DNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007

Size: px
Start display at page:

Download "DNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007"

Transcription

1 DNA Microarrays Introduction Part 2 Todd Lowe BME/BIO 210 April 11, 2007

2 Reading Assigned For Friday, please read two papers and be prepared to discuss in detail: Comprehensive Identification of Cell Cycle-related Genes of the Yeast Saccharomyces cerevisiae by Microarray Hybridization, Spellman, Sherlock, Zhang, Iyer, Anders, Eisen, Brown, Botstein, & Futcher Molecular Biology of the Cell, December 1998 "Genomic expression programs in the response of yeast cells to environmental changes", Gasch AP, Spellman PT, Kao CM, Carmel- Harel O, Eisen MB, Storz G, Botstein D, Brown PO, Mol Biol Cell 2000 Dec; 11:

3 Array: Different Growth Conditions Standard condition Altered growth condition or genetic background

4 Pros/Cons of Different Technologies Spotted Arrays relative cheap to make (~$10 slide) flexible - spot anything you want Cheap so can repeat experiments many times highly variable spot deposition usually have to make your own Accuracy at extremes in range may be less Affy Gene Chips expensive ($500 or more) limited types avail, no chance of specialized chips fewer repeated experiments usually more uniform DNA feaures Can buy off the shelf Dynamic range may be slightly better

5 Microarray Platforms Summary Type of Array Technology Probe Length Max Features Feature Size Cost/array Applications Traditional Spotted Arrays Robot spotting Pre-made DNA 2-color hyb (Cy3/Cy5) Any (35nt- PCR product size) Affymetrix Photolithography 25 nt ~6.5 in Million situ; 1-color biotin NibleGen Micro-mirrors 50-75nt 385, um ~$ CGH, CHiP-chip, (DLP light gene expression projector) in situ synth; 2-color hyb CombiMatrix CMOS in situ 18-50nt 12,000 ~$ color or 1-color ~50,000 ~100 um 5-11 um Cheap Major cost is upfront DNA synthesis ~$100 or less $500+ Single use Can be reused, 4 times total Agilent Ink jet in situ; nt 244,000 73x124 um $ color hyb Single use (1-color?) Gene expression, CGH, CHiP chip Gene expression, CGH, tiling arrays, CHiP chip, SNP detection CGH, gene expression, SNP detection Gene expression, CGH, ChIP chip

6 Spotted Arrays Movie of a commerical robotic spotter, similar to the two Brown lab-style robots here on campus: Movie applying labeled sample to spotted microarray for hybridization

7 Affymetrix Array Production Photo-lithography demo movie, presented by Eric Lander at YouTube: Source:

8 NibleGen Maskless Micromirror in situ synthesis

9 CombiMatrix Arrays CombiMatrix s core technology is a specially modified semiconductor adapted for biological applications. These integrated circuits contain arrays of microelectrodes that are individually addressable using embedded logic circuitry on the chip. Placed in a specially designed fluidic chamber, the chip digitally directs the molecular assembly of biopolymers in response to a digital command.

10

11 Affymetrix Hybridization / Labeling

12 Image Analysis & Data Visualization Cy3 Cy5 Cy5 Cy3 log 2 Cy5 Cy Experiments Genes Underexpressed Overexpressed fold 2 4 8

13 Typical Goal: Identify genes involved in a specific biological process (i.e. heat shock) Guilt by association - assumption that genes with same pattern of changes in expression are involved the same pathway If we know what some genes in a group are doing, it hints that others with similar expression may be involved in same cellular process

14 Classification In some cases, don t need to know what any genes in a group are doing to be useful Total expression profile can be used as a fingerprint identifying cell type example: Tumor classification - predict outcome / prescribe appropriate treatment based on clustering with known outcome tumors

15 Types of Analysis to Form Gene Associations Hierarchical clustering Partitioning of Data in Groups (supervised & unsupervised) Self-organizing maps (SOM) K-means clustering Gene shaving Support vector machines (SVM) Modeling Singular value decomposition (SVD) / Principle component analysis (PCA) Ranking Tests

16 New Data ScanAlyze Data flow Cluster Database Data Selection SOM K-means Complete Data Table (cdt) SVD

17 Developing New Methods How do you know when your method performs better than a previous method? A gold standard test set for benchmarking array data doesn t exist There is too much biology we don t know: if a new method classifies a gene in the wrong gene group, is it recognizing new biology, or just getting it wrong??

18 Limitations of Arrays Do not necessarily reflect true levels of proteins - protein levels are regulated by translation initiation & degradation as well Generally, do not prove new biology - simply suggest genes involved in a process, a hypothesis that will require traditional experimental verification Expensive! $20-$100K to make your own / buy enough arrays to get publishable data

19 Practical Problems Distinguishing background noise from low level, biologically important signals Difficult to independently verify so many data points, so success of array based on anecodotal evidence Multiple repetitions of array experiments is crucial, not always possible with limited samples Not easy to dissect specific from non-specific expression changes for a spec. experiment Example: common stress response in yeast

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology

More information

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron

More information

DNA Microarrays and Clustering of Gene Expression Data

DNA Microarrays and Clustering of Gene Expression Data DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

advanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA

advanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents

More information

Spotted DNA Array Design. Todd Lowe BME/Bio 210 Sept 30, 2008

Spotted DNA Array Design. Todd Lowe BME/Bio 210 Sept 30, 2008 Spotted DNA Array Design Todd Lowe BME/Bio 210 Sept 30, 2008 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations For

More information

Microarrays & Gene Expression Analysis

Microarrays & Gene Expression Analysis Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed

More information

Introduction to DNA microarrays. DTU - January Hanne Jarmer

Introduction to DNA microarrays. DTU - January Hanne Jarmer Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go Microarrays - The Concept Measure

More information

Supervised Learning from Micro-Array Data: Datamining with Care

Supervised Learning from Micro-Array Data: Datamining with Care November 18, 2002 Stanford Statistics 1 Supervised Learning from Micro-Array Data: Datamining with Care Trevor Hastie Stanford University November 18, 2002 joint work with Robert Tibshirani, Balasubramanian

More information

The application of hidden markov model in building genetic regulatory network

The application of hidden markov model in building genetic regulatory network J. Biomedical Science and Engineering, 2010, 3, 633-637 doi:10.4236/bise.2010.36086 Published Online June 2010 (http://www.scirp.org/ournal/bise/). The application of hidden markov model in building genetic

More information

Analysis of a Proposed Universal Fingerprint Microarray

Analysis of a Proposed Universal Fingerprint Microarray Analysis of a Proposed Universal Fingerprint Microarray Michael Doran, Raffaella Settimi, Daniela Raicu, Jacob Furst School of CTI, DePaul University, Chicago, IL Mathew Schipma, Darrell Chandler Bio-detection

More information

10.1 The Central Dogma of Biology and gene expression

10.1 The Central Dogma of Biology and gene expression 126 Grundlagen der Bioinformatik, SS 09, D. Huson (this part by K. Nieselt) July 6, 2009 10 Microarrays (script by K. Nieselt) There are many articles and books on this topic. These lectures are based

More information

Clones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.

Clones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization. Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used

More information

First steps in signal-processing level models of genetic networks: identifying response pathways and clusters of coexpressed genes

First steps in signal-processing level models of genetic networks: identifying response pathways and clusters of coexpressed genes First steps in signal-processing level models of genetic networks: identifying response pathways and clusters of coexpressed genes Olga Troyanskaya lecture for cheme537/cs554 some slides borrowed from

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Gene expression analysis: Introduction to microarrays

Gene expression analysis: Introduction to microarrays Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is

More information

Spotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003

Spotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003 Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Moc/Bio and Nano/Micro Lee and Stowell

Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx

More information

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence

More information

Computational Biology I

Computational Biology I Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)

More information

Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics

Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized

More information

Towards Gene Network Estimation with Structure Learning

Towards Gene Network Estimation with Structure Learning Proceedings of the Postgraduate Annual Research Seminar 2006 69 Towards Gene Network Estimation with Structure Learning Suhaila Zainudin 1 and Prof Dr Safaai Deris 2 1 Fakulti Teknologi dan Sains Maklumat

More information

Measuring and Understanding Gene Expression

Measuring and Understanding Gene Expression Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics

More information

3. Microarrays: experimental design, statistical analysis and gene clustering

3. Microarrays: experimental design, statistical analysis and gene clustering WUEMED Drought Course 3. Microarrays: experimental design, statistical analysis and gene clustering John Bennett International Rice Research Institute Los Baños, Philippines 3.1: Experimental overview

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Bioinformatics for Biologists

Bioinformatics for Biologists Bioinformatics for Biologists Functional Genomics: Microarray Data Analysis Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Outline Introduction Working with microarray data Normalization Analysis

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Application of Emerging Patterns for Multi-source Bio-Data Classification and Analysis

Application of Emerging Patterns for Multi-source Bio-Data Classification and Analysis Application of Emerging Patterns for Multi-source Bio-Data Classification and Analysis Hye-Sung Yoon 1, Sang-Ho Lee 1,andJuHanKim 2 1 Ewha Womans University, Department of Computer Science and Engineering,

More information

6. GENE EXPRESSION ANALYSIS MICROARRAYS

6. GENE EXPRESSION ANALYSIS MICROARRAYS 6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011

More information

Gene expression. What is gene expression?

Gene expression. What is gene expression? Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

Gene Expression Data Analysis

Gene Expression Data Analysis Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based

More information

Bioinformatics. Microarrays: designing chips, clustering methods. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute

Bioinformatics. Microarrays: designing chips, clustering methods. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Bioinformatics Microarrays: designing chips, clustering methods Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18 Feb 25 Sequence

More information

The essentials of microarray data analysis

The essentials of microarray data analysis The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering

More information

Resampling methods for variance estimation of singular value decomposition analyses from microarray experiments

Resampling methods for variance estimation of singular value decomposition analyses from microarray experiments Funct Integr Genomics (2002) 2:92 97 DOI 10.1007/s10142-002-0047-5 ORIGINAL PAPER Debashis Ghosh Resampling methods for variance estimation of singular value decomposition analyses from microarray experiments

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

Introduction to microarray technology and data analysis

Introduction to microarray technology and data analysis Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction

More information

Introduction to gene expression microarray data analysis

Introduction to gene expression microarray data analysis Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful

More information

Measuring gene expression

Measuring gene expression Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq

More information

earray 5.0 Create your own Custom Microarray Design

earray 5.0 Create your own Custom Microarray Design earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Announcements. Lecture 2: DNA Microarray Overview. Gene Expression: The Central Dogma. Talks. Go to class web page

Announcements. Lecture 2: DNA Microarray Overview. Gene Expression: The Central Dogma. Talks. Go to class web page Announcements Lecture 2: DNA Microarray Overview Go to class web page http://www.cs.washington.edu/527 Add yourself to class list Check out HW1, including last year s (Some slides from Dr. Holly Dressman,

More information

ECS 234: Genomic Data Integration ECS 234

ECS 234: Genomic Data Integration ECS 234 : Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG

More information

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology

More information

2000/2001 ABRF MICROARRAY RESEARCH GROUP STUDY: A CURRENT PROFILE OF MICROARRAY LABORATORIES

2000/2001 ABRF MICROARRAY RESEARCH GROUP STUDY: A CURRENT PROFILE OF MICROARRAY LABORATORIES 2000/2001 ABRF MICROARRAY RESEARCH GROUP STUDY: A CURRENT PROFILE OF MICROARRAY LABORATORIES by George Grills 1, Chandi Griffin 2, Aldo Massimi 1, Kathryn Lilley 3, Kevin Knudtson 4, and James VanEe 5

More information

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Introduction to Transcription Factor Binding Sites (TFBS) Cells control the expression of genes using Transcription Factors.

Introduction to Transcription Factor Binding Sites (TFBS) Cells control the expression of genes using Transcription Factors. Identification of Functional Transcription Factor Binding Sites using Closely Related Saccharomyces species Scott W. Doniger 1, Juyong Huh 2, and Justin C. Fay 1,2 1 Computation Biology Program and 2 Department

More information

Normalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612

Normalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612 Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Analysis of Cancer Gene Expression Profiling in DNA Microarray Data using Clustering Technique

Analysis of Cancer Gene Expression Profiling in DNA Microarray Data using Clustering Technique Analysis of Cancer Gene Expression Profiling in DNA Microarray Data using Clustering Technique 1 C. Premalatha, 2 D. Devikanniga 1, 2 Assistant Professor, Department of Information Technology Sri Ramakrishna

More information

Biochemistry 412. DNA Microarrays. April 1, 2008

Biochemistry 412. DNA Microarrays. April 1, 2008 Biochemistry 412 DNA Microarrays April 1, 2008 Microarrays Have Led to an Explosion in mrna Profiling Studies Stolovitky (2003) Curr. Opin. Struct. Biol. 13, 370. Two Main Types of DNA Microarrays Grünenfelder

More information

Measuring gene expression (Microarrays) Ulf Leser

Measuring gene expression (Microarrays) Ulf Leser Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/

More information

Introduction to microarray technology and data analysis

Introduction to microarray technology and data analysis Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction

More information

Using Lower Amounts of RNA for GE Microarray Experiments

Using Lower Amounts of RNA for GE Microarray Experiments Welcome to our E-Seminar: Using Lower Amounts of RNA for GE Microarray Experiments Chairperson: Rita Willis Slide 1 Labeling RNA for Microarray Experiments Outline Introduction Labeling, Amplification

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

Genomes contain all of the information needed for an organism to grow and survive.

Genomes contain all of the information needed for an organism to grow and survive. Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Predicting Gene Functions

Predicting Gene Functions Predicting Gene Functions Shubhra Sankar Ray shubhrasankar@yahoo.com Center for Soft Computing Research, Indian Statistical Institute, Kolkata, India Tasks in Bioinformatics: Alignment, comparison and

More information

Homework : Data Mining. Due at the start of class Friday, 25 September 2009

Homework : Data Mining. Due at the start of class Friday, 25 September 2009 Homework 4 36-350: Data Mining Due at the start of class Friday, 25 September 2009 This homework set applies methods we have developed so far to a medical problem, gene expression in cancer. In some questions

More information

Comparative Genomic Hybridization

Comparative Genomic Hybridization Comparative Genomic Hybridization Srikesh G. Arunajadai Division of Biostatistics University of California Berkeley PH 296 Presentation Fall 2002 December 9 th 2002 OUTLINE CGH Introduction Methodology,

More information

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1 This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing

More information

Bioinformatics : Gene Expression Data Analysis

Bioinformatics : Gene Expression Data Analysis 05.12.03 Bioinformatics : Gene Expression Data Analysis Aidong Zhang Professor Computer Science and Engineering What is Bioinformatics Broad Definition The study of how information technologies are used

More information

Welcome! Introduction to High Throughput Genomics December Norwegian Microarray Consortium FUGE Bioinformatics platform

Welcome! Introduction to High Throughput Genomics December Norwegian Microarray Consortium FUGE Bioinformatics platform Introduction to High Throughput Genomics December 2011 Norwegian Microarray Consortium FUGE Bioinformatics platform Rita Holdhus Kjell Petersen Welcome! Course program Day 1 Thursday 1st December 2011

More information

Zohar Yakhini Arazi School of Computer Science Herzeliya Interdisciplinary Center (IDC) and Technion Computer Science Department (visiting)

Zohar Yakhini Arazi School of Computer Science Herzeliya Interdisciplinary Center (IDC) and Technion Computer Science Department (visiting) Modelling and synthetic biology for two step fermentation Zohar Yakhini Arazi School of Computer Science Herzeliya Interdisciplinary Center (IDC) and Technion Computer Science Department (visiting) Constraints

More information

Background Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy

Background Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Background Correction and Normalization Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Feature Level Data Outline Affymetrix GeneChip arrays Two

More information

Integrative Genomics 1a. Introduction

Integrative Genomics 1a. Introduction 2016 Course Outline Integrative Genomics 1a. Introduction ggibson.gt@gmail.com http://www.cig.gatech.edu 1a. Experimental Design and Hypothesis Testing (GG) 1b. Normalization (GG) 2a. RNASeq (MI) 2b. Clustering

More information

Computing with large data sets

Computing with large data sets Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Bioinformatics for Biologists

Bioinformatics for Biologists Bioinformatics for Biologists Microarray Data Analysis. Lecture 1. Fran Lewitter, Ph.D. Director Bioinformatics and Research Computing Whitehead Institute Outline Introduction Working with microarray data

More information

Seven Keys to Successful Microarray Data Analysis

Seven Keys to Successful Microarray Data Analysis Seven Keys to Successful Microarray Data Analysis Experiment Design Platform Selection Data Management System Access Differential Expression Biological Significance Data Publication Type of experiment

More information

Outline. Analysis of Microarray Data. Most important design question. General experimental issues

Outline. Analysis of Microarray Data. Most important design question. General experimental issues Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,

More information

Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter

Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter VizX Labs, LLC Seattle, WA 98119 Abstract Oligonucleotide microarrays were used to study

More information

Gene Expression. Bioinformatics (Lec 15)

Gene Expression. Bioinformatics (Lec 15) Gene Expression Process of transcription and/or translation of a gene is called gene expression. Every cell of an organism has the same genetic material, but different genes are expressed at different

More information

Discovering gene regulatory control using ChIP-chip and ChIP-seq. Part 1. An introduction to gene regulatory control, concepts and methodologies

Discovering gene regulatory control using ChIP-chip and ChIP-seq. Part 1. An introduction to gene regulatory control, concepts and methodologies Discovering gene regulatory control using ChIP-chip and ChIP-seq Part 1 An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk http://bit.ly/bio2links

More information

Computational approaches to the discovery of regulatory elements in noncoding DNA. Michael Koldobskiy

Computational approaches to the discovery of regulatory elements in noncoding DNA. Michael Koldobskiy Computational approaches to the discovery of regulatory elements in noncoding DNA Michael Koldobskiy MB&B 452a December 13, 2002 INTRODUCTION Biological research in the post-genomic era has been charged

More information

Standard Data Analysis Report Agilent Gene Expression Service

Standard Data Analysis Report Agilent Gene Expression Service Standard Data Analysis Report Agilent Gene Expression Service Experiment: S534662 Date: 2011-01-01 Prepared for: Dr. Researcher Genomic Sciences Lab Prepared by S534662 Standard Data Analysis Report 2011-01-01

More information

COMPUTATIONAL ANALYSIS OF MICROARRAY DATA

COMPUTATIONAL ANALYSIS OF MICROARRAY DATA COMPUTATIONAL ANALYSIS OF MICROARRAY DATA John Quackenbush Microarray experiments are providing unprecedented quantities of genome-wide data on gene-expression patterns. Although this technique has been

More information

Data Mining for Biological Data Analysis

Data Mining for Biological Data Analysis Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han

More information

Bioinformatics and Genomics: A New SP Frontier?

Bioinformatics and Genomics: A New SP Frontier? Bioinformatics and Genomics: A New SP Frontier? A. O. Hero University of Michigan - Ann Arbor http://www.eecs.umich.edu/ hero Collaborators: G. Fleury, ESE - Paris S. Yoshida, A. Swaroop UM - Ann Arbor

More information

Accuracy of the Bayesian Network Algorithms for Inferring Gene Regulatory Networks

Accuracy of the Bayesian Network Algorithms for Inferring Gene Regulatory Networks HELSINKI UNIVERSITY OF TECHNOLOGY Engineering Physics and Mathematics Systems Analysis Laboratory Mat-2.108 Independent research projects in applied mathematics Accuracy of the Bayesian Network Algorithms

More information

CodeLink Human Whole Genome Bioarray

CodeLink Human Whole Genome Bioarray CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it

More information

ON REPORTING FOLD DIFFERENCES

ON REPORTING FOLD DIFFERENCES ON REPORTING FOLD DIFFERENCES C.L. TSIEN Massachusetts Institute of Technology and Harvard Medical School 545 Technology Square, NE4-420, Cambridge, MA 0219, USA T.A. LIBERMANN, X. GU New England Baptist

More information

Across Platform Comparisons. Collaborators. Previous Work and SCCOR translational research funds. Disagreement in Results

Across Platform Comparisons. Collaborators. Previous Work and SCCOR translational research funds. Disagreement in Results Across Platform Comparisons Collaborators Dan Warren, (JHMI) Forrest Spencer, Laura Morsberger (JHU Medicine Core) Sara C. Hilmer, Eric Hoffman (CNMC) Alan Scott, Anne E. Jedlicka (JHBSPH Core) Wayne Yu,

More information

Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information

Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information Jarkko Salojärvi Lecture slides by

More information

Stefano Monti. Workshop Format

Stefano Monti. Workshop Format Gad Getz Stefano Monti Michael Reich {gadgetz,smonti,mreich}@broad.mit.edu http://www.broad.mit.edu/~smonti/aws Broad Institute of MIT & Harvard October 18-20, 2006 Cambridge, MA Workshop Format Morning

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal

More information