SUPPLEMENTARY INFORMATION

Size: px

Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Emma Todd
6 years ago
Views:

1 SUPPLEMENTY INFORMATION doi: /nature20785 Extended data Fig 1f Extended data Fig 1h 37 KD 37 KD Extended data Fig 1i Extended data Fig 4c Extended data Fig 3b Extended data Fig 4j 37 KD 37 KD Extended data Fig 3a Extended data Fig 3n P- (Y 877) 75 KD 37 KD Supplementary Fig 1 1

2 RESECH SUPPLEMENTY INFORMATION Extended data Figure 4b Extended data Fig 4h Extended data Figure 4d Extended data Fig 4j PGR 75 KD 75 KD Extended data Fig 5c MR (NR3C2) MDA-MB 231 GR (NR3C1) MCF7 Cama1 Extended data Fig 4j HCC1806 Supplementary Fig 1 2

3 SUPPLEMENTY INFORMATION RESECH Supplementary Table 1 Samples used for gene expression analyses. Four types of samples were lasermicrodissected for RNA extraction: normal mammary tissue, EL, primary tumors and lung metastases. Tissue Mouse-strain Age [weeks] mice samples Normal mammary tissue BALB/c 8 and 18 n = 7 n = 10 Early lesions (EL) Balb-NeuT 9 n = 3 n = 7 Primary tumors Balb-NeuT n = 6 n =19 Metastases (Lung) Balb-NeuT n = 3 n = 7 Supplementary Table 2 opossum TF binding enrichment and role of nuclear receptors. A short list of genes specifically expressed in EL samples (300 genes) was loaded into the opossum web based software (version 1). The TF class column in this table indicates nuclear receptors as the main regulators of this profile. TFs bind to differentially expression profile TF Class Target gene hits Target TFBS hits ESR1 NUCLE RECEPTOR HNF1A HOMEO Pax4 PAIRED-HOMEO NR3C1 NUCLE RECEPTOR Ar NUCLE RECEPTOR RORA_2 NUCLE RECEPTOR PPG-RXRA NUCLE RECEPTOR RXRA-VDR NUCLE RECEPTOR PPG NUCLE RECEPTOR 9 10 NF-kappa B REL RORA_1 NUCLE RECEPTOR NR2F1 NUCLE RECEPTOR

4 RESECH SUPPLEMENTY INFORMATION Supplementary Table 3 Genomatix analyses and role of steroid hormone receptors. A shortlist of genes specifically expressed in EL samples (300 genes) loaded into the Genomatix software (v2.0) to identify dominant signaling pathways or networks, which regulate these genes. Five different sub-tables were generated based on different criteria as provided in the heading of each table. The p-value indicates enrichment of the EL list in specific pathways or networks. The column entitled number of involved genes displays the number of genes from the expression profile of EL, which are involved in that particular signaling pathway or network. The rightmost five columns of each table display hormone nuclear receptors involved in that pathway or network. The (+) sign shows the involvement of steroid hormone receptors in the regulation of that given signaling pathway. Note that the progesterone receptor is not showing up in any of pathways possibly due to lacking information used by software or its indirect role acting via its paracrine factors. 5 top ranking canonical signal transduction pathways p value involved genes MAP kinase 3.63 e PgR Nr3C1 Nr3c2 FOXA2&A3 Network 7.13E SMAD2&3 signaling 1.47E P38 MAPK 4.71E TGFBR 1.54E top ranking biological process networks (Gene ontology) p value involved genes Transcription from RNA pol II promoter 1.57E Positive regulation of transcription, DNA dependent 8.20E Regulation of transcription from RNA pol II complex 1.26E Positive regulation of RNA metabolic process 1.02E Positive regulation of gene expression 1.97E top ranking signal transduction pathways (literature mining) p value involved genes Developmental 1.44E CEBP beta 1.44E Histone deacetylase 2.72E Differentiation 6.33E Nuclear receptor subfamily 7.03E PgR PgR Nr3C1 Nr3C1 Nr3c2 Nr3c2 4

5 SUPPLEMENTY INFORMATION RESECH 5 top ranking cellular component networks (Gene ontology) p value involved genes PgR Nr3C1 Nr3c2 Nucleoplasm 1.07E Transcripton factor complex 2.18E Nucleus 2.38E Nuclear lumen 4.38E Nuclear part 5.27E top ranking molecular function networks (Gene ontology) Sequence specific DNA binding transcription factor activity Nucleic acid binding transcription factor activity p value involved genes PgR Nr3C1 Nr3c2 6.16E E Sequence specific DNA binding 1.17E Sequence specific DNA binding RNA pol II transcription 9.28E Regulatory region DNA binding 1.53E Supplementary table 4 Patient data classified based on DCC positivity and PgR/Her2 scores DCC Negative DCC positive IRS= immune reactive score. status no-amplification PGR IRS 2 (+) amplification 3 Total Total Total

6 RESECH SUPPLEMENTY INFORMATION Supplementary table 5 amp /PGR high samples used for double staining for PGR and Her2 in figure 6D Number ID DCC PGR IRS -ICH FISH 1 788/12X positive 12 3 n.a /03 positive 12 3 n.a /10 positive 12 2 positive 4 031/03 positive 12 2 positive 5 210/06 positive 12 2 positive 6 264/06 positive 12 2 positive 7 375/03 positive 9 3 n.a /12 positive 12 3 n.a /03 positive 12 2 positive /03 positive 12 2 positive Supplementary table 6 Samples used for mirna analyses PGR high / neg PGR neg / high PGR high / high Sample ID PGR IRS Score/ amplification T T T T T T T T T T /amp* T T /amp T T T T T T T T T T /amp T T /amp T *Samples with staining score 2 were tested by FISH for amplification; score 3 was considered amplified. 6

7 SUPPLEMENTY INFORMATION RESECH Supplementary table 7 Clinical characteristics of M0 patients used for CGH analyses of BM-derived DCCs Age (median=55) Patient [n=49] < ptis 2 pt 1 28 Tumor stage pt 2 15 pt 3 4 pt 4 0 N 0 27 Lymph node status N 1 18 N 2 3 N 3 0 missing 1 Grading Time point of bone marrow aspiration Systemic therapy before bone marrow aspiration G1 10 G2 27 G3 9 G4 1 missing 2 at surgery 40 within 1st year after surgery 6 Between 1 st and 5 th year after surgery 3 yes 4 no 41 missing 4 7

8 RESECH SUPPLEMENTY INFORMATION Supplementary Table 8 ERα, PGR and status of primary tumors of patient with DCCs undergoing single cell gene expression analysis Patients [n=19] Age (Median) < 55 years years 9 ptis* 2 Tumor stage pt1 10 pt2 7 pt3-4 0 Lymph node status N 0 14 N Grading Hormone receptor status status G1 3 G2 12 G3 4 G4 0 positive 18 negative 1 amplified 0 Nonamplified 17 unknown* 2 *DCIS patients were not tested for status 8

9 SUPPLEMENTY INFORMATION RESECH Supplementary table 9 Antibodies antibody Cat. Number Manufacture Working Concentration B-actin antibody A ML Sigma-Aldrich 1/20,000 for WB PGR (C-20) sc-539 Santa Cruz Biotech 1/100 for all applications (MC-20) sc-542 Santa Cruz Biotech 1/100 for WB (N-20) sc-816 Santa Cruz Biotech 1/100 for WB (H-150) sc-8974 Santa Cruz Biotech 1/100 for WB NR3C2 (GR (p-20)) sc1002 Santa Cruz Biotech 1/100 for WB NR3C1 ( GR ( M-20) ) sc-1004 Santa Cruz Biotech 1/100 for WB EpCAM-Alex647 (clone: G8.8) Biolegend 1/200 for WB α-cd326 (EpCAM)-PE for human Miltenyi Biotec GmbH 1/50 For IF c-erbb-2 (Her2 (clone: PK)) for WB and IF DLN Dianova 1/500 for WB 1/250 for IF for IHC A0485 DAKO 1/250 for IHC Phospho-Her2 for WB 2241 Cell signaling 1/250 for WB Keratins K8/K18 (GP11) GP11 Progen Biotechnik 1/200 for IHC Rabbit IgG Sc-2027 Santa Cruz Biotech 1/200 for IHC Goat anti Rabbit-AF 488 A11017 Life Technologies 1/200 for IF Goat anti mouse-cy Jackson ImmunoResearch 1/200 for all applications Goat anti Guinea pig-cy Jackson ImmunoResearch 1/200 for all applications Guinea Pig IgG CR4 Sino Biological Inc. 1/100 for all applications Anti mouse HRP NA931 GE Healthcare 1/2000 for WB Anti Rabbit HRP NA934 GE Healthcare 1/2000 for WB Anti Goat HRP sc-2020 Santa Cruz Biotech 1/2000 for WB Supplementary Table 10 PCR primers Murine specific Gene 5' Primer 3' Primer Ahnak GTCTTTGTTCAGGAGGTG CCCATGGTATTCAGCAAC Nfatc3 GGAGCAAACCAAAGCCTG CTCGGCTACCTTCAGTTTC Stac3 GATTCTTCCCTCCAAACTTC TAACCACCAGCTTCATCTC Zc3hav1 TTCTTCCACTCCTGTCCC TTCTGCTCCACATCCTTC Baz2a AGTCTCTGGTAGTGGTGATG TGCTTCATTCTCTTCCCAC Nr3c2 CTTTCCGCCTGTCAATGC TCATCTCCACACACCAAGCAG Zfp780b TGGATGCTACTCAGAAGGTC CCTGTCTGTTTCTTCCTTCA Nr3c1 CAAGGGTCTGGAGAGGACAA TACAGCTTCCACACGTCAGC Actb GTGACAGCATTGCTTCTGTG TCTCAAGTCAGTGTACAGGC Wnt4 GCCATCGAGGAGTGCCAATAC GCCACACCTGCTGAAGAGATG Pgr A&B AAGCCAGTTTGAAGAGATG ATTCAAGCAGTACAGGTGG Pgr B AAAGGATCCGCAGGTTCTC GGCGAGACTACAGACGACAC Esr1(α) CCTCCCGCCTTCTACAGGT CACACGGCACAGTAGCGAG GAACTACATCAAGGAACTCG TATGGGACTTGATTAGCAG Esr2 (β) TCTCTTCCCAGCAGCAGTC GCATTCAGCATCTCCAGC Rankl CCTCACCATCAATGCTGC TACGCTTCCCGATGTTTC Rank TCTCATCGTTCTGCTCCTC TTGCTGACTGGAGGTTGC Human specific Gene 5' Primer 3' Primer PGR A&B CCAGCCAGAGCCCACAATAC GTTGTGCTGCCCTTCCATTG ACTB TGGACATCCGCAAAGACCTG GGGTGTAACGCAACTAAGTCAT TTGGCCAGTACCAATGACAA GGCAGCTCTTCCTCCTGTTT (exon16 del) CCTACATGCCCATCTGGAAG GCAGAGATGATGGACGTCAG (wt) GCTGAACAATACCACCCCTG GAGCCAGCTGGTTGTTCTTG EEF1A1 TGCCCCAGGACACAGAGACT CTGTGTCGGGGTTGTAGCCA GAPDH AATCCCATCACCATCTTCCAG GCCATCACGCCACAGTTTCC 9

10 RESECH SUPPLEMENTY INFORMATION Supplementary Table 11 mirna Sequences mirna Ref Sequence mimic mirna Mimic Sequence mmu-mir-30a-5p uguaaacauccucgacuggaag mmu-mir-30a-5p F TGTAAACATCCTCGACTGGAAG mmu-mir-30a-5p R CTTCCAGTCGAGGATGTTTACA mmu-mir-30a-3p cuuucagucggauguuugcagc mmu-mir-30a-3p F CTTTCAGTCGGATGTTTGCAGC mmu-mir-30a-3p R GCTGCAAACATCCGACTGAAAG mmu-mir-21a-5p uagcuuaucagacugauguuga mmu-mir-21a-5p F TAGCTTATCAGACTGATGTTGA mmu-mir-21a-5p R TCAACATCAGTCTGATAAGCTA mmu-mir-25-3p cauugcacuugucucggucuga mmu-mir-25-3p F CATTGCACTTGTCTCGGTCTGA mmu-mir-25-3p R TCAGACCGAGACAAGTGCAATG mmu-mir-92a-3p uauugcacuugucccggccug mmu-mir-92a-3p F TATTGCACTTGTCCCGGCCTG mmu-mir-92a-3p R CAGGCCGGGACAAGTGCAATA mmu-mir-340-5p uuauaaagcaaugagacugauu mmu-mir-340-5p-f TTATAAAGCAATGAGACTGATT mmu-mir-340-5p-r AATCAGTCTCATTGCTTTATAA mmu-mir-9-5p ucuuugguuaucuagcuguauga mmu-mir-9-5p-f TCTTTGGTTATCTAGCTGTATGA mmu-mir-9-5p-r TCATACAGCTAGATAACCAAAGA mmu-mir-92a-1-5p agguugggauuugucgcaaugcu mmu-mir-92a-1-5p F AGGTTGGGATTTGTCGCAATGCT mmu-mir-92a-1-5p R AGCATTGCGACAAATCCCAACCT mmu-mir-21a-3p caacagcagucgaugggcuguc mmu-mir-21a-3p F CAACAGCAGTCGATGGGCTGTC mmu-mir-21a-3p R GACAGCCCATCGACTGCTGTTG 10

TheraLin. Universal Tissue Fixative Enabling Molecular Pathology

TheraLin. Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology Contents Page # TheraLin Universal Tissue Fixative 3 Introduction 5 Easy