in the run of repets) n ompoun ( mixture of repets of two or more motifs) repet mirostellites in the silkworm genome were on the orer of 62%, 29% n 7% respetively (Tble 1). This is in lose greement with 72% perfet, 28% imperfet, n 11% ompoun repets in humn 22 (Tble 1). The primer pirs evelope for the flnking sequenes of the mirostellite loi isolte from the silkworm genome suessfully mplifie the repets prouing vriety of o-ominnt mrkers. This inite tht the mirostellite loi were onserve n not generlly erive from trnsposble elements, whih re expete to be mobile, giving rise to null lleles. A summry of the mirostellite loi n PR mplifition onitions for sets of representtive mirostellite loi re given in Tble 2. The polymorphisms, whih mnifeste s size ifferenes in the PR prouts, oul be esily sore ross silkworm strins (Figure 2). For exmple, the 15 mirostellite loi, 11 (GT) n n 4 (A) n, revele totl of 113 lleles in 13 silkworm strins. The number of lleles sore t eh lous in these strins vrie from s few s 3 to s mny s 17. The (A) n motifs showe teneny to revel greter number of lleles ompre to (GA) n motifs. For exmple, 11 (GT) n loi revele totl of 85 lleles, rnging from 3 to 17, with n verge of 7.7 lleles per lous wheres the four (T) n loi revele totl of 28 lleles rnging from 5 to 9 with n verge of 7 lleles per lous. Heterozygosity vlues All 15 mirostellite loi revele lleli length polymorphism in the 13 silkworm strins nlyse. The verge heterozygosity vlue ws 0.79, rnging from 0.66 to The most polymorphi lous, st2763, whih revele 17 lleles, lso showe the highest heterozygosity URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST

4 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY Tble 2. Mirostellite loi, repet pttern, forwr n reverse flnking primer sequenes, number of lleles, lleli rnge, heterozygosity vlues n nneling temperture (T) in ombyx mori Primer sequene Lous Repet No. Allele size Hetero- Mgl 2 symbol motif length Forwr Reverse lleles rnge (bp) zygosity T ( ) (mm) St158 (A) 9(A) 4 5 -ttgttgt-3 5 -gtttttttt St211 (GT) gtgtgttg-3 5 -gtttttttt St256 (A) 5(TA) 7 5 -ttgtgggggtgt-3 5 -tgtggggggtt St346 (GA) 9 5 -ggggggtgg-3 5 -tggtttgtggtgt St892 (GT) ttgttggttt-3 5 -ttggtgttttgtt St951 (GA) ttgtgtttggg-3 5 -ttgtgttt St962 (GT) tttttt-3 5 -tgtgtgggtgtgtt St1013 (GT) 9 5 -gtgtgggtggt-3 5 -tgtttt St1411 (GT) 8(GT) 5 5 -gtgtttgtggtgg-3 5 -ttgttttttttttttg St1423 (A) tttgtggttt-3 5 -gtgtttttg St1893 (A) tggtgttttt-3 5 -tttggtg St2550 (GA) ggtttgtggt-3 5 -ggtgggttgtgtt St2604 (T) 9 5 -gtgttgtt-3 5 -gtttgtttttgtt St2763 (GT) 22(GT) 7 5 -ggttttt-3 5 -gtggtttgttg St3513 (GT) 5(TGG) 6(TA) 2 5 -gtttgtttgt-3 5 -tggtttttttttg bp 200 bp 100 bp M Hu 204 KA N 1 N 7 N 18 Figure 2. Alleli vritions etete by mirostellite lous (mestst10) in ifferent silkworm strins. N 4 2 of This lous hrboure two strethes of (GT) motifs, one with 22 repets n nother with 7 repets. The lous st892, with (GT) 10 motif tht revele only 3 lleles in the 13 silkworm popultions, showe the lowest heterozygosity vlues. There ws no ler eviene with regr to the reltionship between the repet length n egree of polymorphisms. For exmple, lous st951 (GA) 23, revele 5 lleles with heterozygosity vlue of 0.68, n the lous st2604 with (GA) 9 showe 8 lleles with heterozygosity vlue of The loi tht were similr in length lso iffere in their number of lleles n heterozygosity. The loi st211, st892, st962 n st1893, whih rry repet motifs of (GT) 10, showe 6, 3, 6, n 7 lleles respetively. These results re in ontrst to the reports on humn n other speies where longer repets hve been reporte to generte higher egree of polymorphism 22,23..nihi Gungnong Mori Nistri Pure Mysore izo Srupt Geneti iversity stuies A vriety of moleulr tehniques hve been employe suessfully in silkworm to etet genome-wie polymorphisms. These methos inlue Restrition Frgment Length Polymorphisms n vriety of PR-bse tehniques. In stuy reporte by Ngrju et l. 8 n Shrm et l. 9, bne krit ministellite, km(2)8 ontining 545 bp NA sequene onsisting of 66 opies of GATA repets intersperse with vrible number of inuleotie (TA) repets in severl lotions, ws use s probe. The probe revele intr- n inter-popultion geneti iversity when teste on 13 ivergent silkworm genotypes. The pheneti nlysis of RFLP t seprte the 13 strins into three groups: one onsiste of ll ipusing strins (exept HU 204 ); the seon onsiste of ll non-ipusing strins (exept Pure Mysore n Nistri); n the thir onsiste exlusively of Pure Mysore n Nistri (Figure 3). In nother stuy, six nonymous multilous probes obtine from PstI subgenomi silkworm librry, were use on the sme set of 13 silkworm strins 24. The geneti informtiveness expresse in terms of number of loi revele (effetive multiplex rtio, EMR) n mount of polymorphism etete (iversity inex, I) ws ompre with the three PR-bse tehniques, Rnom Amplifie Polymorphi NA (RAP), Inter-Simple Sequene Repet PR (ISSR- PR) n simple sequene repets (SSRs). The six multilous RFLP probes proue 180 prouts of whih 97% were polymorphi; the 15 SSR loi gve rise to n verge of 8 lleles eh, of whih 86% were polymorphi; n ISSR-PR proue 39 frgments of whih 77% were polymorphi (Tble 3). The highest iversity inex ws observe for ISSR-PR (0.957) n the lowest (0.744) for RAPs (Tble 4). The RAPs, ISSR-PR 418 URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST 2002

5 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY Hu 204 KA N 1 N 7 N Hu 204 KA N 7 N 1 N ISSR N 4 2 Gungnong Srupt Mori.nihi PureMysore Nistri izo N RAP N 4 2.nihi Mori Srupt Nistri PureMysore izo Gungnong N Hu 204 KA N 1 N 7 N Hu 204 KA N 1 N 7 N RFLP N 4 2.nihi Gungnong Mori Nistri PureMysore izo Srupt N 72 SSR N 4 2.nihi Gungnong Mori Srupt Nistri PureMysore izo N Figure 3. enrogrms generte from geneti similrity mtries lulte using Nei n Li oeffiients for ISSR-PR, RFLP, RAP n SSR mrker ssys., ipusing silkworm strins; N, nonipusing silkworm strins. Numbers on the noes inite the number of times prtiulr brnh ws reore per 100 bootstrp replitions following 1000 replitions. Tble 3. A summry of eh type of mrker ssy performe on 13 silkworm strins Totl number Totl no. Totl poly- Men no. prouts Perentge of polyof ssys prouts morphi prouts per ssy morphi prouts SSR 15 (primer pirs) Inter-SSR 6 (primers) RAP 40 (primers) RFLP 6 (probes) Tble 4. A summry of men I, EMR n MI for ifferent mrker ssys of silkworms Men effetive Mrker Men iversity multiplex rtio Mrker inex ssy inex (I) (EMR) (MI) SSR Inter-SSR RAP RFLP I = 1 pi 2, where pi is the llele frequeny of the ith llele. EMR = n p(n p/n), where n p is the number of polymorphi loi n n is the totl number of loi. MI = I EMR. n multilous RFLPs lerly seprte the ipusing n non-ipusing silkworm vrieties, s i the km(2)8 probe (Figure 3). The nlysis of the sme set of 13 silkworm strins using 5 ifferent mrker systems highlighte the utility of eh of the mrker systems in geneti nlysis of silkworm. These results show tht ISSR-PR n multilous RFLP mrkers re powerful tehniques for fingerprinting silkworm vrieties. Although most ISSR loi re ominnt rther thn o-ominnt, ISSR-PR mrkers offer severl vntges over RFLPs for genotyping, the mjor one being the rpi proution of lrge number of mrkers in ost-effetive mnner. euse of these vntges, the ISSR-PR tehnique hs potentil use in silkworm breeing, germplsm evlution, n geneti mpping. The reently utomte ISSR-PR tehnique by inluing fluoresent ye in the PR retion followe by nlysis on n AI utomte sequener 25 hs been shown to be iel for high-resolution mpping experiments n NA profiling (see the lter setion of this rtile). Although multilous RFLP probes offer fetures URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST

6 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY suh s high reprouibility n esy soring, the requirement of lrge quntity of templte NA, n Southern hybriiztion rener them less suitble for lrge-sle stuies. In the RAP tehnique, though wiely use, mny ftors suh s onentrtion of Mg 2+, qulity of the templte, therml yler n the soure of polymerse hve been reporte to ffet the repetbility of the results between ifferent lbortories. In this spet, RAP nlysis my not be metho of hoie for lrge-sle genotyping experiments. onsiering the reprouibility, geneti informtiveness n spee, SSRs re the most useful mrkers mong ll the mrker systems. Sine SSRs re o-ominntly inherite, multilleli in nture, n n be multiplexe (5 6 loi n be nlyse on single lne) n utomte, they re useful for geneti iversity, peigree evlution n geneti mpping stuies. Although the initil ost to evelop lous-speifi primers is high, the vntges tht they re robust n re menble to utomtion ultimtely inrese the ostbenefit rtio, prtiulrly onsiering the vlue of being ble to ompre t sets iretly. ross-mplifition of ombyx mirostellites in Sturnii silkmoths n Notui moths Avnes in lepioptern genomis hve been limite by generl lk of geneti informtion for iniviul speies beuse of lk of geneti tools with bro pplibility ross speies 26. An essible pproh to suh problem is to look for hromosome onservtion ross speies by using omprtive genome mpping. Reent results 27 (Ngrju et l., uner preprtion) show tht mny ombyx mirostellite loi re onserve ross Sturnii silkmoths whih inlue most of the ommerilly importnt wil silkmoths suh s Anthere ssm (Mug silkworm), A. mylitt (Tropil tsr silkworm), n A. pernyi (Temperte tsr silkworm), s well s Notui moth, Helioverp rmiger, serious griulturl pest. onsiering tht the genetis of these moths hs hrly been stuie, the mirostellite evelopment progrmme in. mori mkes it possible to rry out moleulr geneti nlyses of these moths without investing in mirostellite evelopment progrmme for eh speies. The use of heterologous primers will signifintly reue the ost of eveloping mrkers for the wil silkmoths n griulturl pest, Heliothis spp. esies, s mpping is lrey unerwy in Heliothis 28,29, omprtive mpping pproh will enble the preition of the presene of mirostellites ssoite with genes of interest. Suh onserve loi oul be potentilly use for ssessing the evolutionry reltionships within n ross speies with resonble egree of ury. Linkge mps The first ttempt to onstrut moleulr linkge mps for the silkworm utilize RFLPs generte by 15 hrter- NNNN(A)n (A)nNN A repet NNNNNNNNNNNNAAAAA NNNNNNNNNNNTGTGTGTGTG NNNNNNNNNNNN Genom i NA NNN A repet NN(A)n (A)n NNNN PR prout 3 -nhore prim er PR prout 5 -nhore prim er Figure 4. Inter-Simple Sequene Repet-PR (ISSR-PR). A single primer trgeting (A) n repet nhore either t the 3 (tel rrows) or t the 5 en (yellow rrows) of the repet, is use to mplify genomi sequene flnke by two inversely oriente (A) n repets (pte from Zietkiewiz et l. 41 ). 420 URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST 2002

7 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY Figure 5. The Menelin segregtion of Fluoresent-ISSR-PR (FISSR-PR) mrkers in silkworm. The FISSR-PR mrkers were generte using primer 5 RAY RAT R (GA) 7 3 on two prentl strins, p50 n 108, n their F 1 n F 2 offspring. The rrows n rrowhes inite mrkers speifi to p50 n 108, respetively. ize single opy sequenes, 36 nonymous sequenes erive from folliulr NA librry, n 10 loi orresponing to low opy number retrotrnsposon, mg 15. Reently, this work ws extene using s probes prtilly sequene NAs (ESTs) erive from n embryoni n mternl mrna librry. y using the lssi bkross strtegy to etet linkge (see below), smll number of segregnts (e.g., 15 nimls) from bkrosses of single heterozygous femles erive from strins p50 n J02 to inbre J02-erive mles hve been use to ssign more thn 200 oominnt mrkers to 27 linkge groups n one inepenent mrker. Integrtion of these linkge groups with the onventionl geneti mps of morphologil n biohemil mrkers is unerwy, together with the reiprol bkrosses esigne to ssign reombintion istnes within eh linkge group (W. Hr, H. nno, H. Fuji, pers. ommun.). An RAP linkge mp of silkworm hs been onstrute using 320 rnom primers, whih proue 243 polymorphi prouts between two prentl silkworm strins, 108 n P50. In the F 2 popultion of 101 iniviuls use for these mps, segregtion rtios of 168 bns were nerly 3 : 1 in hi squre tests, showing Menelin inheritne 12. The MAPMAKER progrm sorte 168 bns into 29 linkge groups. The sum of mp istnes is pproximtely 900 M. Reently, Ngrj 14 hs onstrute Z-hromosome RAP linkge mp using bkross popultion () erive from rossing n F 1 (mle) heterozygous for reessive sex-linke mrker, trnslusent lrvl skin (o) homozygous trnsluent (o) (femle). In silkworm, both F 2 (Figure 6) n bkross popultions (Figure 7) hve been use by ifferent groups. Four groups hve use n F 2 popultion erive from ross of the sme two referene prentl strins, 108 n P50. Although both strins re of hinese origin, they exhibit high phenotypi iversity for suh omplex hrters suh s size, growth rte, ipuse, nutritionl requirements, generl vigour n ooon properties suh s ooon weight, ooon shell weight, n silk fibre length, suggesting tht onsierble polymorphism exists t NA level. ifferent groups hve use ifferent number of F 2 offspring for mpping, ffeting the bility to etet linkge between istl mrkers. Shi et l. 15 hve use 52 F 2 progeny for RFLP mps, wheres Promboon et l. 12 n Ysukohi 13 hve use 101 n 166 F 2 progeny, respetively, for mps bse on RAPs. The SSR n Fluoresent ISSR (FISSR) mrkers hve been mppe reently using the sme 101 F 2 offspring use by Promboon et l. 12. (Muthulkshmi, Kthirvel, Selvenrn n Ngrju, uner preprtion). The FISSR mrkers re prtiulrly vntgeous for high throughput genotyping in mpping of genomes 25 (Figures 4 n 5). For onstruting high-ensity linkge mps, lrge number of F 2 iniviuls nee to be nlyse using number of mrkers. The templte requirement in the se of other onventionl PR methos is reltively high. The FISSR ssy provies lrge number of NA mrkers per primer n llows etetion of mrkers with s little s 2 5 ng of templte NA, on n utomte sequener obviting the neessity for using riotive isotopes. kross popultions hve been use for mpping by three other groups 14,16. Ngrj 14 hs use polyvoltine strin, Pure Mysore, whose lrvl skin is norml white (+/+), n bivoltine strin (o/o), whose lrvl skin is trnsluent, ontrolle by reessive gene, o, lote on the Z hromosome. Fifty five progeny were use for mpping. Tn et l. 16 hve use similr bk ross with 47 offspring. Similrly, Hr n oworkers hve use bkross strtegy to mke initil linkge ssignments of oominnt mrkers using smll number of segregnts (15 offspring), to be followe up with muh lrger number of progeny (on the orer of 100) to evelop reombintion mp (W. Hr, pers. ommun.). The use of bkross popultions for mpping is wellestblishe in ombyx genetis n reently in griulturl pests. It is vntgeous sine it vois omplitions rising from the use of ominnt mrkers n filittes biphsi pproh to stuy linkge ue to the ourrene of hismti oogenesis (Figure 7). This URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST

8 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY pproh ws elegntly emonstrte reently by Hekel et l. in the mpping of mjor gene onferring resistne to t toxin in the imonbk moth, Plutell xylostell 28, n in the tobo buworm, Heliothis viresens 29, using AFLP mrkers. In these stuies two bkross popultions were rete, one by rossing n F 1 femle (erive from the initil ross between suseptible strin n resistnt strin) with its suseptible prent n seon bkross popultion by rossing n F 1 mle with the suseptible femle prent. From the first, popultion informtion on the linkge group ontributing to the trit for resistne ws erive. This is possible beuse in the bsene of rossing over in the F 1 femles, ll of the genes present on the linkge group hrbouring the gene for t toxin resistne woul show bsolute linkge. The seon popultion ws use to etermine the lotion of the trit of interest in the orresponing linkge group beuse rossing over uring gmetogenesis in the F 1 mles results in reombintion of mrkers n thus llows one to etermine mp istne between mrkers. A similr strtegy bse on the moleulr mp oul be use to trk genes of eonomi interest in silkworm. Quntittive genetis The onerte tion of two or more iniviul genes s well s their intertions with eh other n with the environment etermine mny importnt phenotypi hrteristis. Suh hrteristis re referre to s polygeni or quntittive trits, n the iniviul gene lotions s quntittive trit loi (QTLs). In silkworm lmost ll of the importnt eonomi trits suh s feunity, silk ooon weight, silk fibre length, silk fibre thikness, n resistne to bulovirus re quntittive in nture. Very little is known bout the number of genes involve, their hromosoml lotions, or their gene prouts. The evelopment of high ensity geneti linkge mps tht re bse on NA mrker loi provies useful tool for the resolution of these omplex trits into their iniviul geneti omponents 30. riefly, iniviuls from geneti rosses suh s F 2 or bkross popultions, or reombinnt inbre lines or ner isogeni lines obtine by repete rossing of strins with ontrsting phenotypes, re evlute for the phenotype of interest n for their genotype lsses t NA-bse mrker loi t regu- F 2 interross strtegy Prent 1 x Prent 2 F 1 femle No rossing over x F 1 mle rossing over ours* A A b b gmetes b A A Type 1 progeny *Non-reombinnt gmetes not shown Type 2 progeny Figure 6. Shemti representtion of the behviour of mrkers in n F 2 interross. Ahismti oogenesis mkes it possible to test whether linkge groups re relly inepenent or not. As shown in the figure, ny F 2 iniviul nnot be homozygous for both mternl n pternl ominnt mrkers on the sme utosome. This is speilly true for ominnt mrkers where it is not possible to istinguish homozygotes from heterozygotes. The bsene of mternl mrker in ertin F 2 progeny mens tht the nonreombinnt utosome of the progeny is pternl (Type 2 progeny), n vie vers (Type 1 progeny). As result, eh F 2 iniviul n be type for eh linkge group s to whether its non-reombinnt hromosome is pternl or mternl in origin. 422 URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST 2002

9 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY A A Prent 1 b b x Prent 2 Prent 2 x F 1 mle F 1 femle Prent 2 x rossing over ours b A No rossing over A b gmetes A non-reombinnt progeny Reombinnt progeny non-reombinnt progeny Figure 7. iphsi nture of geneti linkge in silkworm. Any two loi on the sme hromosome re bsolutely linke in femles s there is no rossing over uring oogenesis n the loi nnot reombine. Linkge in mles, on the other hn, epens on the reombintion istne seprting the two loi, beuse rossing over ours uring spermtogenesis. This biphsi nture of linkge filittes sequentil pproh to mpping. In the first phse, bsolute linkge in offspring of femle-informtive rosses is use to ientify the linkge groups, eh of whih orrespons to hromosome, ontributing to the trit of interest. In the seon phse, the lotion of the gene ontributing to the trit of interest within these groups is nrrowe own further by nlysing reombinnt offspring of mle-informtive mtings. lr 10- to 20-M intervls ross the genome. The ifferenes between the men phenotype n mrker genotype lsses re then use to etermine the genome positions n the effets of QTLs tht ontribute to the phenotype. The NA mrkers tht re losely linke to the trits of interest in silkworm oul be use to selet the trit in question in segregting popultion of n F 2 ross or using bulke segregnt nlysis 31, or with reombinnt inbre lines 32 or ner isogeni lines proue in silkworm improvement progrmmes. Of ourse, the effetiveness of suh NA mrker-ssiste seletion (MAS) will epen on the ury of the phenotypi lssifition of the trit of interest n the egree of linkge between mrker(s) n trits of interest in silkworm. ross-breeing strtegies hve been extensively use s mens of hrnessing heterosis in the silkworm 33. In ft hybri silkworms hve ontribute signifintly to the rmti inrese in silk proution of the worl 34. An enormous mount of breeing effort hs been investe in the evelopment of silkworm hybris, n this hs resulte in the relese of mny hybri ombintions in Jpn, hin, Ini n other ountries. While onsierble suess hs been hieve in silkworm hybri progrmmes, experimentl t pertining to the geneti bsis of heterosis in silkworm hve remine sre. The reent vnes in genome reserh hve generte onsierble interest in preiting hybri performne using moleulr mrkers in rop breeing progrmmes. Most of the stuies hve been reporte in orn n rie. A lrge number of stuies onute in mize hve proue vrible results: high orreltions between moleulr mrker istnes of the prents n hybri performne were etete in some stuies 35, while low orreltions were observe in others 36,37. In rie lso, there re extensive stuies on the reltionship between moleulr mrker heterozygosity n hybri performne. As in mize, results re vrible 38. Seletion of genetilly pure n ivergent prentl strins is ritil to the suess of hybriiztion progrmme in silkworm. The use of NA mrkers to relte the geneti homozygosity n geneti istne of the prentl strins to the mnifesttion of hybri vigour, n unerstning the geneti bsis of heterosis, will be quite useful to selet suitble prentl lines for hybriiztion progrmmes. Reently, moleulr mrkers hve been genotype on set of 22 silkworm strins rosse in full-illel progrmme (Ro, hnrshekrih n Ngrju, uner preprtion) to eliit the reltionship between within n between strin geneti vribility n the bsis of mi- n better-prent heterosis. The results inite positive orreltion between geneti istne n mi-prentl heterosis; there is lso eviene to show tht prentl homozygosity hs is- URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST

10 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY tint influene on the egree of mnifesttion of heterosis. Most importnt, the stuies enble them to ientify the silkworm inbre lines whih proue highly heteroti hybris. onsiering tht lrge number of silkworm inbre lines re mintine in the silkworm breeing sttions in Ini n other silk-prouing ountries, the vilble moleulr mrkers shoul be use to ientify the prentl lines tht re most suitble for proution of heteroti hybris. The silkworm strin-speifi mrkers oul lso be use for uthentition of vrieties, protetion of breeers rights, n perioil monitoring of the purity of vrieties. Physil mpping of the silkworm genome Isoltion n hrteriztion of genes of interest using mp-bse loning methos n systemti sequening of the ombyx genome by the propose Interntionl onsortium requires high resolution physil mp. A lone-bse physil mp onsists of set of orere, overlpping inserts of lone genomi NA. Suh mp ffors unique resoure for stuying the struture n funtion of the genome. The mp filittes the moleulr ientifition of genes of interest, n the lones in the mp provie rey ess to substrtes for genome sequening. A lone-bse mp lso opens up new opportunities for stuies of genome evolution. lone-bse mps hve been ssemble for severl moel orgnisms n griulturlly importnt speies. In most orgnisms, sets of overlpping lones overing uninterrupte strethes of the genome (ontigs) re ssemble by eteting overlps by mens of shre restrition frgments in fingerprints or shre sequene tgge sites (STSs). The onstrution of omprehensive n stble NA librries lone in pproprite lrge-sle vetors is essentil to obtin high-resolution physil mps of omplex eukryoti genomes suh s silkworm. Tht the ury n effiieny of physil mpping re in iret reltion to the men size of lone frgments in genomi librries enourge the evelopment of severl lrge-sle vetor systems in reent yers. Yest rtifiil hromosomes (YA) were the first wiely use systems, but mny problems ssoite with lone stbility, himerism, n low yiel le to the evelopment of nother lrge-sle loning system bse on the E. oli F ftor whih hs lrgely superee YA-bse loning. These vetors re referre to s teril Artifiil hromosomes (A) 39. A librries for silkworm hve been onstrute in three lbortories 40 (Mit et l., uner preprtion) from two. mori referene strins, p50 n 108, using nuler NA from posterior silkglns p50. Altogether these librries ontin more thn 30 genome equivlents, with verge insert sizes rnging from kb. The onstrution of A ontigs using shre STSs, hromosome wlking, n the fingerprinting methos is 424 unerwy in the Ntionl Institute of Agrobiologil Sienes, Tsukub, Jpn (Mit, K., pers. ommun.). In erly stuies, the previously reporte lose linkge between the ombyx homologs of the invete (m in) n engrile (m en) genes ws onfirme by onstrution of A ontig tht ontine both sequenes 40. Initil sreening of A librries hs lso revele informtion bout the hromosoml orgniztion of two genes, seriin-1, whih oes for one of the mjor ooon proteins, n the gene enoing the preursor protein of ipuse hormone n pheromone biosynthesis-tivting neuropeptie (the H-PAN gene), whih re lote within 22-kb intervl n re ivergently oriente. In ition to their use to orient n orgnize known genes in fine-struture mpping of silkworm hromosomes, A ontigs will serve s primry tools for lrge-sle sequening of the silkworm genome. Initil efforts re unerwy to trget selete portions of the genome, inluing hromosomes 1 (Z), 2, n W, with long-term plns to rry out omplete genome sequene (Mit, K., pers. ommun.). onluing remrks The tools n triks re now in ple for lrge-sle genomis of silkworm. The ner future will bring n explosive growth in funtionl gene informtion from the iptern prigm rosophil, of whih muh will be useful for silkworm. Foresighte efforts re lrey unerwy to initite the Interntionl Silkworm Genome onsortium to sequene the ombyx genome. Tehnology trnsfer from other genome projets will mke importnt ontributions in this enevour. The next few yers shoul be exiting for silkworm genomis, with gret stries being me in the EST sequening projet, A librry preprtion, onstrution of linkge mps, onstrution of trnsgeni silkworms for refrtoriness to virl iseses, n nlysis of QTL. Eqully exiting is the potentil pplition of the results of silkworm genomis reserh to other lepiopterns, prtiulrly Heliothines n wil silkmoths, whih represent the estrutive n benefiil extremes of this lrge n iverse inset orer. 1. oir, H., Fujii, H., Kwguhi, Y., Kihr, H. n nno, Y., Geneti Stoks n Muttions of ombyx mori, Institute of Geneti Resoures, Kyushu University, Jpn, Gge, L. P., hromosom, 1974, 45, Interntionl Lepioptern Genome Sequening onsortium ( 4. Ams, M.. et l., Siene, 2000, 287, Interntionl Humn Genome Sequening onsortium, Nture, 2001, 409, Venter, J.. et l., Siene, 2001, 291, Ngrj, G. M. n Ngrju, J., Eletrophoresis, 1995, 16, URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST 2002

11 SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY 8. Ngrju, J., Shrm, A., Sethurmn,. N., Ro, G. V. n Singh, L., ibi, Shrm, A., Niphkr, M. P., Kthirvelu, P., Ngrju, J. n Singh, L., J. Here., 1999, 90, Tretjk, A. P., Ryskov, A. P., Sevstynov, G. A., Fillipovih, Y.. n Strunnikov, V. A., FES Lett., 1992, 303, Rey, K.., Ngrju, J. n Abrhm, E. G., Hereity (UK), 1999, 83, Promboon, A., Shim, T., Fujiwr, F. n Kobyshi, M., Genet. Res., 1995, 66, Ysukohi, Y., Genetis, 1998, 150, Ngrj, G. M., Ph thesis, Univ. of Mysore, Shi, J., Hekel,. G. n Golsmith, M. R., Genet. Res., 1995, 66, Tn, Y-., Wn,., Zhu, Y., Lu,., Xing, Z. n eng, H. W., Genetis, 2001, 157, Litt, M. n Luty, J. A., Am. J. Hum. Genet., 1989, 44, Tutz,., Nulei Ais Res., 1989, 17, Weber, J. L. n My, P. E., Am. J. Hum. Genet., 1989, 44, ietrih, W. F. et l., Nture, 1996, 380, Rey, K.., Abrhm, E. G. n Ngrju, J., Genome, 1999, 42, Weber, J. L., Genomis, 1990, 7, Wu, K. S. n Tnksley, S.., Mol. Gen. Genet., 1993, 241, Ngrju, J., Rey, K.., Ngrj, G. M. n Sethurmn,. N., Hereity (UK), 2001, 86, Ngrju, J., Kthirvel, M., Subbih, E. V., Muthulkshmi, M. n Kumr, L.., Mol. ell. Probes, 2002, 16, Hekel,. G., Annu. Rev. Entomol, 1993, 38, Ngrju, J. n Muthulkshmi, M., V Intl. ong. Ento. rzil, Hekel,. G., Ghn, L. J., Liu, Y.. n Tbshnik, E.., Pro. Ntl. A. Si. USA, 1999, 96, Ghn, L. J., Goul, F. n Hekel,. G., Siene, 2001, 293, Lner, E. S. n otstein,., Genetis, 1989, 121, Mihelmore, R. W., Prn, I., Kesseli, R. V., Pro. Ntl. A. Si. USA, 1991, 88, Reiter, R. S., Willims, J. G. K., Felmn, K. A., Rflski, J. A., Tingey, S. V. n Solnik, Pro. Ntl. A. Si. USA, 1992, 89, Ngrju, J., Urs, R. n tt, R. K., Seriologi, 1996, 36, Ngrju, J., Klimenko, V. n ouble, P., in Enylopei of Genetis (e. Reeve, E..), Fitzroy erborn Press, Lonon, 2001, pp Smith, O. S., Smith, J. S.., owen, S. L., rown, S. L., Tenborg, R. A. n Wll, S. J., Theor. Appl. Genet., 1990, 80, Goshlk, E.., Lee, M. n Lnkey, K. R., ibi, 1990, 80, uley, J. W., Sghi Mroof, M. A. n Rufener, G. K., rop Si., 1991, 31, Sghi Mroof, M. A., Yng, G. P., Zhng, Q. n Grvois, K. A., ibi, 1997, 37, Shizuy, H., irren,., Kim, U. J., Mnino, V., Slepk, T., Thiiri, Y. n Simon, M., Pro. Ntl. A. Si. USA, 1992, 29, Wu,., Kwski, S. n Ysukohi, Y., Mol. Gen. Genet., 1999, 261, Zietkiewiz, E., Rflski, A. n Lbu,., Genomis, 1994, 20, Estoup, A., Soligne, M., Hrry, M. n ornuet, S. M., Nul. Ais. Res., 1993, 21, AKNOWLEGEMENTS. We thnk M. Muthulkshmi, M. Kthirvel n M. Selvenrn for helpful isussions. Finnil support to JN by the ept. of iotehnology, Govt. of Ini, New elhi is grtefully knowlege. URRENT SIENE, VOL. 83, NO. 4, 25 AUGUST

Primer in Population Genetics

Primer in Population Genetics Primer in Popultion Genetics Hierrchicl Orgniztion of Genetics Diversity Primer in Popultion Genetics Defining Genetic Diversity within Popultions Polymorphism number of loci with > 1 llele Number of lleles

More information

RAIN (RAndom INsertion) Scheduling Algorithm for SoC Test

RAIN (RAndom INsertion) Scheduling Algorithm for SoC Test RAIN (RAnom INsertion) Sheuling Algorithm for SoC Test Jung-Been Im Sunghoon Chun Geune Kim Jin-Ho An Sungho Kng Deprtment of Eletril n Eletroni Engineering Yonsei University 134, Shinhon-Dong Seoemoon-Gu,

More information

PRODUCTION METHOD. contact sulphuric acid plant, various kind of waste gases).

PRODUCTION METHOD. contact sulphuric acid plant, various kind of waste gases). "POL" PHOSPHATE FERTLZER DRY AND WASTE-FREE PRODUCTON METHOD / The elborted fertilizer prodution tehnology nd POL -phosphte fertilizer, re originl hievements dpted to present hnges in the rw-mteril nd

More information

Genetics and Resistance

Genetics and Resistance Genetis nd Resistne Development of Co-Dominnt Amplified Polymorphi Sequene Mrkers in Rie tht Flnk the Mgnporthe grise Resistne Gene Pi7(t) in Reominnt Inred Line 29 M. A. Cmpell, D. Chen, nd P. C. Ronld

More information

Mating-Type Distribution and Genetic Diversity of Cercospora sojina Populations on Soybean from Arkansas: Evidence for Potential Sexual Reproduction

Mating-Type Distribution and Genetic Diversity of Cercospora sojina Populations on Soybean from Arkansas: Evidence for Potential Sexual Reproduction Popultion Biology Mting-Type Distriution n Geneti Diversity of Cerospor sojin Popultions on Soyen from Arknss: Eviene for Potentil Sexul Reproution Hun Kim, Annky D. Newell, Royn G. Cot-Siekmeyer, John

More information

Practices and Strategic Investment Section

Practices and Strategic Investment Section FOREST PRACTICES Prties nd Strtegi Investment Setion Resoure Prties Brnh PO Box 9513 Stn Prov. Govt. Vitori. BC V8W 9C2 SILVICULTURE NOTE 3 July 211 Twenty-Yer Effets of Windrow Burning, Chemil nd Mehnil

More information

Chapter 9. Mapping and characterizing whole genomes. Structural Genomics Functional genomics

Chapter 9. Mapping and characterizing whole genomes. Structural Genomics Functional genomics Chpter 9 Mpping nd chrcterizing whole genomes Structurl Genomics Functionl genomics How mny genes hs humn? 5,500 27,000 Interprettion of genomic informtion: high throughput technologies re used to get

More information

Nonlinear Mixed Effects Model for Swine Growth

Nonlinear Mixed Effects Model for Swine Growth Nonliner Mixed Effects Model for Swine Growth A. P. Schinckel nd B. A. Crig Deprtment of Animl Sciences nd Deprtment of Sttistics, Purdue University Introduction Severl nonliner growth functions model

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture10924 no tg Lsm1-my Lsm2-my Lsm5-my Lsm6-my Lsm7-my Lsm8-my no tg Lsm1-my Lsm2-my Lsm5-my Lsm6-my Lsm7-my Lsm8-my kd 220 120 100 80 60 50 40 30 20 SeeBlue Mrker Mgi Mrk no tg Sm1-my Smd3-my

More information

Available online at ScienceDirect. Energy Procedia 49 (2014 ) SolarPACES 2013

Available online at  ScienceDirect. Energy Procedia 49 (2014 ) SolarPACES 2013 Aville online t www.sieneiret.om SieneDiret Energy Proei 49 (2014 ) 2340 2350 SolrPACES 2013 Comprison of solr power output foresting performne of the Totl Sky Imger n the University of Cliforni, Sn Diego

More information

Screening for temperature tolerance of some. Aspergillus spp. Lahore-54590, Pakistan. *E. mail:

Screening for temperature tolerance of some. Aspergillus spp. Lahore-54590, Pakistan. *E. mail: Myopth (8) 6(&): 7- Sreening for temperture tolerne of some spergillus spp. *Neelm Nzir n Ghzl Nsim Lhore ompost (Pvt.) Lt. Mehmoo ooti, Ring Ro, Lhore, Pkistn. Institute of Myology n Plnt Pthology, University

More information

THE EFFECT OF SOIL MOISTURE ON RESIDUAL FLUID AND GRANULAR PHOSPHORUS AVAILABILITY

THE EFFECT OF SOIL MOISTURE ON RESIDUAL FLUID AND GRANULAR PHOSPHORUS AVAILABILITY THE EFFECT OF SOIL MOISTURE ON RESIDUAL FLUID AND GRANULAR PHOSPHORUS AVAILABILITY Therese MBeth 1, Mike MLughlin 1,2, Json Kiry 2, Dvi Chittleorough 3 n Roger Armstrong 4 1 Shool of Agriulture, Foo n

More information

PROCEEDINGS 2017 Crop Pest Management Short Course & Minnesota Crop Production Retailers Association Trade Show

PROCEEDINGS 2017 Crop Pest Management Short Course & Minnesota Crop Production Retailers Association Trade Show PROCEEDINGS 2017 Crop Pest Mngement Short Course & Minnesot Crop Prodution Retilers Assoition Trde Show Institute for Ag Professionls http://www.extension.umn.edu/griulture/g-professionls/ Do not reprodue

More information

Achieving Non-Inclusive Cache Performance with Inclusive Caches Temporal Locality Aware (TLA) Cache Management Policies

Achieving Non-Inclusive Cache Performance with Inclusive Caches Temporal Locality Aware (TLA) Cache Management Policies Ahieving Non-Inlusive Che Performne with Inlusive Ches Temporl Lolity Awre (TLA) Che Mngement Poliies Amer Jleel, Eri Borh, Mlini Bhndru, Simon C. Steely Jr., nd Joel Emer Intel Corportion, VSSAD Msshusetts

More information

Rose Midge Research Report 2006

Rose Midge Research Report 2006 Rose Mige Reserh Report 26 Stuy Title: Evlution of hemil n iologil tretments for ontrol of rose mige (Dsineur rhoophg Coquillet): effiy n rop tolerne. Reserher: Dr. Jnie Elmhirst, Elmhirst Dignostis &

More information

CII-ITC Sustainability Awards Questionnaire 2016

CII-ITC Sustainability Awards Questionnaire 2016 CII-ITC Sustinility Awrs Questionnire 2016 DISCLAIMER: The informtion ontine in this oument is intelletul property of Confeertion of Inin Inustry (CII). Contents of the oument in full or in prt re onfientil,

More information

Comparison of two soil quality indexes to evaluate cropping systems in northern Colorado

Comparison of two soil quality indexes to evaluate cropping systems in northern Colorado University of Nebrsk - Linoln Digitlommons@University of Nebrsk - Linoln Publitions from USD-RS / UNL Fulty USD griulturl Reserh Servie --Linoln, Nebrsk 1-1-28 omprison of two soil qulity indexes to evlute

More information

ABA signalling is fine-tuned by antagonistic HAB1 variants

ABA signalling is fine-tuned by antagonistic HAB1 variants Reeive 14 Aug 214 Aepte 22 Jul 215 Pulishe 25 Sep 215 DOI: 1.138/nomms9138 signlling is fine-tune y ntgonisti HAB1 vrints Zhijun Wng 1, *, Hongto Ji 1,2, *, Bingjin Yun 1,3, Shungfeng Wng 1, Cho Su 1,3,

More information

Impacts of fertilizer application rates on phosphorus dynamics in salt-affected soil

Impacts of fertilizer application rates on phosphorus dynamics in salt-affected soil Vol. 63 27 No. : 468 474 Plnt Soil Environ. oi:.722/58/27-pse Impts of fertilizer pplition rtes on phosphorus ynmis in slt-ffete soil Ling-An NIU* Jin-min HAO College of Resoure n Environmentl Sienes Chin

More information

Isolation of human DNA sequences that bind to nuclear factor I, host protein involved in adenovirus DNA replication

Isolation of human DNA sequences that bind to nuclear factor I, host protein involved in adenovirus DNA replication Pro. Ntl. Ad. Si. USA Vol. 81, pp. 413-417, July 1984 Biohemistry Isoltion of humn DNA sequenes tht bind to nuler ftor I, host protein involved in denovirus DNA replition (protein-medited seletion/origins

More information

Technology & Prod uct Reports Does Amendment of Soak Solution with Sucrose and Urea Increase Production of Shiitake Mushrooms on Sawdust Blocks?

Technology & Prod uct Reports Does Amendment of Soak Solution with Sucrose and Urea Increase Production of Shiitake Mushrooms on Sawdust Blocks? Tehnology & Prod ut Reports Does Amendment of Sok Solution with Surose nd Ure Inrese Prodution of Shiitke Mushrooms on Swdust Bloks? Cthy Sot, Cul Beyl, nd Gokul Ghle ADDITIONAL INDEX WORDS. iologil effiieny,

More information

Effects of various organic materials on soil aggregate stability and soil microbiological properties on the Loess Plateau of China

Effects of various organic materials on soil aggregate stability and soil microbiological properties on the Loess Plateau of China Vol. 59, 213, No. 4: 162 168 Plnt Soil Environ. Effets of vrious orgni mterils on soil ggregte stility n soil miroiologil properties on the Loess Plteu of Chin F. Wng 1, Y.A. Tong 1, J.S. Zhng 1, P.C.

More information

Improving Water and Nutrient Use Efficiency of Potato by Partial Root-Zone Drying Irrigation in a Semi-Arid Area in China: A Field Experimental Study

Improving Water and Nutrient Use Efficiency of Potato by Partial Root-Zone Drying Irrigation in a Semi-Arid Area in China: A Field Experimental Study YAN SHI et l: IMPROVING WATER AND NUTRIENT USE EFFICIENCY OF POTATO BY PARTIAL ROOT-... Improving Wter n Nutrient Use Effiieny of Potto y Prtil Root-Zone Drying Irrigtion in Semi-Ari Are in Chin: A Fiel

More information

Vertical Distribution of Pratylenchus spp. in Silt Loam Soil and Pacific Northwest Dryland Crops

Vertical Distribution of Pratylenchus spp. in Silt Loam Soil and Pacific Northwest Dryland Crops Vertil Distriution of Prtylenhus spp. in Silt Lom Soil n Pifi Northwest Dryln Crops Rihr W. Smiley, Professor, Json G. Sheey, Fulty Reserh Assistnt, n Snr A. Esley, Fulty Reserh Assistnt, Oregon Stte University,

More information

Impact of drip fertigation on arecanut cocoa system in humid tropics of India

Impact of drip fertigation on arecanut cocoa system in humid tropics of India DOI 1.17/s1457-12-9585-6 Impt of rip fertigtion on renut oo system in humi tropis of Ini S. Sujth Rvi Bht Reeive: 27 July 212 / Aepte: 17 Novemer 212 Ó Springer Siene+Business Mei Dorreht 212 Astrt A 5-yer

More information

Variation in the natural termite resistance of teak (Tectona grandis Linn. fil.) wood as a function of tree age

Variation in the natural termite resistance of teak (Tectona grandis Linn. fil.) wood as a function of tree age Ann. For. Si. 65 (8) 78 INRA, EDP Sienes, 8 DOI: 1.151/forest:847 Aville online t: www.fs-journl.org Originl rtile Vrition in the nturl termite resistne of tek (Teton grnis Linn. fil.) woo s funtion of

More information

Microbial community dynamics and function associated with rhizosphere over periods of rice growth

Microbial community dynamics and function associated with rhizosphere over periods of rice growth Miroil ommunity ynmis n funtion ssoite with rhizosphere over perios of rie growth Q. Hussin 1,2, G.X. Pn 1, Y.Z. Liu 1, A. Zhng 1, L.Q. Li 1, X.H. Zhng 1, Z.J. Jin 1 1 Institute of esoures, Eosystem n

More information

Three-Phase Wound-Rotor Induction Machine with Rotor Resistance

Three-Phase Wound-Rotor Induction Machine with Rotor Resistance Exercise 2 Three-Phse Wound-Rotor Induction Mchine with Rotor Resistnce EXERCISE OBJECTIVE When you hve completed this exercise, you will know the effects of vrying the rotor resistnce of three-phse wound-rotor

More information

and Patrick. V. Bonsignore, Ph. D. Argonne National Laboratory Energy Systems and Environmental Research Divisions 9700 South Cass Avenue

and Patrick. V. Bonsignore, Ph. D. Argonne National Laboratory Energy Systems and Environmental Research Divisions 9700 South Cass Avenue UTILIZATION OF HIGH-CARBOHYDRATE FOOD WASTES AS THE FEEDSTOCK FOR DEGRADABLE PLASTICS S. P. Tsi, Ph. D., R. D. Colemn, Ph. D., TenLin S. Tsi, Ph. D., nd Ptrik. V. Bonsignore, Ph. D. Argonne Ntionl Lbortory

More information

Quantification of Field Resistance to Verticillium dahliae in Eight Russet-Skinned Potato Cultivars Using Real-Time PCR

Quantification of Field Resistance to Verticillium dahliae in Eight Russet-Skinned Potato Cultivars Using Real-Time PCR Am. J. Potto Res. (2013) 90:158 170 DOI 10.1007/s12230-012-9280-1 Quntifition of Fiel Resistne to Vertiillium hlie in Eight Russet-Skinne Potto Cultivrs Using Rel-Time PCR J. S. Pshe & A. L. Thompson &

More information

Economic Evaluation of Glyphosate-Resistant and Conventional Sugar Beet 1

Economic Evaluation of Glyphosate-Resistant and Conventional Sugar Beet 1 Weed Tehnology. 24. Volume :3 396 Eonomi Evlution of Glyphoste-Resistnt nd Conventionl Sugr Beet ANDREW R. KNISS, ROBERT G. WILSON, ALEX R. MARTIN, PAUL A. BURGENER, nd DILLON M. FEUZ 2 Astrt: Field experiments

More information

A CROP HARVESTER FOR FORAGE PLOTS1

A CROP HARVESTER FOR FORAGE PLOTS1 A CROP HARVESTER OR ORAGE PLOTS1 J. G. Knltr exo Wrrl. KeLsrI-BrscH Cn Deprtment oj Agriculture, Ottw, Ontrio freceive for publiction Jnury 29, 1956] ABSTRACT The smll crop hrvester escribe is esigne to

More information

IncP-1 and PromA Group Plasmids Are Major Providers of Horizontal Gene Transfer Capacities Across Bacteria in the Mycosphere of Different Soil Fungi

IncP-1 and PromA Group Plasmids Are Major Providers of Horizontal Gene Transfer Capacities Across Bacteria in the Mycosphere of Different Soil Fungi Mirob Eol DOI 10.1007/s00248-014-0482-6 SOIL MICROBIOLOGY InP-1 nd PromA Group Plsmids Are Mjor Providers of Horizontl Gene Trnsfer Cpities Aross Bteri in the Myosphere of Different Soil Fungi Miozhi Zhng

More information

than 1 week at -90, were resuspended by gentle homogenization

than 1 week at -90, were resuspended by gentle homogenization Pro. Nti. Ad. Si. USA Vol. 74, No. 11, pp. 4881-4885, November 1977 Biohemistry Role of nuleotides in tubulin polymeriztion: Effet of gunylyl 5'-methylenediphosphonte (mirotubules/gunosine nuleotides/high

More information

Long term effect of wastewater irrigation of forage crops on soil and plant quality parameters

Long term effect of wastewater irrigation of forage crops on soil and plant quality parameters Deslintion 215 (27) 143 152 Long term effet of wstewter irrigtion of forge rops on soil n plnt qulity prmeters Munir J. Mohmm Rusn *, Smi Hinnwi, Lith Rousn Fulty of Agriulture, Jorn University of Siene

More information

7 mm Diameter Miniature Single-Turn Cermet Trimmer

7 mm Diameter Miniature Single-Turn Cermet Trimmer 7 mm Dimeter Miniture Single-Turn Cermet Trimmer A dust seled plsti se proteting qulity ermet trk gurntees high performne nd proven reliility. Adjustments re mde esier y the ler sle redings. is idelly

More information

Comparative transcription of right- and left-handed poly[d(g-c)] by

Comparative transcription of right- and left-handed poly[d(g-c)] by The MBO Journl Vol.2 No.1 pp.177 1714, 1983 omprtive trnsription of right nd lefthnded poly[d(g)] by whet germ RN polymerse II Robert Durnd, ludette Job, Dvid.Zrling1, Mrel Teissere, Thoms M.Jovinl* nd

More information

p Coaches j i n C Dimensions Report Name Ali Example Date of Report: 29/06/2016 Team Profile 3

p Coaches j i n C Dimensions Report Name Ali Example Date of Report: 29/06/2016 Team Profile 3 Report Nme Ali Exmple Dte of Report: 29/06/2016 Tem Profile 3 Also Recommended: Behviourl Type t Work Profile, Composite Tem Report Who could use components of this report: p Coches j i HR professionls

More information

Effect of Nitrogen Rate on Yield of Nine Warm-season Introduced Perennial Forage Varieties

Effect of Nitrogen Rate on Yield of Nine Warm-season Introduced Perennial Forage Varieties Effet of Nitrogen Rte on Yield of Nine Wrm-seson Introdued Perennil Forge Vrieties By Eddie Funderurg, Jon T. Biermher, Corey Moffet, Mohu Hque nd Jgdeesh Mosli When rnhers think out plnting n introdued

More information

How Can I Reduce Operating Cost and Maintain a Viable Operation?

How Can I Reduce Operating Cost and Maintain a Viable Operation? How Cn I Reduce Operting Cost nd Mintin Vible Opertion? Bckground for Discussion In this discussion we re not going into the obvious cost-cutting items like buying tht new pickup or trctor, keeping new

More information

p Coaches j i m Recruitment Dimensions Report Name Ali Example Date of Report: 29/06/2016 Elements report 3

p Coaches j i m Recruitment Dimensions Report Name Ali Example Date of Report: 29/06/2016 Elements report 3 Report Nme Ali Exmple Dte of Report: 29/06/2016 Elements report 3 Also Recommended: Trit Profile, Competency Report Who could use components of this report: p Coches j i HR professionls Trined prctitioners

More information

Weed seed-bank responses to long-term fertilization in a rice-wheat rotation system

Weed seed-bank responses to long-term fertilization in a rice-wheat rotation system Plnt Soil Environ. Wee see-nk responses to long-term fertiliztion in rie-whet rottion system M. Jing 1, X.P. Shen 1, W. Go 1, M.X. Shen 2, Q.G. Di 1 1 Key Lortory of Crop Genetis n Physiology of Jingsu

More information

post-tsunami mangrove rehabilitation in north sumatera and riau provinces a photo essay

post-tsunami mangrove rehabilitation in north sumatera and riau provinces a photo essay post-tsunami mangrove rehabilitation in north sumatera an riau provines a photo essay The first 18 months of the projet fouse on mangrove areas in; Langkat Regeny - North Sumatera (503 hetares) an Bengkalis

More information

acj mutants in which it is affected (olfaction/behavior genetics/sensory system/brain/antennae)

acj mutants in which it is affected (olfaction/behavior genetics/sensory system/brain/antennae) Pro. Nti. Ad. Si. USA Vol. 86, pp. 8118-8122, Otoer 1989 Neuroiology A simple hemosensory response in Drosophil nd the isoltion of j mutnts in whih it is ffeted (olftion/ehvior genetis/sensory system/rin/ntenne)

More information

FRACTAL CHARACTERIZATION OF WHEAT CROP BASED ON DIGITAL IMAGES CAPTURED IN THE VISIBLE SPECTRUM

FRACTAL CHARACTERIZATION OF WHEAT CROP BASED ON DIGITAL IMAGES CAPTURED IN THE VISIBLE SPECTRUM FRACTAL CHARACTERIZATION OF WHEAT CROP BASED ON DIGITAL IMAGES CAPTURED IN THE VISIBLE SPECTRUM Florin SALA, Mrius BOLDEA, Iosif GERGEN Bnt University of Agriulturl Sienes nd Veterinry Mediine, Regele

More information

Seedling Quality Standards for Bottomland Hardwood Afforestation in the Lower Mississippi River Alluvial Valley: Preliminary Results

Seedling Quality Standards for Bottomland Hardwood Afforestation in the Lower Mississippi River Alluvial Valley: Preliminary Results Seedling Qulity Stndrds for Bottomlnd Hrdwood Afforesttion in the Lower Mississippi River Alluvil Vlley: Preliminry Results Douglss F. Jos Emile S. Grdiner K. Frnis Slifu Ronld P. Overton George Hernndez

More information

LETTERS. Short hairpin RNA expressing bacteria elicit RNA interference in mammals. Shuanglin Xiang 1,2, Johannes Fruehauf 1,2 & Chiang J Li 1

LETTERS. Short hairpin RNA expressing bacteria elicit RNA interference in mammals. Shuanglin Xiang 1,2, Johannes Fruehauf 1,2 & Chiang J Li 1 00 Nture Pulishing Group http://www.nture.om/ntureiotehnology Short hirpin RNA expressing teri eliit RNA interferene in mmmls Shunglin Xing,, Johnnes Fruehuf, & Ching J Li RNA-interferene (RNAi) is potent

More information

Preparation of compost using layer droppings with different materials

Preparation of compost using layer droppings with different materials Preprtion of ompost using lyer roppings with ifferent mterils H Khtun*, F Alm, MA Hshem, SME Rhmn Deprtment of Animl Siene, Bnglesh Agriulturl University, Mymensingh 2202, Bnglesh Astrt The experiment

More information

Conservation Tillage Strategies For Corn, Sorghum And Cotton

Conservation Tillage Strategies For Corn, Sorghum And Cotton (93%) cotton nd percent lint ws similr in oth pickers. The 15-inch row system with 27 plnts/a gve higher lint yield (1491 l/a) compred to 4-inch row cotton with 5 plnts/a (136 l/a). Plnt cnopy closed 3

More information

The performance of lowland rice (Oryza sativa L.) cultivars on iron toxic soil augmented with compost. O.A. Dada and J.A. Aminu

The performance of lowland rice (Oryza sativa L.) cultivars on iron toxic soil augmented with compost. O.A. Dada and J.A. Aminu Journl of Stress Physiology & Biohemistry, Vol. 9 No. 4 2013, pp. 207-218 ISSN 1997-0838 Originl Text Copyright 2013 by Dd, Aminu ORIGINAL ARTICLE The performne of lowlnd rie (Oryz stiv L.) ultivrs on

More information

Soil phosphorus and potassium availability in long-term field experiments with organic and mineral fertilization

Soil phosphorus and potassium availability in long-term field experiments with organic and mineral fertilization Vol. 62, 216, No. 12: 558 565 Plnt Soil Environ. oi: 1.17221/534/216-PSE Soil phosphorus n potssium vilility in long-term fiel experiments with orgni n minerl fertiliztion M. Káš, G. Mühlhová, H. Kusá,

More information

Phenotypic plasticity in a complex world: interactive evects of food and temperature on Wtness components of a seed beetle

Phenotypic plasticity in a complex world: interactive evects of food and temperature on Wtness components of a seed beetle Oecologi (2007) 53:9 32 DOI 0.007/s00442-007-0748-5 POPULATION ECOLOGY Phenotypic plsticity in complex world: interctive evects of food nd temperture on Wtness components of seed beetle R. Crig Stillwell

More information

Efficacy of Armicarb (potassium bicarbonate) against scab and sooty blotch on apples

Efficacy of Armicarb (potassium bicarbonate) against scab and sooty blotch on apples Effiy of Armir (potssium ironte) ginst s nd sooty loth on pples Einfluss von Armir (Klium Biront) uf den Shorf und Regenflekenkrnkheit des Apfels Luius Tmm 1, Thoms Amsler 1, Hnsjko Shärer 1, Mtthis Refrdt

More information

Business Continuity Software Buyer s Guide

Business Continuity Software Buyer s Guide Business Continuity Softwre Buyer s Guide Opertionlly strtegic nd deployble, business continuity plns re criticl to ensuring your orgniztion cn survive nd succeed following n unplnned incident. Mny orgniztions

More information

Self-Antigen Presentation by Keratinocytes in the Inflamed Adult Skin Modulates T-Cell Auto-Reactivity

Self-Antigen Presentation by Keratinocytes in the Inflamed Adult Skin Modulates T-Cell Auto-Reactivity ORIGINAL ARTICLE in the Inflme Ault Skin Moultes T-Cell Auto-Retivity Mihel Meister, Amel Tounsi, Evelyn Gffl, Tois Bl, Mri Pptrintfyllou, Juli Luwig, Georg Pougilis, Felix Bestvter, Luis Klotz, Gerhr

More information

Foraging patterns of pileated woodpeckers in a managed Acadian forest: a resource selection function

Foraging patterns of pileated woodpeckers in a managed Acadian forest: a resource selection function 2387 Forging ptterns of pilete woopekers in mnge Ain forest: resoure seletion funtion Jérôme Lemître n Mr-Anré Villr Astrt: We nlyze the reltive influene of forging sustrte hrteristis s preitors of the

More information

Questionnaire for self-assessment

Questionnaire for self-assessment WH IN U O Helthy Employees in Helthy Orgnistions Good Prtie in Workple Helth Promotion (WHP) in Europe Questionnire for self-ssessment Foreword The Europen Network for Workple Helth Promotion hs een in

More information

THERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING

THERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING Journl of Mining nd Metllurgy, 38 (1 2) B (2002) 93-102 THERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING N.Mitevsk* nd @.D.@ivkovi}** *RTB BOR, Copper Institute, 19210 Bor, Yugoslvi

More information

Original Research Effects of Various Long-Term Tillage Systems on Some Chemical and Biological Properties of Soil

Original Research Effects of Various Long-Term Tillage Systems on Some Chemical and Biological Properties of Soil Pol. J. Environ. Stud. Vol. 22, No. 6 (213), 1835-1844 Originl Reserh Effets of Vrious Long-Term Tillge Systems on Some Chemil nd Biologil Properties of Soil Dorot Swędrzyńsk 1 *, Iren Młek 2, Andrzej

More information

Overexpression of DEAD box protein pmss116 promotes ATP-dependent splicing of a yeast group intron in vitro

Overexpression of DEAD box protein pmss116 promotes ATP-dependent splicing of a yeast group intron in vitro 2966-2972 Nulei Aids Reserh, 1995, Vol. 23, No. 15 Overexpression of DEAD ox protein pmss116 promotes ATP-dependent spliing of yest group intron in vitro sell Niemer, Crlo Shmelzer nd G. Vlentin Borner*

More information

Crop, Livestock and Environment Division, Japan International Research Center for Agricultural Sciences (Tsukuba, Ibaraki , Japan) 2

Crop, Livestock and Environment Division, Japan International Research Center for Agricultural Sciences (Tsukuba, Ibaraki , Japan) 2 JARQ (3), 33 39 (07) http://www.jirs.ffr.go.jp Soil silion nd ron under pddy in Mekong Delt Effets of the Continuous Applition of Rie Strw Compost nd Chemil Fertilizer on Soil Cron nd Aville Silion under

More information

Delivered by Ingenta. that mechanical properties of PVA-HA-Silk composite hydrogel are enhanced with the adding of HA

Delivered by Ingenta. that mechanical properties of PVA-HA-Silk composite hydrogel are enhanced with the adding of HA Mterils Express Copyright 2013 y Amerin Sientifi Pulishers All rights reserved. Printed in the United Sttes of Ameri 2158-5849/2013/3/265/008 doi:10.1166/mex.2013.1127 www.sps.om/mex Strt-up frition properties

More information

PRODUCTIVITY STUDY OF FOUR AVOCADO CULTIVARS IN ALGARVE REGION

PRODUCTIVITY STUDY OF FOUR AVOCADO CULTIVARS IN ALGARVE REGION 1999. Revist Chpingo Serie Hortiultur 5: 73-76. PRODUCTIVITY STUDY OF FOUR AVOCADO CULTIVARS IN ALGARVE REGION Edurdo Leopoldo Ferreir Direção Regionl de Agriultur do Algrve Aprtdo 282, 8 Fro Portugl SUMMARY

More information

High strength fine grained structural steel, thermo-mechanically rolled, for high temperature application

High strength fine grained structural steel, thermo-mechanically rolled, for high temperature application P420M HT High strength fine grined structurl steel, thermo-mechniclly rolled, for high temperture ppliction Specifiction DH-E52-D, edition April 2016 1 P420M HT is high strength thermomechniclly rolled

More information

North American Strawberry Growers Association Research Program

North American Strawberry Growers Association Research Program North Amerin Strwerry Growers Assoition Reserh Progrm Finl Report (Ferury 8 - Deemer 9) Strwerry Plnt Propgtion, Potentil Phosphorus Pool nd Ftors Influening Phosphorus Use Effiieny in Nursery Systems

More information

Identifying indicators of community sustainability in the Robson Valley, British Columbia

Identifying indicators of community sustainability in the Robson Valley, British Columbia Reserch Report BC Journl of Ecosystems nd Mngement Identifying indictors of community sustinbility in the Robson Vlley, British Columbi John R. Prkins 1, Jeji Vrghese 2, nd Richrd C. Stedmn 3 Abstrct This

More information

Multilocus Analysis for Gene-Centromere Mapping Using First Polar Bodies and Secondary Oocytes

Multilocus Analysis for Gene-Centromere Mapping Using First Polar Bodies and Secondary Oocytes Copyright 0 1995 by the Genetics Society of Americ Multilocus Anlysis for Gene-Centromere Mpping Using First Polr Bodies nd Secondry Oocytes Yng D, Vickie L. Jrrell, Tinlin Wng, Rohn L. Fernndo, Mtthew

More information

The advanced agronomic training system in Morocco

The advanced agronomic training system in Morocco The dvnced gronomic trining system in Morocco Firdwcy L. in Hervieu B. (ed.). Agronomic trining in countries the Mediterrnen region Montpellier : CIHEAM Options Méditerrnéennes : Série Etudes; n. 1988II

More information

MED18 interaction with distinct transcription factors regulates multiple plant functions

MED18 interaction with distinct transcription factors regulates multiple plant functions Reeived 13 Aug 213 Aepted 4 De 213 Pulished 23 Jn 214 DOI: 1.138/nomms464 MED18 intertion with distint trnsription ftors regultes multiple plnt funtions Zhiing Li 1, Crig M. Shluttenhofer 1,w, Ketki Bhide

More information

Article received ; Revised ; Accepted

Article received ; Revised ; Accepted Pk. J. Biotehnol. Vol. 13 (3) 205-209 (2016) ISSN Print: 1812-1837 www. pjt.org ISSN Online: 2312-7781 GRAIN YIELD, PHOSPHORUS CONTENT AND UPTAKE OF WHEAT (TRITICUM AESTIVUM L.) AS AFFECTED BY PHOSPHORUS

More information

Induced ncrnas allosterically modify RNA-binding proteins in cis to inhibit transcription. Pull-down HAT assay. Control. Acetylated CBP.

Induced ncrnas allosterically modify RNA-binding proteins in cis to inhibit transcription. Pull-down HAT assay. Control. Acetylated CBP. Vol 454 3 July 28 oi:1.138/nture6992 LETTERS Inue nrnas llosterilly moify RNA-ining proteins in is to inhiit trnsription Xingting Wng 1,2, Shigeki Ari 5, Xioyun Song 1, Donn Reihrt 3, Kun Du 5, Griel Psul

More information

Interrogation of genomes by molecular copy-number counting (MCC)

Interrogation of genomes by molecular copy-number counting (MCC) Interrogtion of genomes by moleculr copy-number counting (MCC) Angelik Dser 1,2,4, Mdn Thngvelu 1,2,4, Richrd Pnnell 1, Aln Forster 1, Louise Sprrow 3, Grce Chung 1,2, Pul H Der 1 & Terence H Rbbitts 1

More information

III. Adhesion Quality of Tin Plating on Aluminum: Thermal Shock and Adhesion Tests

III. Adhesion Quality of Tin Plating on Aluminum: Thermal Shock and Adhesion Tests Dt Bulletin Therml Aging Study of Tin Plting on Aluminum 0108DB0602 02/2007 Cedr Rpids, IA, USA Bell Chudnovsky* Vinent Pvgeu + Mihel Rpeux + Ali Zolfghri* Pierre Brdollet + *) Shneider Eletri North Ameri

More information

Turfgrass Seeding Recommendations for the Pacific Northwest

Turfgrass Seeding Recommendations for the Pacific Northwest Turfgrss Seeding Reommendtions for the Pifi Northwest A P A C I F I C N O R T H W E S T E X T E N S I O N P U B L I C A T I O N P N W 2 9 9 Wshington Stte University Oregon Stte University University of

More information

Effects of Control Release Fertilizers on Nutrient Leaching, Palm Growth and Production Cost

Effects of Control Release Fertilizers on Nutrient Leaching, Palm Growth and Production Cost Florid Interntionl University FIU Digitl Commons Deprtment of Erth nd Environment College of Arts, Sienes & Edution 11-18-215 Effets of Control Relese Fertilizers on Nutrient Lehing, Plm Growth nd Prodution

More information

Received: 9 December 2008 / Accepted: 14 July 2009 / Published online: 14 August 2009 Ó U.S. Government 2009

Received: 9 December 2008 / Accepted: 14 July 2009 / Published online: 14 August 2009 Ó U.S. Government 2009 New Forests (2010) 39:195 213 DOI 10.1007/s11056-009-9164-5 Effet of midstory nd understory removl on the estblishment nd development of nturl nd rtifiil pin ok dvne reprodution in bottomlnd forests Jonthn

More information

Study on Carbide Tool Performance in Green Machining of Aeronautical Material: Q-T Models and Finite Element Analysis

Study on Carbide Tool Performance in Green Machining of Aeronautical Material: Q-T Models and Finite Element Analysis 80 IPTEK, The Journl or Tehnology nd Siene, Vol. 19, No. 3, August 2008 Study on Crbide Tool Perormne in Green Mhining o Aeronutil Mteril: Q-T Models nd Finite Element Anlysis Armnsyh Ginting 1 Abstrt

More information

Tapper Concrete Scew Anchor Type 410 & 304 Stainless Steel

Tapper Concrete Scew Anchor Type 410 & 304 Stainless Steel Conrete Sew Type 4 & 304 PRODUCT DESCRIPTION The fastening system is a family of srew anhors for light to meium uty appliations in onrete, masonry blok an brik base materials. The is fast an easy to install

More information

Platform quick guide. Stockbroking Pro platform. stockbroking

Platform quick guide. Stockbroking Pro platform. stockbroking Stockbroking Pro pltform Pltform quick guide This concise guide hs been put together to help you quickly fmilirise yourself with the mny fetures nd tools vilble on the CMC Mrkets Stockbroking Pro pltform.

More information

SOFTWARE ENGINEERING Staffing Level Estimation and Scheduling

SOFTWARE ENGINEERING Staffing Level Estimation and Scheduling SOFTWARE ENGINEERING Staffing Level Estimation an Scheuling Staffing level estimation Once the effort require to evelop a software has been etermine, it is necessary to etermine the staffing requirement

More information

Genome-wide association analysis of GAW17 data using an empirical Bayes variable selection

Genome-wide association analysis of GAW17 data using an empirical Bayes variable selection PROCEEDINGS Open Access Genome-wide ssocition nlysis of GAW7 dt using n empiricl Byes vrible selection Vitr Pungppong, Libo Wng, Ynzhu Lin, Dbo Zhng, Min Zhng * From Genetic Anlysis Workshop 7 Boston,

More information

Responses of rice yield and the fate of fertilizer nitrogen to soil organic carbon

Responses of rice yield and the fate of fertilizer nitrogen to soil organic carbon Vol. 63, 2017, No. 9: 416 421 Plnt Soil Environ. Responses of rie yield nd the fte of fertilizer nitrogen to soil orgni ron Weifu PENG, Yongjun ZENG, Qinghu SHI, Shn HUANG* Ministry of Edution nd Jingxi

More information

Water saving under fixed-furrow surface irrigation in clay soil of the Middle Nile Delta of Egypt

Water saving under fixed-furrow surface irrigation in clay soil of the Middle Nile Delta of Egypt Wter nd Soiety III 343 Wter sving under fixed-furrow surfe irrigtion in ly soil of the Middle Nile Delt of Egypt A. A. Ad El-Hlim Soil nd Wter Deprtment, Fulty of Agriulture, Tnt University, Egypt Astrt

More information

Our Missio n. Silver/ Petrucelli+ Associates, Inc. is dedicated. to providing the highest quality services to

Our Missio n. Silver/ Petrucelli+ Associates, Inc. is dedicated. to providing the highest quality services to Silver/ Petrucelli+ Assocites, Inc. is dedicted to providing highest qulity services to our clients, producing cretive nd effective design solutions tht re fisclly responsible nd environmentlly sensitive.

More information

Control Effects of Two-Batch-Duck Raising with Rice Framing on Rice Diseases, Insect Pests and Weeds in Paddy Field

Control Effects of Two-Batch-Duck Raising with Rice Framing on Rice Diseases, Insect Pests and Weeds in Paddy Field Advne Journl of Food Siene nd Tehnology 4(5): 39-315, 212 ISSN: 242-4868 E-ISSN: 242-4876 Mxwell Sientifi Orgniztion, 212 Sumitted: August 31, 212 Aepted: Septemer 24, 212 Pulished: Otoer 2, 212 Control

More information

Moml is a Semi-Dominant Modifier of Intestinal Adenoma Size and Multiplicity in Min/+ Mice

Moml is a Semi-Dominant Modifier of Intestinal Adenoma Size and Multiplicity in Min/+ Mice Copyright 0 1996 by the Genetics Society of Americ Moml is Semi-Dominnt Modifier of Intestinl Adenom Size nd Multiplicity in Min/+ Mice Kren A. Gould,*,t" Willim F. Dietrich,x32 Ntlie Borenstein," Eric

More information

Pamela Strange (SGS Australia), William Wang (OLAM), Steve Katis (OLAM), Ian Lonie (Tanuki), Stephen Phillips (Tanuki).

Pamela Strange (SGS Australia), William Wang (OLAM), Steve Katis (OLAM), Ian Lonie (Tanuki), Stephen Phillips (Tanuki). The effects of folir ppliction of () Verno FG Cu3+Zn3, () NORDOX 75 WG nd (3) Cupric Hydroxide, during the kernel dry weight ccumultion period for nuts nd ud differentition period for wood, in ering Nonpriel

More information

The Effect of SFAS No. 131 on the Diversification Discount

The Effect of SFAS No. 131 on the Diversification Discount The Effect of SFAS No. 131 on the Diversifiction Discount Seoungpil Ahn Sogng Business School, Sogng University PA706, 35 Bekbeom-ro, Mpo-gu, Seoul 121-742, Kore E-mil: sphn@sogng.c.kr Received: July 2,

More information

The energy content of the diet generally

The energy content of the diet generally Peer reviewed Originl reserch Economics of incresing lysine:clorie rtio nd dding dietry ft for growing-finishing pigs rered in commercil environment Mnuel De L Llt, MS, PhD; Steve S. Dritz, DVM, PhD; Michel

More information

The effect of three foliar fertilizers on the Growth and yield of two Variety Broad been(vicia faba L)under the drip irrigation system.

The effect of three foliar fertilizers on the Growth and yield of two Variety Broad been(vicia faba L)under the drip irrigation system. مجلة جامعة تكريت للعلوم الزراعية المجلد) 3 ( العدد) 313( ) ( ISSN-1813-166 Vii f L. lg6 int Min plot proti Split plot Design الكلمات الدالة : اسمدة ورقيت الباقالء الري بالتنقيط Su plot R..B.D للمراسلة

More information

[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids

[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids Equilibri in Solutions of Wek Acids Chpter 16 Acid-Bse Equilibri Dr. Peter Wrburton peterw@mun.c http://www.chem.mun.c/zcourses/1011.php The dissocition of wek cid is n equilibrium sitution with n equilibrium

More information

human genome 3.2 billion bases Biotechnology A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT

human genome 3.2 billion bases Biotechnology A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT Biotechnology 2007-2008 A Brve New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT humn genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA

More information

Comparative Susceptibility of Potato Cultivars to Verticillium Wilt Assessed via Wilt Severity and Subsequent Yield Reduction

Comparative Susceptibility of Potato Cultivars to Verticillium Wilt Assessed via Wilt Severity and Subsequent Yield Reduction Interntionl Journl of Plnt Breeding 21 Globl Siene Books Comprtive Suseptibility of Potto Cultivrs to Vertiillium Wilt Assessed vi Wilt Severity nd Subsequent Yield Redution Mejd Dmi-Remdi 1* Hyf Jbnoun-Khireddine

More information

Three-Phase Wound-Rotor Induction Machine with a Short- Circuited Rotor

Three-Phase Wound-Rotor Induction Machine with a Short- Circuited Rotor Exercise 1 Three-Phse Wound-Rotor Induction Mchine with Short- Circuited Rotor EXERCISE OBJECTIVE When you hve completed this exercise, you will know how three-phse woundrotor induction mchine cn operte

More information

Effects of Selection for Scrotal Circumference in Limousin Bulls on Reproductive and Growth Traits of Progeny 1,2

Effects of Selection for Scrotal Circumference in Limousin Bulls on Reproductive and Growth Traits of Progeny 1,2 Effects of Selection for Scrotl Circumference in Limousin Bulls on Reproductive nd Growth Trits of Progeny 1,2 D. W. Moser 3, J. K. Bertrnd, L. L. Benyshek, M. A. McCnn, nd T. E. Kiser Animl nd Diry Science

More information

Effect of Thiourea on Dormancy Breaking and Yield of Potato (Solanum Tuberosum L.) Minitubers Marfona cv. in Greenhouse

Effect of Thiourea on Dormancy Breaking and Yield of Potato (Solanum Tuberosum L.) Minitubers Marfona cv. in Greenhouse 211 Interntionl Conferene on Environmentl nd Agriulture Engineering IPCBEE vol.15(211) (211) IACSIT Press, Singpore Effet of Thioure on Dormny Breking nd Yield of Potto (Solnum Tuerosum L.) Minituers Mrfon

More information

Product design. A product is a bundle of attribute levels or features that have utilities to customer (price is considered as attribute as well)

Product design. A product is a bundle of attribute levels or features that have utilities to customer (price is considered as attribute as well) Product design Working ssumption: Wht is product? A product is undle of ttriute levels or fetures tht hve utilities to customer (price is considered s ttriute s well) The mening of : Designing product

More information

Factors Associated with Populations of Plant-Parasitic Nematodes in Bentgrass Putting Greens in Oklahoma

Factors Associated with Populations of Plant-Parasitic Nematodes in Bentgrass Putting Greens in Oklahoma Ftors Assoited with Popultions of Plnt-Prsiti Nemtodes in Bentgrss Putting Greens in Oklhom N. R. Wlker, Deprtment of Entomology nd Plnt Pthology; C. L. God, Deprtment of Sttistis; H. Zhng, Deprtment of

More information

Influence of no tillage controlled traffic system on soil physical properties in double cropping area of North China plain

Influence of no tillage controlled traffic system on soil physical properties in double cropping area of North China plain Afrin Journl of Biotehnology Vol. 11(4), pp. 856-864, 12 Jnury, 2012 Aville online t http://www.demijournls.org/ajb DOI: 10.5897/AJB11.2221 ISSN 1684 5315 2012 Ademi Journls Full Length Reserh Pper Influene

More information