Targeted modification of gene function exploiting homology directed repair of TALENmediated double strand breaks in barley
|
|
|
- Rosanna Bailey
- 6 years ago
- Views:
Transcription
1 Targeted modification of gene function exploiting homology directed repair of TALENmediated double strand breaks in barley Nagaveni Budhagatapalli a, Twan Rutten b, Maia Gurushidze a, Jochen Kumlehn a, and Goetz Hensel a,1 a Plant Reproductive Biology, Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstr. 3, D Stadt Seeland/OT Gatersleben, Germany b Structural Cell Biology, Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstr. 3, D Stadt Seeland/OT Gatersleben, Germany 1 To whom correspondence should be addressed. Dr. Goetz Hensel Plant Reproductive Biology Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Corrensstr. 3 D Stadt Seeland/OT Gatersleben Germany E Mail: hensel@ipk gatersleben.de Tel: +49(0) Fax: +49(0) DOI: /g
2 Figure S1. Details of the binary plasmids used in the study and expression data of FokI in the leaves of donor material. (A) and (B) Binary plasmids used to obtain expression of the gfp-specific TALEN units. SpecR: ADENYLTRANSFERASE (encodes resistance to spectinomycin), LB: T-DNA left border, d35sp: CaMV 35S promoter, BAR: BAR (encodes resistance to bialaphos), 35ST: CaMV 35S transcriptional termination sequence, NOST: A. tumefaciens NOPALINE SYNTHASE transcriptional termination sequence, FokI: FokI cleavage domain, TALEN (left or right): customized binding domain of the gfp-talen units, HA: haemagglutinin tag, S40 NLS: SV40 nuclear localization signal, UBIP: maize UBIQUITIN-1 promoter plus first intron, RB: T-DNA right border, ColE1: E. coli plasmid ColE1 high-copy replication origin, pvs1: Pseudomonas aeruginosa plasmid pvs1 replication origin. (C) Binary plasmid used for developing stable gfp lines and (D) binary plasmid carrying yfp gene cassette. (E) Transcription analysis in the presence of the gfp-talen units. The cdnas were prepared from lines 335R and 338R (harboring the right-hand unit), and from lines 319L and 462L (left-hand unit). The FokI cleavage domain was amplified using primers given in Supplemental Table S1 and HvACTIN1 was used as the reference sequence. 2 SI
3 Figure S2. Confocal microscopy image of the barley abaxial leaf surface demonstrating the cell types present. The guard and adjacent epidermal cells labeled A, B and C were included in the count, whereas those marked D (narrow cells in the inter-stomatal region) were excluded due to the low efficiency of transient transgene expression. 3 SI
4 Figure S3. HDR following the induction of TALEN-mediated DSBs in cultured immature barley embryos. (A) Merged bright field and epifluorescence images of line 462L (carrying gfp and the left-hand TALEN unit) callus taken 24 h after bombardment with the right-hand gfp-talen unit and linearized yfp* fragment. Bar: 20 µm. (B) Lambda stack of same materials shown in (A) used to visualize the presence of GFP (emission peak at 509 nm) and YFP (527 nm). (C; D) Epifluorescence of transiently transformed 462L callus after excitation with 488 nm laser light and spectral unmixing to identify (C) GFP and (D) YFP signals. Bar: 20 µm. (E) Merged image of (C) and (D). 4 SI
5 Table S1. List of primers used for the identification of T-DNA elements in the study. Primer Sequence 5 3 Amplified region, primer orientation Actin-F1 GGATCCGATGGCTGACGGTGAGGACATCCAG HvACTIN1, forward Actin-F2 CCATGGAGAAGCACTTCCTGTGGACGATCG HvACTN1, reverse FokI-F1 ATCGAGATCGCCCGGAACAGCACC FokI gene, forward FokI-R ATCATCTCGCCGCCGATCAGGAGC FokI gene, reverse GH-35S-R1 GAGGCATCTTGAACGATAGC CaMV 35S promoter, reverse GH-YFP-TALEN-F2 CGACTTTAAAGAAGATGGTA yfp TALEN-right unit, forward 5 SI
6 Table S2 Quantification of homology directed repair in barley leaves. Available for download as an Excel file at /DC1 6 SI
Transient and transgenic approaches for functional testing of candidate genes in barley
Volume 55(1):129-133, 2011 Acta Biologica Szegediensis http://www.sci.u-szeged.hu/abs ARTICLE Transient and transgenic approaches for functional testing of candidate genes in barley Bettina Nagy 1, Petra
Targeted modification of gene function exploiting homology-directed repair of TALEN-
G3: Genes Genomes Genetics Early Online, published on July 6, 2015 as doi:10.1534/g3.115.018762 1 2 Targeted modification of gene function exploiting homology-directed repair of TALEN- mediated double
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
Plant Cell, Tissue and Organ Culture
Supplementary materials for Plant Cell, Tissue and Organ Culture Article tile: Agrobacterium mediated Genetic Transformation of Miscanthus sinensis Authors: Ok-Jin Hwang 1, Mi-Ae Cho 1, Yun-Jeong Han 1,
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
pri 201 DNA Series (High-Expression Vectors for Plant Transformation)
For Research Use Cat #. 3264 3265 3266 3267 pri 201 DNA Series (High-Expression Vectors for Plant Transformation) Product Manual Table of Contents I. Description... 3 II. Product Information... 3 III.
Barley as a model for cereal engineering and genome editing. Wendy Harwood
Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter
Genome Engineering and Haploid Technology in Crop Plants
Genome Engineering and Haploid Technology in Crop Plants Jochen Kumlehn Plant Reproductive Biology Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Gatersleben Genetic modifications in
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplemental Data. Wu and Xue (2010). Plant Cell /tpc
Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION High-efficiency TALEN-based gene editing produces disease-resistance rice Ting Li 1, Bo Liu 1, Martin H. Spalding 1, Donald P. Weeks 2, Bing Yang 1 * 1 Department of Genetics,
SUPPLEMENTARY INFORMATION. Tolerance of a knotted near infrared fluorescent protein to random circular permutation
SUPPLEMENTARY INFORMATION Tolerance of a knotted near infrared fluorescent protein to random circular permutation Naresh Pandey 1,3, Brianna E. Kuypers 2,4, Barbara Nassif 1, Emily E. Thomas 1,3, Razan
Targeted Gene Therapy in the Treatment of X-linked Hyper-IgM Syndrome. Caroline Kuo, MD Pediatric Allergy & Immunology Clinical Instructor
Targeted Gene Therapy in the Treatment of X-linked Hyper-IgM Syndrome Caroline Kuo, MD Pediatric Allergy & Immunology Clinical Instructor 1 Disclosures None. Hyper-immunoglobulin M syndromes Heterogeneous
Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design
Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
BurrH: a new modular DNA binding protein for genome engineering
Supplementary information for: BurrH: a new modular protein for genome engineering Alexandre Juillerat, Claudia Bertonati, Gwendoline Dubois, Valérie Guyot, Séverine Thomas, Julien Valton, Marine Beurdeley,
Supplemental Figure 1
12 1 8 Embryo 6 5 4 Silk 6 4 2 3 2 1 1 15 21 24 3 35 4 45 days after pollination 2 6 12 24 72 hours after pollination 35 6 3 25 2 15 1 5 Endosperm 8 12 21 22 3 35 4 45 days after pollination 5 4 3 2 1
Testing Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA
Testing Non-Transgenic CRISPR Technology for Wheat Improvement KALI M BRANDT, HILARY L GUNN, BRETT L BUSCHKE, ADAM HEESACKER, NATHALIA MORET TI, ALEXANDER KARASEV, ROBERT S ZEMETRA 13 TH IWGS - TULLN,
Genome edi3ng with the CRISPR-Cas9 system
CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,
Supplemental information Precise A T to G C base editing in the rice genome
Supplemental information Precise A T to G C base editing in the rice genome Kai Hua, Xiaoping Tao, Fengtong Yuan, Dong Wang, Jian-Kang Zhu Contents Supplemental Figure 1. TA cloning results of two base
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice. A B Supplemental Figure 1. Expression of WOX11p-GUS WOX11-GFP
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
A simple test for the cleavage activity of customized endonucleases in plants
DOI 10.1186/s13007-016-0118-6 Plant Methods RESEARCH A simple test for the cleavage activity of customized endonucleases in plants Open Access Nagaveni Budhagatapalli 1, Sindy Schedel 1, Maia Gurushidze
Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte
Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte Carlo algorithm for one million generations to obtain
4/26/2015. Cut DNA either: Cut DNA either:
Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds
sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer
Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses
oligonucleotide primers listed in Supplementary Table 2 and cloned into ppcr-script (Stratagene) before digestion
Supplementary Methods. Construction of BiFC vectors The full-length ARC3 cdna, ARC3 1-1794 and ARC3 1-1083 were amplified from ppcr-script/arc3 using the oligonucleotide primers listed in Supplementary
New Plant Breeding Techniques Group 1 Targeted Mutagenesis
WORKSHOP COMPERATIVE SITUATION OF NEW PLANT BREEDING TECHNIQUES 12-13 SEPTEMBER 2011 SEVILLE, SPAIN New Plant Breeding Techniques Group 1 Targeted Mutagenesis Maria Lusser Joint Research Centre, European
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
To investigate the heredity of the WFP gene, we selected plants that were homozygous
Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous
Gene specific primers. Left border primer (638) ala3-4 (Salk_082157) Gene specific primers. Left border primer (1343)
Supplemental Data. Poulsen et al. (2008) The Arabidopsis P4-ATPase pump ALA3 localizes to the Golgi and requires a β subunit to function in lipid translocation and secretory vesicle formation. A ala3-1
Recitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes
Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes Question No. 1 of 10 1. Which of the following statements about genes is correct? Question #1 (A) Genes carry the information for protein
Materials and methods. by University of Washington Yeast Resource Center) from several promoters, including
Supporting online material for Elowitz et al. report Materials and methods Strains and plasmids. Plasmids expressing CFP or YFP (wild-type codons, developed by University of Washington Yeast Resource Center)
Genome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
Sperm cells are passive cargo of the pollen tube in plant fertilization
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17079 Sperm cells are passive cargo of the pollen tube in plant fertilization Jun Zhang 1, Qingpei
Genetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
Supplementary Information. c d e
Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination
7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
Easi CRISPR for conditional and insertional alleles
Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and
AP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
Figure S1: Plasmid map of RNAi-reporter construct pipkta26_swai.
Figure S1: Plasmid map of RNAi-reporter construct pipkta26_swai. γ 5 γ a γ b FcFgl1 3 (461 bp) γ 5 γ a γ b FcFmk1 3 (300 bp) γ 5 γ a γ b FcGls1 3 (300 bp) γ 5 γ a γ b FcChsV 3 (385 bp) Figure S2: Schematic
XactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
Define selective breeding. Define pure breeding. Define domestication relative to the examples above.
Define selective breeding. Define pure breeding. Define domestication relative to the examples above. Selective Breeding Selective Breeding Induced nondisjunction Define hybridization. Explain how hybridization
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for t
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for the pcloa genes of zebrafish, green spotted puffer (listed
Molecular Biology Techniques Supporting IBBE
Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning
Yeast 2-Hybrid Kayla Nygaard
Yeast 2-Hybrid 2.26.18 Kayla Nygaard Y2H - What is it? A method to screen for protein-protein interactions in yeast Capitalizes on GAL4 system in yeast. GAL4 has 2 domains DNA-Binding Domain (DB) Transcriptional
Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients
Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,
GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
CRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
GM (Genetically Modified) Plants. Background
1 GM (Genetically Modified) Plants Background Genetically modified crops (GM) have been used since 1996 in the U.S. GM crops contain foreign genetic material The DNA may be from another plant or from a
A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells
Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplementary Information
Supplementary Information Fluorescent protein choice The dual fluorescence channel ratiometric promoter characterization plasmid we designed for this study required a pair of fluorescent proteins with
The Central Dogma. 1) A simplified model. 2) Played out across life. 3) Many points for control.
Molecular Biology The Central Dogma 1) A simplified model. 2) Played out across life. 3) Many dis@nct points for control. Molecular Biology DNA: four nucleo@de bases (GC,AT) (2 bits) gene@c code in 3 base
Supporting Information
Supporting Information Gómez-Marín et al. 10.1073/pnas.1505463112 SI Materials and Methods Generation of BAC DK74B2-six2a::GFP-six3a::mCherry-iTol2. BAC clone (number 74B2) from DanioKey zebrafish BAC
Return to Web Version
Page 1 of 7 Page 1 of 7 Return to Web Version ZFN Technology Biowire Volume 10 Article 1 Have your genomic work cut out for you The genomes of several organisms, including humans, have been sequenced,
Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene
Aalborg Universitet Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Publication date: 2009 Document Version Publisher's PDF, also
DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Construct Design and Cloning Guide for Cas9-triggered homologous recombination
Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest
Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
Regulatory Mechanism of Mycotoxin Tenuazonic Acid Production in Pyricularia oryzae
1 Supporting Information 2 3 4 5 6 Regulatory Mechanism of Mycotoxin Tenuazonic Acid Production in Pyricularia oryzae Choong-Soo Yun, Takayuki Motoyama, and Hiroyuki Osada* Chemical Biology Research Group,
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Deep sequencing reveals global patterns of mrna recruitment
Supplementary information for: Deep sequencing reveals global patterns of mrna recruitment during translation initiation Rong Gao 1#*, Kai Yu 1#, Ju-Kui Nie 1,Teng-Fei Lian 1, Jian-Shi Jin 1, Anders Liljas
Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
PLNT2530 (2018) Unit 9. Genome Editing
PLNT2530 (2018) Unit 9 Genome Editing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 Genome Editing
Supporting Information
Supporting Information Deng et al. 10.1073/pnas.1515692112 SI Materials and Methods FPLC. All fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20),
Nucleic Acid Structure:
Genetic Information In Microbes: The genetic material of bacteria and plasmids is DNA. Bacterial viruses (bacteriophages or phages) have DNA or RNA as genetic material. The two essential functions of genetic
A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks
A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks SARAH K. DICKERSON AND F. NINA PAPAVASILIOU Laboratory of Lymphocyte Biology, The
Live-cell visualization of excitation energy dynamics in chloroplast thylakoid structures
Supplementary Information Live-cell visualization of excitation energy dynamics in chloroplast thylakoid structures Masakazu Iwai, Makio Yokono, Kazuo Kurokawa, Akira Ichihara & Akihiko Nakano Supplementary
Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
Supporting Information
Supporting Information Development of a 2,4-Dinitrotoluene-Responsive Synthetic Riboswitch in E. coli cells Molly E. Davidson, Svetlana V. Harbaugh, Yaroslav G. Chushak, Morley O. Stone, Nancy Kelley-
CRISPR-Cas9 Genome Editing. New Era of Agricultural Biotechnology
2017 Grains Research Update - CRISPR-Cas9 Genome Editing New Era of Agricultural Biotechnology Yong Han & Chengdao Li y.han@murdoch.edu.au Western Barley Genetics Alliance 28 Feb,2017 One of the ten breakthrough
New Plant Breeding Technologies
New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/244/ra72/dc1 Supplementary Materials for An Interaction Between BZR1 and DELLAs Mediates Direct Signaling Crosstalk Between Brassinosteroids and Gibberellins
Supplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice Fei Chen 1,*, Guojun Dong 2,*, Limin Wu 1, Fang Wang 3, Xingzheng
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
Bootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
A Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
F (fertility) plasmid Fig Gene movement, part III and restriction-modification. Plasmid transfer via F conjugation
Microm 410 2009: Gene Movement-Conjugation F (fertility) plasmid Fig 11.19 Gene movement, part III and restriction-modification Plasmid transfer via F conjugation Conjugative ability due to transfer (tra
Recombinant protein production in Eukaryotic cells. Dr. W. McLaughlin BC35C
Recombinant protein production in Eukaryotic cells Dr. W. McLaughlin BC35C Recombinant protein production in Eukaryotic cells! rhuman protein must be identical to the natural protein! Prokaryotes are generally
Generation of gene knockout vectors for Dictyostelium discoideum
Generation of gene knockout vectors for Dictyostelium discoideum Instruction manual Last date of revision April 2012 2015 Version PR29-0001 PR29-0003 www.stargate.com This manual can be downloaded under
I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:
I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction
SUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying