DNA Typing of the Human MN and Ss Blood Group Antigens in Amniotic Fluid and Following Massive Transfusion

Transcription

1 COAGULATION AND TRANSFUSION MEDICINE DNA Typing of the Human MN and Ss Blood Group Antigens in Amniotic Fluid and Following Massive Transfusion JAMES R. ESHLEMAN, MD, PHD, SUSAN H. SHAKIN-ESHLEMAN, MD, PHD, ANN CHURCH, SBB (ASCP), JEFFREY A. KANT, MD, PHD, AND STEVEN L. SPITALNIK, MD Although red blood cell (RBC) antigen typing by agglutination is generally useful, several situations exist where this approach is difficult or impossible. For example, following a massive transfusion, a patient's residual RBCs are mixed with transfused normal donor RBCs. In this case, typing by hemagglutination primarily detects the antigens on the heterogeneous population of transfused RBCs. Agglutination testing is also of limited use for determining the phenotype of a fetus at risk for hemolytic disease of the newborn because fetal RBCs must be obtained by periumbilical blood sampling. Determining the genotype of an individual by analyzing genomic DNA isolated from peripheral blood nucleated cells or amniocytes is an alternative approach for determining the RBC antigen type. In this report, the allele specific polymerase chain reaction (AS-PCR) was used to identify the alleles at the MN and Ss loci that encode the corresponding antigens on glycophorin A (GPA) and glycophorin B (GPB), respectively. This method was used to type these alleles in peripheral blood samples obtained from normal individuals and from patients following massive transfusion. Of 23 peripheral blood specimens analyzed, all were correctly typed by this method. The allele specific polymerase chain reaction was also used to determine these alleles using amniotic fluid samples. Of 11 amniotic fluid specimens analyzed, 8 were correctly typed at both loci. Mistyping of three amniotic fluid specimens was explained by possible maternal blood contamination. (Key words: MNSs blood group system; Polymerase chain reaction; Glycophorins) Am J Clin Pathol 1995; 103: Almost all the serological methods used to type blood group antigens on the surface of red blood cells (RBCs) depend on direct visualization of RBC agglutination. However, in some clinical situations, routine serological methods cannot determine the RBC phenotype accurately. For example, following a massive transfusion, RBCs obtained from the recipient no longer represent those synthesized by this patient, but rather represent a mixture of RBCs from the transfused units obtained from various donors. Therefore, serological phenotyping would detect antigens on both the patient's and the donors' RBCs. Routine agglutination methods are also of limited use for determining the RBC phenotype of a fetus at risk for hemolytic disease of the newborn because periumbilical blood sampling must be performed to obtain fetal RBCs. Finally, in patients with autoimmune hemolytic anemia, autoantibody coating of RBCs can make serological typing im- From the Department of Pathology and Laboratory Medicine. University of Pennsylvania. Philadelphia. Current address for Dr. Eshleman and Dr. Shakin-Eshleman is Department of Pathology, School of Medicine, Case Western Reserve University, Cleveland, Ohio. Supported in part from grants from the NIH (#F82 GM and #R01 HL 46206) and from MetPath. Presented in part at the 1993 annual meeting of the Academy of Clinical Laboratory Physicians and Scientists in New Haven, Connecticut, June 10-12, Manuscript received May 3, 1994; revision accepted July 21,1994. Address reprint requests to Dr. Spitalnik: 220 John Morgan Building, Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA possible. An alternative approach is to infer the RBC phenotype by identifying the alleles in genomic DNA encoding blood group antigens. In recent years, many genes encoding human blood group antigens have been cloned and sequenced. 12 With this information, it is theoretically possible to type RBCs at many loci using methods such as the allele specific polymerase chain reaction (AS- PCR), which is a modification of standard PCR. 3 "* In AS-PCR, an allele specific oligonucleotide primer (designed to perfectly match a single allele at the 3' end of the primer) is used for amplification in conjunction with a common primer (designed to perfectly match all alleles at a distant site). If the corresponding allele is present, then a perfect match occurs with both primers, permitting exponential amplification. However, if this allele is not present, then amplification does not occur. In this report, AS-PCR was used to type the alleles at the MN and Ss loci. This approach was complicated by the high degree of homology between the glycophorin A (GPA), GPB, and GPE genes. 7 Using peripheral blood samples, the AS-PCR method was validated by typing samples obtained from individuals previously known to be heterozygous or homozygous at these loci, and also by prospective prediction of individual MNSs phenotypes using a double blind approach. The utility of this approach to predict patient RBC phenotype following a massive transfusion or most probable genotype of fetal RBC from amniotic fluid is demonstrated. MATERIALS AND METHODS Routine RBC blood group antigen typing was performed by standard agglutination methods 8 using reagents purchased from Gamma Biologicals (Houston, TX). 353

2 354 COAGULATION AND TRANSFUSION MEDICINE Primers 5' AS primars M: CAGCATCAAGTACCACTGGT M CAGCATT.AAGTACCACTGAG. Templates GPA-M: CAGCATCAAGTACCACTGGT GPA-N: CAGCATT.AAGTACCACTGAG. GPB: CAGCATJAAGTACCACTGAG. GPE: CAGCATCAAGTACCACTGGT B. Primers Templates 5' common primnr CCTCCAGAAAAGAAAAACGT GPB-S: CCTCCAGAAAAGAAAAACGT GPB-S: CCTCCAGAAAAGAAAAACGT GPA: CCTCCAGAAG.AGSAAACCGS GPE: CCTCCAGAASAGSAAAATGA 3' common primer ATACJCGCTAATGAAGTTTCA ATAGTGITAATGAAGTTTCA 3' AS primars S: TGGGACAACTTGTCCATCGT S: CGGGACAACTTGTCCATCGT TGGGACAACTTGTCCATCGT CGGGACAACTTGTCCATCGT SGGJACAACTTGCCCATCAT GGGGACAACTTGTCCATCGT FIG. 1. M, N, S, and s allele and gene specific primers and target DNA templates. Panel A: M and N allele specific anti-sense (AS) primers (displayed in sense format) that hybridize with the 5' region of the GPA gene are shown on the left. The sense primer that hybridizes with the 3' region of the GPA gene and imparts gene specificity is shown on the right. The genomic sequence of the M allele of the GPA gene (GPA-M) is shown. The partially homologous sequences of the N allele of the GPA gene (GPA-N), the GPB gene, and the GPE gene are also shown. The sequences differing from the GPA-M sequence are underlined. Panel B: S and s allele specific anti-sense (AS) primers (displayed in sense format) that hybridize with the 3' region of the GPB gene are shown on the right. The sense primer that hybridizes with the 5' region of the GPB gene and imparts gene specificity is shown on the left. The genomic sequence of the S and s alleles of the GPB gene (GPB-S and GPB-s, respectively), the partially homologous sequences of the GPA gene and the GPE gene are shown. The sequences differing from the GPB-S sequence are underlined. Genomic DNA was isolated using standard techniques 9 from peripheral blood anticoagulated with EDTA or from amniotic fluid (without prior culturing). Amniocentesis was performed for fetal lung maturity testing and residual amniotic fluid was used for the current study. DNA isolated from amniotic fluid was generally not quantified, but was significantly less than the 500 ng per reaction used for analysis of peripheral blood samples. All procedures using human samples were performed in accord with the ethical standards established by the University of Pennsylvania. Before amplification, target DNA was boiled for 5 minutes and then chilled for 10 minutes at 4 C. Primers for gene and allele specific amplification were designed from published sequence information. 10 " 13 The primers and templates are shown in Figure 1. The primers were synthesized by the Wistar Institute Oligonucleotide Synthesis facility (Philadelphia, PA). Amplifications were performed in 100 /*L reactions containing: 5 ng/ M L of genomic DNA; 0.1% gelatin; 10 mm Tris ph 8.4; 50 mm KG; 200 jum each of deoxynucleotides; 0.1% Triton X- 100; 0.85 mm MgCl 2 for M and N alleles, 1 mm MgCl 2 for S and s alleles; 0.3 ^M primers for M and N alleles, 0.1 jitm primers for S and s alleles. Amplification was performed using a Perkin-Elmer Cetus N thermocycler (Norwalk, CT) with 30 cycles of 93 C melting for 1 minute, 50 C annealing for 1 minute, and 72 C elongation for 2 minutes. Following amplification, 50 /il of the reaction mix was separated by agarose gel electrophoresis (1% gels), and DNA was visualized by staining with ethidium bromide. 9 All amplifications were performed in duplicate. Other than the three peripheral blood samples initially used to optimize conditions, all other samples were analyzed in a double blind fashion without knowledge of the serologic results. RESULTS To determine the conditions for selective amplification of the M, N, S, and s alleles, three individuals of known MNSs phenotype were studied (Fig. 2). One individual was heterozygous at both loci (M+N+S+S+) and two individuals were homozygous at each locus ((M+N-S+s-) and (M-N+S-S+)). To determine the lower limit of detection of the method, DNA from the individual heterozygous at both loci was used. A visually detectable amplification product was reliably seen at 5 ng of input genomic DNA (data not shown). The most probable genotypes at the MN and Ss loci of seven individuals of varying type were determined in a double blind fashion using AS-PCR of peripheral blood samples. After twice determining the most probable genotype for each sample, the result was compared to the phenotype obtained by standard serologic testing. The correct phenotype was predicted by AS- PCR in all seven samples at both loci (data not shown). DNA blood typing may be useful in the clinically relevant setting of massive transfusion. In this study, DNA was isolated from the peripheral blood of three patients before and after a massive transfusion. For the pretransfusion specimens, there was agreement in each case of the most probable genotype obtained at each locus with the serologically determined RBC phenotype. As expected, due to transfusion with multiple donor units, serological determinations of the RBC phenotype using the posttransfusion specimens were incorrect. However, the most probable genotypes of the same post-transfusion samples reflected the true phenotypic blood types of the individual patients. The results obtained with one representative patient are shown in Figure 3. In this case, Ms, the pretransfusion most probable genotype, agreed with the pretransfusion phenotype. Although DNA typing of the posttransfusion specimen, which analyzes genomic sequences in white blood cells, yielded the correct most probable genotype of the recipient, the agglutination method, which analyzes the circulating RBCs, yielded an incorrect phenotype because of the presence of donor RBCs. Because of the risks associated with periumbilical blood sampling, it would be desirable to analyze amniotic fluid with a DNA based method, such as AS-PCR, to determine fetal RBC blood group antigens. Amniotic fluid samples were obtained from 11 pregnant women. Before analysis, visual estimates indicated that the amount of RBCs contaminating the pelleted amniotic fluid specimens varied from 0% to 20%. For some amniotic fluid samples, both maternal and neonatal peripheral blood samples were also available. The 11 amniotic fluid specimens were analyzed in a double blind fashion. The MNSs most probable genotypes were correctly determined for 8 samples; three samples were typed incorrectly. Of the three incorrect samples, two were not visibly contaminated with RBCs, and the third had approximately 5% RBCs. Of these three specimens, two were incorrectly positive for alleles present in the A.J.C.P.-March 1995

3 ESHLEMAN ET AL. 355 DNA Blood Typing NO DM control mother MNSsMNSs A.F. baby MNSsMNSs Genotype: Phenotype: M S MS Ml NSs MUSi FIG. 2. Determination of most probable MNSs genotype by AS-PCR analysis of genomic DNA isolated from individuals of known phenotype. Genomic DNA was isolated from the peripheral blood of three individuals, amplified by AS-PCR, and separated by agarose gel electrophoresis. The MNSs RBC phenotypes of these individuals were previously determined using serological methods. The RBCs of these individuals had the following serologic phenotypes: Sample 1: MS; Sample 2: Ns; Sample 3: MNSs. The results of control amplifications in the absence of template DNA are also shown. Electrophoretic standards were separated in the extreme left and right lanes. The sizes of these markers (in base pairs) are shown. Note that both the M and N primer sets amplify two DNA products that appear as doublets. The larger product (upper band) is of the size predicted from the known genomic sequence; the lower band is seen only in some individuals and is not seen if the template concentration is reduced during amplification (data not shown). mother; no maternal specimen was available for the third. In one specimen, one allele was incorrectly typed as negative. Figure 4 shows the results obtained with one representative amniotic fluid specimen. The mother's RBC phenotype was MS; the most probable genotype of the amniotic fluid was MSs. After birth of the infant, cord blood was analyzed by both serological phenotyping and DNA genotyping, which confirmed the original amniotic fluid results. DISCUSSION There are several clinical situations where RBC phenotyping using serological methods is difficult or impossible. In these set- Genotype: MNSs Ms Phenotype: MNSs Ms MNSs FIG. 3. MNSs DNA typing of peripheral blood samples by AS-PCR following massive transfusion. Peripheral blood was collected before (pre) and after (post) massive transfusion from one individual. Determination of the most probable genotype by AS-PCR of genomic DNA and determination of the MNSs phenotype by serological typing of RBCs were performed as described. Positive controls were performed using Sample 3 from Figure 2, an individual whose type was MNSs. Electrophoretic markers were separated and identified as in Figure 2. Ms Genotype: MNSs MS MSs MSs Phenotype: MNSs MS MSs FIG. 4. Determination of the most probable MNSs genotype by AS- PCR of amniotic fluid and comparison with the serological phenotype of neonatal peripheral blood RBCs. Maternal peripheral blood (mother), amniotic fluid (A.F.), and neonatal peripheral blood (baby) were collected and analyzed by AS-PCR as described in Materials and Methods. Maternal and neonatal peripheral blood RBCs were also analyzed by standard serological methods. No serologic testing was attempted on the amniotic fluid sample. Positive controls were performed using Sample 3 from Figure 2, an individual whose type was MNSs (control). An exceedingly faint band seen in the s lane amplified from the maternal peripheral blood was interpreted as negative. tings, DNA-based methods for determining most probable genotypes of RBC blood group antigens may be useful. For example, in a massively transfused patient, the true RBC blood group phenotype can be serologically determined if a pretransfusion specimen is available or if the patient's reticulocytes can be separated from a posttransfusion specimen. However, in situations where this is not possible, antigen typing by AS-PCR using DNA isolated from the patient's circulating white blood cells can provide this information. Although one theoretical limitation to using this sensitive assay in this setting is that DNA from transfused white blood cells might also be amplified, this was not observed in this study. This study also describes DNA typing of RBC antigens using nucleated cells derived from uncultured amniotic fluid. DNA analysis of uncultured amniotic fluid for detection of other genes has been performed previously. 14 However, because PCR has extremely low limits of detection (<5 ng of DNA in this study), these reactions must be interpreted with great care. Although gross contamination of amniotic fluid with maternal blood is not uncommon, the number of contaminating white blood cells should be approximately three orders of magnitude lower than the number of contaminating RBCs. However, a maternal peripheral blood sample should always be analyzed concurrently with the fetal specimen. In this way, if the mother lacks the corresponding allele, one can be more confident that the product amplified from amniotic fluid represents a true positive result. However, when this approach is used in the setting of hemolytic disease of the newborn or neonatal alloimmune thrombocytopenia, an attempt is being made to identify a fetal allele (eg, Rh(D) or PI AI, respectively) that the mother lacks. Therefore, contamination of amniotic fluid with maternal blood should be less of an issue. Recent studies that isolated fetal cells from the maternal peripheral circulation by flow cytometry 15 suggest a further noninvasive extension of this approach. In these studies, fetal cells were identified by PCR using Y chromosome specific primers. If a pure enough population of fetal cells could be isolated by flow cytometry, it is conceivable that a PCR-based technique Vol. 103-No. 3

4 356 COAGULATION AND TRANSFUSION MEDICINE could predict the fetal RBC antigen type directly from maternal peripheral blood, obviating the need for amniocentesis. Although not examined in this study, RBC antigen typing by AS-PCR may also be useful when evaluating individuals with autoimmune hemolytic anemia. Sometimes removing all of the autoantibody coating these patients' RBCs without destroying important RBC antigens is impossible, which makes it difficult to use serological methods to determine the RBC phenotype. In addition, as pointed out by others, 16 DNA blood typing would also be useful in forensic and paternity tests. Several other groups have used DNA based methods to identify human blood group antigens. In one study, MNSs typing was performed by allele specific oligonucleotide hybridization using peripheral blood DNA displayed on Southern blots. 17 Although this technique is accurate, it is relatively laborious. Allele specific polymerase chain reaction in a multiplex format has been used to determine the ABO blood type by examining the genes coding for the relevant glycosyltransferases. 18 " 19 In a recent study, MN typing was also performed by AS-PCR. 16 However, these authors did not apply their method to the clinically relevant situations previously described, and they were unable to reliably type for the Ss antigens. In a more recent study, PCR was used for Rh(D) typing of amniotic fluid and chorionic villus samples. 20 This study used common primers for the CcEe gene as a positive internal control. Their approach has great potential utility in the management of pregnant women whose anti-rh(d) antibodies predispose them to develop hemolytic disease of the newborn. Finally, DNA typing methods are not limited to determining RBC blood group antigens, but have also been used to identify human platelet alloantigens important in transfusion medicine. 21 Although the use of DNA methods to determine blood types is potentially of great clinical benefit, some concerns remain. These primarily result from analyzing an individual's genotype and then deducing the corresponding phenotype. For example, when the DNA blood typing result suggests that an individual is homozygous at a particular locus, it is also possible that the individual is heterozygous for that allele and a corresponding null allele. For this reason, the DNA results in this study are described as the "most probable" genotype. In addition, it is possible for an individual to have a unique DNA polymorphism that does not influence the encoded amino acid sequence, but prevents hybridization of an allele specific oligonucleotide primer. In this case, the absence of a PCR amplification product would lead to the incorrect interpretation that the corresponding antigen is absent at the phenotypic level. Such a situation was described in testing for cystic fibrosis. 22 In contrast, it is possible for an individual to have a subtle point mutation in either the promoter or coding regions preventing protein expression. However, because this mutation may be distant from the sequences probed by the chosen primers, the presence of the PCR amplification product would lead to the incorrect interpretation that the corresponding antigen is expressed at the phenotypic level. Detection of such polymorphisms and characterization of the true sensitivity and specificity of DNA blood typing will require testing large population groups of various ethnic backgrounds. Although not incorporated in this pilot study, clinical assays should include additional controls. Ideally, PCR reactions should include a positive control to confirm the presence of patient DNA in the reaction tube, such a control would amplify genomic DNA from all human samples (eg, the CcEe primers used in the study of Bennett and colleagues 20 ). Another relevant internal control includes a segment of unrelated DNA of a different size to which sequences complementary to the test primers are attached at the ends. These "mimics" serve as positive internal controls to confirm the presence of functional primers, nucleotides, and polymerase, as well as the absence of inhibitory substances. This latter approach has been exploited for quantitative reverse transcriptase PCR, but is not generally applied to DNA PCR. Finally, it is important to rigorously prevent cross-contamination of PCR reaction tubes giving rise to false-positive results. Polymerase chain reaction-based testing will become more economical when automated methods and instruments are introduced. Although it is possible that complete RBC antigen typing will be routinely done by PCR methods in the future, the most immediate applications will probably involve analysis of only one blood group system at a time in selected clinical settings. Many additional control samples, including known variant antigens, must be analyzed to validate these types of techniques before they can be applied routinely. REFERENCES 1. Lutz P, Dzik WH. Molecular biology of red cell blood group genes. Transfusion 1992;32: Le Van Kim C, Mouro I, Cherif-Zahar B, et al. Molecular cloning and primary structure of the human blood group RhD polypeptide. Proc Nail Acad Sci USA 1992;89: Dermer SJ, Johnson EM. Methods in laboratory investigation. Rapid DNA analysis of alpha-1 -antitrypsin deficiency: Application of an improved method for amplifying mutated gene sequences. Lab Invest 1988;59: Ehlen T, Dubeau L. Detection of Ras point mutations by polymerase chain reaction using mutation-specific, inosine-containing oligonucleotide primers. Biochem Biophvs Res Comm 1989;160: Newton CR, Graham A, Heptinstall LE, et al. Analysis of any point mutation in DNA: The amplification refractory mutation system (ARMS). Nucl Acid Res 1989; 17: Wu DY, Ugozzoli L, Pal BK, Wallace RB. Allele-specific enzymatic amplification of /3-globin genomic DNA for diagnosis of sickle cell anemia. Proc Nail Acad Sci USA 1989;86: Cartron J-P, Rahuel C. Human erythrocyte glycophorins: Protein and gene structure analyses. Transfusion Med Rev 1992; 6: Walker RH,ed. Technical Manual. 1 lth ed. Bethesda, MD: American Association of Blood Banks, 1993, pp Sambrook J, Fritsch EF, ManiatisT. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, Siebert PD, Fukuda M. Isolation and characterization of human glycophorin A cdna clones by a synthetic oligonucleotide approach: Nucleotide sequence and mrna structure. Proc Nail AcadSciUSA 1986;83: Siebert PD, Fukuda M. Molecular cloning of a human glycophorin B cdna: Nucleotide sequence and genomic relationship to glycophorin A. Proc Nail Acad Sci USA 1987;84: Kudo S, Fukuda M. Identification of a novel human glycophorin, glycophorin E, by isolation of genomic clones and complementary DNA clones utilizing polymerase chain reaction. J Biol Chem 1990;265: Vignal A, Rahuel C, London J, et al. A novel gene member of the human glycophorin A and B gene family. Molecular cloning and expression. Eur J Biochem 1990; 191: Kan YW, Dozy AM. Antenatal diagnosis of sickle-cell anaemia by DNA analysis of amniotic-fluid cells. Lancet 1978;2: Wachtel S, Elias S, Price J, et al. Fetal cells in the maternal circulation: Isolation by multiparameter flow cytometry and confir- A.J.C.P.-March 1995

5 ESHLEMAN ET AL. 357 DNA Blood Typing mation by polymerase chain reaction. Hum Reprod 1991; 6: Corfield VA, Moolman JC, Martell R, Brink PA. Polymerase chain reaction-based detection of MN blood group-specific sequences in the human genome. Transfusion 1993;33: Huang CH, Guizzo ML, McCreary J, Leigh EM, Blumenfeld OO. Typing of MNSs blood group specific sequences in the human genome and characterization of a restriction fragment tightly linked to S-s-alleles. Blood 1991;77: Ugozzoli L, Wallace RB. Application of an allele-specific polymerase chain reaction to the direct determination of ABO blood group genotypes. Genomics 1992; 12: O'Keefe DS, Dobrovic A. A rapid and reliable PCR method for genotyping the ABO blood group. Hum Mulal 1993;2: Bennett PR, Le Van Kim C, Colin Y, et al. Prenatal Determination of Fetal RhD type by DNA Amplification. A' Engl J Med 1993;329: McFarland JG, Aster RH, Bussel JB, et al. Prenatal diagnosis of neonatal alloimmune thrombocytopenia using allele-specific oligonucleotide probes. Blood 1991;78: Fujimura FK, Northrup H, Beaudet AL, O'Brien WE. Genotyping errors with the polymerase chain reaction. N Engl J Med 1990;322:61. Vol. 103-No. 3