Interest in any of the products, request or order them at Bio-Connect.
|
|
|
- Francine Shepherd
- 6 years ago
- Views:
Transcription
1 NFκB Pathway Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0) T B +32 (0) Begonialaan 3a F NL +31 (0) F B +32 (0) T uissen info@bio-connect.nl The Netherlands W
2 NFkB Pathway Antibody uo LISA kit Nuclear factor kappa B (NFkB) is a protein complex that controls large number of genes responsible for the regulation of apoptosis, inflammation, tumorigenesis and a variety of immune responses. NF-kB is sensitive and responsive to stimuli such as cytokines, stress, UV, low oxygen, bacterial or viral infections. IKK Independant Pathway Canonical Pathway IL-1 TNF ypoxia 2O2 LPS IL-1 TNF1 TA FA Non-canonical Pathway C40L UV, er2 C40 my88 IAK1/4 IAK TAF6 Tyr Kinase TAF6 CK2 TAF2 TAF3 TAB TAK NIK NO IKKα IKKβ S32 c-iap1/2 Calpain Y42 S36 NO S866 p100 LB Coactivator IKKα IKKβ S870 Proteosomal Corepressor AC p52 LB p52 LB TF istinct Binding Sites Transcriptional Activation Transcriptional epression Cytokines / Chemokines Immunoreceptor Cell adhesion molecules Acute phase proteins Stress response Promoter-targeting egulation Cell surface receptors egulators of apoptosis Growth factors and ligands arly response genes Transcription factors & regulators Lymphoid organogenesis B cell maturation umoral immunity
3 NFkB Signaling Pathway elated Products Catalog No. Product Name Clonality Applications eactivity AG54369 BAFF antibody, ICC/IF AG20070 BAFF antibody AG80154 AG20066 BAFF LISA Kit Calpain1 antibody LISA,,, Bo, P, b AG52619 Calpain1 antibody abbit mab, IC AG52770 C40 antibody IC AG80130 AG54127 C40L LISA Kit FA antibody LISA AG51660 IKappaB alpha py42 antibody, IC,, AG54345 IKK beta antibody AG20319 IL-1a antibody, Neut AG80237 AG80204 AG80504 AG80712 AG80196 AG80503 AG54631 IL-1a LISA Kit IL-1a LISA Kit IL-1a LISA Kit IL-1b LISA Kit IL-1b LISA Kit IL-1b LISA Kit IAK4 antibody LISA LISA LISA LISA LISA LISA, ICC/IF AG54348 Y88 antibody,, AG51015 NFkB p100/p52 antibody, IC,, AG51519 NFkB p100/p52 ps866 antibody, IC, ICC/IF,, AG51520 NFkB p100/p52 ps870 antibody, IC, ICC/IF,, AG51017 NFkB p105 antibody, IC AG51276 NFkB p105 antibody, ICC/IF,, AG51010 AG51514 NFkB p65 antibody NFkB p65 pt254 antibody, IC, ICC/IF, IC, ICC/IF,,,, AG51516 NFkB p65 pt435 antibody, IC, ICC/IF,, AG51664 NFkB p65 pt505 antibody, IC,, NF-kB Activation Antibody Panel (AG30205) cat no. Name Clonality Applications eactivity Package AG51780 AG51160 AG51850 AG51807 AG51651 IKK beta py199 IKB alpha p38 APK pt180/y182 JNK1/2/3 pt183/y185 IKB alpha ps32/36 ICC/IF, IC, ICC/IF, IC, ICC/IF,,,,,,,,,, AG51850 P38 APK (pt180 / Y182) AG51807 JNK 1 / 2 / 3 (pt183 / Y185) AG51780 IKK beta py199 ela cells Product escription: el or NF-kappaB (NF-kB) proteins comprise a family of structurally-related eukaryotic transcription factors that are involved in the control of a large number of normal cellular and organismal processes, such as immune and inflammatory responses, developmental processes, cellular growth, and apoptosis. Up-regulation of phospho-ikk, phospho-p38, phospho-jnk and down-regulation of IKB alpha is often associated with the activation of NF-kB downstream signaling pathway. AG65351 Goat anti-abbit IgG Antibody (P) ayden and Ghosh. (2012) Genes and ev 26: Baeuerle and enkel. (1994) Ann ev Immunol 12: Phospho-IKB alpha Antibody uo (Total, ps32/36) (AG30037) cat no. Name Clonality Applications eactivity Package AG51651 AG51160 IKB alpha ps32/36 IKB alpha, IC, ICC/IF, IC,,,, AG51160 IKB alpha antibody AG51651 IKB alpha ps32 / 36 antibody uman breast
4 Phospho-NFkB p65 Antibody uo NF-kappa-B is a iquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to L, LA, or LB. The most abundant form of NF-kappa-B is NFKB1 complexed with LA (p65). Four transcript variants encoding different isoforms have been found for LA. (provided by efseq, Sep 2011) NFkB (p65) has multiple phosphorylation site with different regulations and functions. Phosphorylation at Serine 536 is mediated by IKK beta and/or IKK alpha in the cytoplasm and it is required for p65 activation. Phosphorylation on Ser276 of p65 in the nucleus enhances its ability to recruit histone acetyltransferases such as cap response element-binding (CB)-binding protein (CBP) and p300 and to displace p50 histone deacetylase (AC)-1 complexes from NA. In addition, IL1 beta and TNF alpha stimulate p65 phosphorylated at Ser529 through CK2 protein. AG30029, AG30030 and AG30031 NFkB phosphor uos include antibodies react total p65 protein and p65 phosphorylated at Ser276 or Ser529 or Ser536. It is useful for the user in p65 related functional studies. AG51708 NFkB-p65 p-ser529 antibody uman breast AG51518 NFkB-p65 p-ser536 antibody ela cells AG51515 NFkB-p65 p-ser276 antibody uman breast AG30029 Phospho-NFkB Antibody uo (ps529, ps536) cat no. Name Clonality Applications eactivity Package AG51518 AG51708 NFkB-p65 ps529 antibody, IC-P, ICC/IF, IC-P, ICC/IF,,,, AG30030 Phospho-NFkB Antibody uo (ps276, ps536) cat no. Name Clonality Applications eactivity Package AG51518 AG51515 NFkB-p65 ps276 antibody, IC-P, ICC/IF, IC-P, ICC/IF,,,, AG30031 Phospho-NFkB Antibody uo (Total, ps536) cat no. Name Clonality Applications eactivity Package AG51518 AG20427 NFkB p65 antibody [2A12A7] ouse mab, IC-P, ICC/IF, IP, IC,,,, 25 µl Catalog No. Product Name Clonality Applications eactivity AG54322 AG51741 AG54074 AG63986 AG65482 AG80241 AG80206 AG80120 AG65452 AG53680 AG64172 AG20163 NIK antibody elb ps573 antibody TAB1 antibody TAK1 antibody TNF-alpha antibody TNF-alpha LISA Kit TNF-alpha LISA Kit TNF-alpha LISA Kit TNF1 antibody TA antibody TAF2 antibody TAF3 antibody, LISA, IC FACS, IC, ICC/IF, FuncSt LISA LISA LISA FACS, IP, IC, FuncSt IC, IC NFkB Target Genes,, Pri, P,, Catalog No. Product Name Clonality Applications eactivity AG20425 AG20424 BAX antibody Bcl-2 antibody, IC, IP, ICC/IF, FACS, IC, IP,,, k,, AG51057 Bcl-xL antibody,, AG20307 BNF antibody AG54406 Bim antibody, ICC/IF AG53981 Bmi1 antibody AG80164 BP-2 LISA Kit LISA
5 NFkB Target Genes Catalog No. Product Name Clonality Applications eactivity AG52577 BP-4 antibody IC AG51034 AG52902 c-yc antibody COX2 antibody abbit mab, IC IC,,,, AG80195 AG80825 AG53974 AG63244 CP LISA Kit PO LISA Kit Fibronectin antibody GATA3 antibody LISA LISA IC, IC AG80143 AG80229 AG80185 AG54038 G-CSF LISA Kit G-CSF LISA Kit GO beta / CXCL2 LISA Kit ICA-1 antibody LISA LISA LISA AG80116 AG80493 AG53370 IFN-gamma (S) LISA Kit IGFBP-2 LISA Kit inos antibody LISA LISA IC,, AG53340 IF4 antibody abbit mab, IC AG64936 AG80908 AG20345 JUNB antibody IP-1 alpha LISA kit IP-1a antibody LISA, IP, AG80174 AG52352 IP2 LISA kit NA1 antibody LISA, IP, AG52357 NA2A antibody, IP, IC,, AG62568 NGF antibody ICC/IF, FACS, IC,, b, Cat, Fer, Pri AG62512 NG1 antibody, IP, IC,, AG51081 p53 antibody, IC, ICC/IF AG65048 P1/BLIP1 antibody, IC AG20190 P-selectin antibody, IC,, AG65593 AG20161 STAT5A antibody TL9 antibody, IC,,,,, P AG80120 AG80134 TNF-alpha LISA kit VCA1 LISA kit LISA LISA AG65048 P-1 antibody AG53981 Bmi1 antibody AG54038 ICA1 antibody AG52901 COX-2 antibody AG20345 IP-1a antibody AG51081 p53 antibody uman colon uman tonsil Sw480 cells adenocarcinoma ela cells LISA Kits uo/panel also available Species eactivity: - uman; - ouse; - at; b- abbit; Pri- Primate; P- Pig; k- onkey; Bo- Bovine No.22, Ln. 227, Gongyuan oad., sinchu City 300, Taiwan : info@arigobio.com / T : +886 (3) / F : +886 (3)
ELISPOT and FLUOROSPOT kits
ELISPOT and FLUOROSPOT kits Interleukins Interferons Granzymes and perforins TNF superfamily ligands and receptors Apoptosis markers And many more... ELISPOT and FLUOROSPOT: a cell-based assay to assess
Novel cytokines in allergic disease
Novel cytokines in allergic disease By Soohyun Kim, PhD KonKuk University, Seoul Korea Content Introduction (cytokine functions in immune responses) Discovery of Interleukin-32 IL-32 binding protein (a
NF-kB Research Tools, Product Brochure
NF-kB Research Tools, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
Product datasheet. ARG30119 Pro-B Cell Marker Antibody panel (CD19, CD34, CD38, CD40, CD45)(FACS)
Product datasheet info@arigobio.com Package: 1 kit ARG30119 Pro-B Cell Marker Antibody panel (CD19, CD34, CD38, CD40, CD45)(FACS) Component Cat. No. Component Name ARG62820 anti-cd34 antibody [4H11(APG)]
AlphaScreen SureFire IKK β (p-ser177/181) Assay Kits. Quick Guide
AlphaScreen SureFire IKK β (p-ser177/181) Assay Kits Quick Guide Assay Points Catalog # 500 TGRKBS500 10 000 TGRKBS10K 50 000 TGRKBS50K For Research Use Only Research Reagents for Research Purposes Only
I kappa B Kinase alpha (IKKα) activity is required for functional maturation of dendritic cells and acquired immunity to infection
Manuscript EMBO-2012-82441 I kappa B Kinase alpha (IKKα) activity is required for functional maturation of dendritic cells and acquired immunity to infection Alessandra Mancino, Mohamed Habbeddine, Ella
b alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
Circuitry of nuclear factor kb signaling
Alexander Hoffmann David Baltimore Circuitry of nuclear factor kb signaling Authors addresses Alexander Hoffmann 1, David Baltimore 2 1 Department of Chemistry and Biochemistry, University of California,
Product Data Sheet - ANTIBODY
888.267.4436 techsupport@origene.com www.origene.com Name:Mouse Monoclonal p62/sqstm1 Antibody (5H7E2) Product Data Sheet - ANTIBODY Catalog: TA336949 Components: Mouse Monoclonal p62/sqstm1 Antibody (5H7E2)
Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.
1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus
DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268
DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:
Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
Andrea s SI Session PCB 3233
Practice Test Test 2 1. A pathogen invades a tissue. Which cell of the immune system is more likely to respond first? a. Neutrophil b. T Cell c. B Cell d. Macrophage 2. The receptor for C3b is? a. CR1
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
RayBio Human PPAR-gamma Transcription Factor Activity Assay Kit
RayBio Human PPAR-gamma Transcription Factor Activity Assay Kit Catalog #: TFEH-PPARg User Manual Jan 5, 2018 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
Find 1 cell in 100,000 with ELISpot
Find 1 cell in 100,000 with ELISpot Interest in any of the products, request or order them at io-connect Diagnostics. io-connect Diagnostics.V. T NL +31 (0)26 326 44 60 T E +32 (0)2 502 12 53 egonialaan
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:
Post-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
NF-κB/Jurkat/GFP Transcriptional Reporter Cell Line
NF-κB/Jurkat/GFP Transcriptional Reporter Cell Line User Manual Store vial in vapor phase of liquid nitrogen on receipt NF-κB/Jurkat/GFP Reporter Cell Line Contents I. Introduction and Background A. Overview
Using Mechanistic Data to Predict and Interpret Clinical Outcomes in Probiotic Studies on Immunity.
Using Mechanistic Data to Predict and Interpret Clinical Outcomes in Probiotic Studies on Immunity. Milano, Italy October 16, 2015 Thomas A. Tompkins, Ph.D. Research Director, Lallemand Health Solutions
Chapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
Histone H3 Methylation Antibody Panel Pack II - Repression Genes Base Catalog # C10003
Histone H3 Methylation Antibody Panel Pack II - Repression Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3R2DA Histone H3R2 Dimethyl Asymmetric (H3R2me2a)
Validation & Assay Performance Summary
Validation & Assay Performance Summary CellSensor ISRE RA-1 Validated Assay Cat. no. K1674 CellSensor Cell-Based Assay Validation Packet This cell-based assay has been thoroughly tested and validated by
SUPPLEMENTARY INFORMATION
SUPPLEMENTY INFORMATION doi:10.1038/nature20785 Extended data Fig 1f Extended data Fig 1h 37 KD 37 KD Extended data Fig 1i Extended data Fig 4c Extended data Fig 3b Extended data Fig 4j 37 KD 37 KD Extended
TLR and inflammasome
TLR and inflammasome TLR and Inflammasome Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized partner in the development and
Cell biology.
Cell biology Cell biology, formerly called cytology, is a branch of biology that studies the different structures and functions of the cell and focuses mainly on the idea of the cell as the basic unit
ELISA Kit: NF-κB (p65) TRANSCRIPTION FACTOR ASSAY KIT
Page 1 of 12 ELISA Kit: NF-κB (p65) TRANSCRIPTION FACTOR ASSAY KIT Catalog # KAA065 I. Overview Rockland's NF- B (p65) Transcription Factor Assay is a non-radioactive, sensitive method for detecting specific
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:IL6 mouse monoclonal antibody, clone OTI3G9 (formerly 3G9) Product Data Sheet - TRUEMAB Catalog: TA500067 Components: IL6 mouse monoclonal antibody,
Adhesion molecules, cytokines & chemokines
Adhesion molecules, cytokines & chemokines Adhesion molecules and cytokines Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]
![3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]](/thumbs/87/97394430.jpg "3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]")
L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different
1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation?
1 Name MCB 150 Midterm Eam #1 (100 points total) Please write your full name on each page of the eam!! The eam consists of 17 questions (6 pages). Each has a different point count as indicated. Please
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:
BD Biosciences BD Cytometric Bead Array (CBA) Product List. For Research Use Only. Not for use in diagnostic or therapeutic procedures.
BD Biosciences BD Cytometric Bead Array (CBA) Product List For Research Use Only. Not for use in diagnostic or therapeutic procedures. Highlights of BD CBA Products Reagents with Superior Quality and Reproducibility
8,003,386 Tumor necrosis factor receptors 6.alpha. and 6.beta. 7,851,596 Myeloid progenitor inhibitory factor- 1 (MPIF- 1) polypeptides
PAT. NO. Title 8,163,522 Human TNF receptor 8,105,589 Use of DR3 antibodies in the treatment of inflammatory disease 8,063,182 Human TNF receptor fusion protein 8,003,386 Tumor necrosis factor receptors
Structure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
GSI Equine TNF alpha ELISA Kit- Whole Blood DataSheet
GSI Equine TNF alpha ELISA Kit- Whole Blood DataSheet TNF-α, the prototypical member of the TNF protein superfamily, is a homotrimeric type-ii membrane protein (1,2). Membrane bound TNF-α is cleaved by
Data Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654
Data Sheet SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654 Background The transforming growth factor beta (TGFβ) signaling pathway is involved in a diverse range of cell processes such
RabMAb advantages A guide to our rabbit monoclonal antibodies
RabMAb advantages A guide to our rabbit monoclonal antibodies Discover more at abcam.com/rabmab Table of Contents About RabMAb technology... 3 RabMAb technology vs traditional mouse monoclonal technology...
TransAM Kits are DNA-binding ELISAs that facilitate the study of transcription factor activation in mammalian tissue and cell culture extracts.
Transcription Factor ELISAs TransAM sensitive quantitative transcription factor ELISAs TransAM Kits are DNA-binding ELISAs that facilitate the study of transcription factor activation in mammalian tissue
Adhesion molecules and cytokines
Adhesion molecules and cytokines Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized partner in the development and manufacturing
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:CD34 mouse monoclonal antibody, clone OTI12F2 (formerly 12F2) Product Data Sheet - TRUEMAB Catalog: TA808864 Components: CD34 mouse monoclonal
PI3 Kinase Antibodies. NFκB Antibodies. Neuroscience Antibodies. GFP and Epitope Tag Antibodies. Secondary Antibodies. Substrates. Blocking Solutions
PI3 Kinase NFκB Neuroscience AKT is a component of the PI3 Kinase pathway and is activated by phosphorylation at Ser 473 and Thr 308. AKT exhibits tight control over cell proliferation and cell viability.
RayBio Human FRA-2 Transcription Factor Activity Assay Kit
RayBio Human FRA-2 Transcription Factor Activity Assay Kit Catalog #: TFEH-FRA2 User Manual May 2, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in
Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in BL2 cells. The Ponceau S staining of the membranes or
Histone H3K27 Methylation Antibody Panel Pack Base Catalog # C Component Size Shipping Temperature
Histone H3K27 Methylation Antibody Panel Pack Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K27M Histone H3K27me1 (H3K27 Monomethyl) Polyclonal Antibody 25 µg
Antibodies & Assays. Assay Development. Primary Antibodies. Conjugated Secondary Antibodes. Epitope Tag Antibodies. Streptavidin Reagents
Antibodies & Assays Volume 33 Version 5 Assay Development Primary Antibodies Conjugated Secondary Antibodes Epitope Tag Antibodies Streptavidin Reagents For 50 years, ROCKLAND IMMUNOCHEMICALS Inc. has
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction)
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG
Supplemental Table 1 Primers used in study. Human. Mouse
Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc
Macrophage. Adipocyte. Liver. NF-κB NF B 6. TF NF-κB IL-6 PG COX-2 AP 1. NF-κB AP-1 inos CD-36 AP-1 IL-6. basal MCP-1 ABCA1. IL-8 ET-1 NAPDH oxidase
2010년순환기춘계통합학술대회 CD137(4-1BB), 1BB), a TNF Receptor Superfamily, Deficiency Reduces Atherosclerosis in Hyperlipidemic Mice Goo Taeg Oh, DVM., PhD Laboratory of Cardiovascular Genomics Division of Molecular
OX40 MARKET LANDSCAPE
OX40 Agonist OX40 MARKET LANDSCAPE OX40 (a.k.a. CD134) is a costimulatory molecule belonging to the TNF receptor family expressed primarily on activated effector T (T eff) cells and naive regulatory T
Chromatin and Transcription
Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation
Structure of IgG and IgM
Structure of IgG and IgM Fig. 5-1 A,B Crystal Structure of Secreted IgG Fig. 5-1 C Structure of an Ig Domain Fig. 5-2 Proteolytic Fragments of IgG (1) Fig. 5-3A Proteolytic Fragments of IgG (2) Fig. 5-3B
Information Extraction from Biomedical Text
Information Extraction from Biomedical Text BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2009 The Information Extraction Task: Named Entity Recognition Analysis of
TAKING PROTEIN PHOSPHORYLATION MEASUREMENT ONE STEP FURTHER. Alpha SureFire Technology. AlphaLISA SureFire Ultra
TAKING PROTEIN PHOSPHORYLATION MEASUREMENT ONE STEP FURTHER Alpha SureFire Technology AlphaLISA SureFire Ultra IT S THE ASSAY THAT DEFINES NEXT GENERATION If you're developing biotherapeutics whether you're
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody
Human PRLR / Prolactin Receptor ELISA Pair Set
Human PRLR / Prolactin Receptor ELISA Pair Set Catalog Number : SEK10278 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
of signal transduction pathways?
CELL BIOLOGY Signal Transduction + How do you study activation of signal transduction pathways? + IDENTIFICATION OF PATHWAY-SPECIFIC TRANSCRIPTION ACTIVATION + EASIER, FASTER THAN BLOTTING OR GEL-SHIFT
CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone
Histone H3 Methylation Antibody Panel Pack III - Active Genes Base Catalog # C Component Size Shipping Temperature
Histone H3 Methylation Antibody Panel Pack III - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3R17A Histone H3R17 Dimethyl Asymmetric (H3R17me2a)
7.06 Cell Biology QUIZ #3
Recitation Section: 7.06 Cell Biology QUIZ #3 This is an open book exam, and you are allowed access to books and notes, but not computers or any other types of electronic devices. Please write your answers
Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-18 CELL BIOLOGY BIO-5005B Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-
SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning
Humoral Immunity. Humoral Immunity and Complement. B cell Antigens. Location of B Cell Activation. B Cell Activation T-dependent antigens
Humoral Immunity and Humoral Immunity Robert Beatty MCB150 Transfer of non-cell components of blood-- antibodies, complement Humoral immunity = antibody mediated B cell Antigens B Cell Activation of T-dependent
FunctionELISA. (version B1) Catalog Nos & 48505
FunctionELISA IκBα For the detection and analysis of IκBα phosphorylation (version B1) Catalog Nos. 48005 & 48505 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008,
Chromatin Structure and its Effects on Transcription
Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not
Discover more with FluoroSpot
Discover more with FluoroSpot FluoroSpot combines the sensitivity of ELISpot with the capacity to analyze secretion of several analytes simultaneously. This highly sensitive cellular assay is robust, easy
IRAK-M mediates Toll-like receptor/il-1r-induced NFκB activation and cytokine production
The EMBO Journal Peer Review Process File - EMBO-2012-82530 Manuscript EMBO-2012-82530 IRAK-M mediates Toll-like receptor/il-1r-induced NFκB activation and cytokine production Hao Zhou, Mingjia Yu, Koichi
Supplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating
Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low
Visualize cell junctions and cellular adhesion
Cellular Structure Visualize cell junctions and cellular adhesion Antibodies to study specific protein localization and cellular processes Cellular adhesion is essential for providing physical support
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
colorimetric sandwich ELISA kit datasheet
colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL1-beta in serum, plasma and cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity
CALCUTTA UNIVERSITY University College of science 35, Ballygunge Circular Road, Kolkata , India
35, Ballygunge Circular Road, Kolkata 700 09, India Residence :Udayan Flat A-0 25/2B/ Jheel Road, Dhakuria Anindita Ukil,Ph.D Kolkata 700 03 Ref No. BIOCHEM/AU/UGC-IC/Consumable/si RNA/8-9 Dated:23-07-8
Phospho-STAT Panel K15202D N/A
STAT s Complete Base Phospho-STAT Panel K15202D N/A Singleplex s Phospho-STAT3 (Tyr705) K150SVD N/A Phospho-STAT4 (Tyr693) K150PAD N/A Phospho-STAT5a,b (Tyr694) K150IGD K150IGA Total STAT3 K150SND N/A
Model 491 Prep Cell. Bio-Rad Tech Note Summaries. Size, %T Plasma protein 49 kd 12% 60 kd 7% 1773 Recombinant. proteins
Model 491 Prep Cell Bio-Rad Tech Note Summaries 2-D Applications Bulletin Title # Component Preparative 2-D Purifies Proteins for Sequencing or Antibody Production Preparative 2-D Electrophoresis System
Data Sheet HVEM/NF-κB Reporter Jurkat Recombinant Cell Line Catalog # 79310
Data Sheet HVEM/NF-κB Reporter Jurkat Recombinant Cell Line Catalog # 79310 Product Description Recombinant clonal stable Jurkat T cell line expressing firefly luciferase gene under the control of 4 copies
Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity
Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy
Shaping the future of bioassays
Shaping the future of bioassays Company French Company Founded in 2010 Backed up by investment funds Situated in a business park dedicated to health developments projects within the environment of the
SUPPLEMENTARY INFORMATION
doi:.8/nature85 Supplementary Methods Plasmid construction Murine RIG-I, HMGB and Rab5 cdnas were obtained by polymerase chain reaction with reverse transcription (RT-PCR) on total RNA from, and then cloned
B cells Harry W Schroeder Jr MD PhD
B cells Harry W Schroeder Jr MD PhD Division of Clinical Immunology and Rheumatology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Director, UAB Program in Immunology
BEH.462/3.962J Molecular Principles of Biomaterials Spring 2003
Lecture 17: Drug targeting Last time: Today: Intracellular drug delivery Drug targeting Reading: T.J. Wickham, Ligand-directed targeting of genes to the site of disease, Nat. Med. 9(1) 135-139 (2003) Drug
Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex
POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong
RayBio Human jun-b Transcription Factor Activity Assay Kit
RayBio Human jun-b Transcription Factor Activity Assay Kit Catalog #: TFEH-JUNB User Manual Mar 28, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
Make High Quality Affordable
Protein Antibody Gene Kit Cell Lysate Fc receptor Antibody Cancer antigen ed NK-Cell le as Cancer-Cell Perfo r i n a n d G r a n zy r me e Make Quality Affordable Fc receptor Function and s Function:,
Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes
Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein
BIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
Validation & Assay Performance Summary
Validation & Assay Performance Summary CellSensor NFκB RAW. Cell Line Cat. no. K CellSensor Cell-Based Assay Validation Packet This cell-based assay has been thoroughly tested and validated by Invitrogen
Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages
Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages Qun Li, Yves Laumonnier, Tatiana Syrovets, and Thomas Simmet Methods Antibodies and Reagents Antibodies for immunoblotting:
EpiQuik HAT Activity/Inhibition Assay Kit
EpiQuik HAT Activity/Inhibition Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik HAT Activity/Inhibition Assay Kit is very suitable for measuring HAT activity/inhibition
MSD MULTI-SPOT Assay System
MSD MULTI-SPOT Assay System Mouse ProInflammatory 7-Plex Ultra-Sensitive Kit 1-Plate Kit 5-Plate Kit 25-Plate Kit K15012C-1 K15012C-2 K15012C-4 17709-v2-2012Mar 1 MSD Biomarker Assays Mouse ProInflammatory
Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
Supplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
HYPE-293 Transfection Kit Results
HYPE-293 Transfection Kit Results Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 ()26 326 44 5 T BE +32 ()2 53 3 48 Begonialaan 3a F NL +31 ()26 326 44
Immunogenicity of Therapeutic Proteins. Steven J Swanson, Ph.D. Executive Director, Clinical Immunology
Immunogenicity of Therapeutic Proteins Steven J Swanson, Ph.D. Executive Director, Clinical Immunology swanson@amgen.com Causes of Immunogenicity Sequence differences between therapeutic protein and endogenous
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description: